Promoting mechanism of serum amyloid a family expression in mouse intestinal epithelial cells.

Serum amyloid A (SAA) is an acute phase inflammatory protein that we previously described as a robust biomarker of colorectal inflammation in patients with ulcerative colitis (UC) in clinical remission. However, what induces SAA expression in UC remains unclear. This study demonstrates that SAA is significantly expressed in the intestinal tract of UC mouse models when compared with C-reactive protein, another inflammatory biomarker. Moreover, interleukin-6 and tumor necrosis factor-α were found to promote SAA1 expression, as were Toll-like receptor ligands flagellin and lipopolysaccharide. Furthermore, results suggested that the nuclear factor-kappa B (NF-κB) pathway may be involved in the promotion of SAA1 expression by flagellin, which was inhibited by treatment with 5-aminosalicylic acid (5-ASA). Therefore, the flagellin/NF-κB/SAA1 axis may represent one of the mechanisms by which 5-ASA suppresses intestinal inflammation.

Introduction

Serum amyloid A (SAA) is a 12 kDa acute phase protein encoded by the SAA genes located on human chromosome 11, among which SAA1 and SAA2 encode acute phase proteins, SAA3 is a pseudogene, and SAA4 is constitutively expressed and is not definitively associated with inflammation [1]. SAA expression is usually induced in response to infection or acute injury and promotes inflammation through the induction of inflammatory cytokine production and subsequent recruitment of granulocytes, monocytes, and T lymphocytes [2]. It is believed that SAA promotes T-helper 17 (Th17) differentiation and induces inflammation [3, 4]. Th17 cells and other interleukin (IL)-17-producing T cells play important roles at the intestinal mucosal surface and contribute to the regulation of symbiotic organisms that constitute the microflora by protecting them from pathogenic bacteria and fungi [5]. However, excessive Th17 responses can promote autoinflammatory diseases such as Crohn’s disease, rheumatoid arthritis, and multiple sclerosis [6]. We previously reported that SAA performs well as a biomarker of endoscopic mucosal activity in clinical remissive (Rachmileswitz clinical activity index of 4 or less) ulcerative colitis (UC) [7]. Endoscopic inflammation is often experienced even in during clinical remission of UC. Such patients may not exhibit elevated C-reactive protein (CRP), rendering CRP ineffective as a biomarker but SAA can compensate for this issue. In addition, it has been reported that SAA is a better inflammation biomarker than C-reactive protein (CRP) in diseases other than UC [8]. The mechanism underlying SAA expression in the liver has only been investigated in hepatocellular carcinoma cell lines [9]. Thus, whether the same mechanism acts in normal cells remains unclear. SAA expression in the intestinal epithelium has been confirmed by immunostaining and in situ hybridization [4, 10]. However, knowledge gaps remain regarding the mechanism of SAA expression in the intestinal epithelium. SAA expression was promoted by IL-22 in normal mouse cells [11], by lipopolysaccharide (LPS) in mouse colorectal cancer cell lines [10], as well as by a combination of IL-1ß, IL-6, and tumor necrosis factor-α (TNF-α) in human colorectal cancer cell lines [12]. The purpose of this study was to determine the main organ of SAA expression in enteritis as well as the underlying mechanism of SAA expression in the normal intestinal tract. To shed light into this matter, we compared the expression of SAA and CRP using a dextran sulfate sodium (DSS)-induced enterocolitis mouse model, and investigated whether SAA expression could be promoted in normal cells by stimulating small intestinal organoids with various cytokines and Toll-like receptor (TLR) ligands, such as flagellin and LPS. Human SAA3 is a pseudogene, whereas mouse SAA3 is expressed by adipocytes and macrophages. However, human and mouse SAA1 are highly homologous and are often used as research models [13]. In addition, SAA1 works mainly as an inflammatory protein. This study primarily focuses on the role of SAA1 in enteritis, and the expression levels of the subtypes SAA2-4 were also examined.

Materials and methods

Antibodies and reagents

Recombinant murine IL-1β (#211-11B), IL-6 (#216–16), IL-10 (#210–10), and IL-22 (#210–22) were purchased from PeproTech (Cranbury, NJ, USA). Recombinant mouse IL-23 (#1877-ML) and anti-SAA1 goat antibody (#AF2948) were purchased from R&D Systems (Minneapolis, MN, USA). Flagellin from Salmonella typhimurium (#tlrl-stfla) was purchased from InvivoGen (San Diego, CA, USA). LPS was purchased from Sigma-Aldrich (St. Louis, MO, USA). TNF-α (#203–14261) was purchased from Fujifilm Wako Pure Chemical Corporation (Osaka, Japan). Anti-p-NF-κB rabbit antibody (#3033) and inhibitor kappa Bα (IκBα) antibody (#9242) were purchased from Cell Signaling Technology (Danvers, MA, USA). 5-aminosalicylic acid (5-ASA) was provided by Kyorin Pharmaceutical Co. (Tokyo, Japan), and was dissolved in culture medium at 40 mmol/L (pH 7.2 adjusted with NaOH) as described previously [14]. The NF-κB inhibitor BAY11-7082 (#T2846) was purchased from Tokyo Kasei (Tokyo, Japan).

Mice

Specific pathogen-free C57BL/6 (B6) mice were purchased from CLEA Japan (Tokyo, Japan). All mice were housed under pathogen-free conditions in microisolator cages in the animal facility at the Hiroshima University, under 12 h light-dark cycles with access to water and food ad libitum. The health of the mice was monitored every day, and the animals were maintained in accordance with the Guidelines for the Care and Use of Laboratory Animals established by the Hiroshima University. This study was approved by the Committee on the Ethics of Animal Experiments of Hiroshima University (Permit Number: A18-27). All mice underwent cervical dislocation euthanasia after administration of medetomidine hydrochloride, midazolam, and butorphanol.

DSS-induced colitis model

Female mice (7 weeks of age) were divided into two groups (6 mice/group) that were treated with or without 2.5% DSS (MW: 5 kDa; Wako Chemical, Osaka, Japan) in the drinking water for 7 days. After completion of the treatment, the animals were sacrificed, and the liver, terminal ileum, ascending colon, and rectum were collected.

Two replicates of the DSS-induced colitis model experiment were performed and results were found to be reproducible.

Protein analysis

Total protein was extracted from the small intestine organoid using RIPA lysis and extraction buffer (Thermo Fisher Scientific Waltham, MA #89901) with protease inhibitor (Roche, Basel, Switzerland #10276200). After incubation for 5 min at room temperature, cell lysates were centrifuged at 12,000 rpm and 4°C for 20 min to collect protein lysates. After determination of protein concentration using a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific #89901), automated quantitative western blotting (Wes assay) was performed on a Wes instrument (Protein Simple, San Jose, CA) according to the manufacturer instructions. GAPDH, phosphorylated-p65, and IκBα antibodies were used at a dilution of 1:100.

Real-time polymerase chain reaction (PCR)

RNA was isolated from different organ and organoid samples using a RNeasy Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. cDNA was synthesized from 1,000 ng of total RNA using a Reverse Transcription Kit (Qiagen), and quantitative PCR was performed with the SYBR Green Master-Mix (Qiagen) using a Light Cycler (Roche, Basel, Switzerland) according to the manufacturer’s recommended protocol. Samples were normalized for ACTB expression in each organ and small intestinal organoid. The primer sequences used were as follows: SAA1 forward 5’–AAATCAGTGATGGAAGAGAGGC–’3 and reverse 5’–CCCCAGCACAACCTACTGAG–’3; SAA2 forward

5’–TGCTGAGAAAATCAGTGATGCAA–’3 and reverse

5’–CCCAACACAGCCTTCTGAAC–’3; SAA3 forward

5’–AAGAAGCTGGTCAAGGGTCTA–’3 and reverse

5’–TCTTTTAGGCAGGCCAGCAG–’3; SAA4 forward

5’–GGGAGGTCTTGCTCGTGATT–’3 and reverse

5’–AAGTCCCAAGTCCCTTGTACG–’3; SAA4 forward

5’–GGGAAGCCGTACAAGGGACT–’3 and reverse

5’–CCTCGGGTCGGAAGTGATTG–’3; CRP forward 5’–CAGATCCCAGCAGCATCCAT–’3 and reverse 5’–CCTTTTTAAACATGTCTTCATGACC–’3; ACTB/S 5’–AGATCAAGATCATTGCTCCTCCT–’3 and ACTB/SA 5’–ACGCAGCTCAGTAACAGTCC–’3.

Immunofluorescence staining

Frozen specimens cut into 4-μm sections were placed on glass slides and fixed for 15 min in 4% paraformaldehyde in phosphate-buffered saline (PBS) solution. The slides were briefly blocked in protein blocking solution and incubated with an anti-SAA1 goat antibody (1:50 dilution) and anti-p-NF-κB rabbit antibody (1:200 dilution) overnight at 4°C. The slides were washed with PBS and incubated for 1 h at room temperature with Alexa Fluor 488- and 568-labeled secondary antibodies. Nuclei were counterstained with 4’,6-diamidino-2-phenylindole for 10 min, and mounting medium was placed on each specimen with a glass coverslip. SAA1 was identified by red fluorescence, whereas p-NF-κB was identified by green fluorescence. Negative controls were photographed under the same conditions (exposure time, etc.) to confirm the absence of autofluorescence.

Murine organoid culture establishment and maintenance

Small intestine tissue collected from euthanized mice was used to establish organoids referring to the method reported by Sato et al. [15]. The fat and blood vessels were removed. The distal jejunum was collected (approximately 5 cm), and the lumen of the intestine was washed with PBS to remove contents and mucus. Next, the tissue was finely chopped, thoroughly washed with ice-cold PBS, placed in a 2.5 mM EDTA/PBS solution, and incubated in a refrigerator at 4°C for 30 min. Intestinal crypts were sequentially extracted by five rounds of mechanical shearing in PBS. After filtration using a 70 μm filter, the cells were washed with PBS and pelleted (300 μg, 3 min, 4°C). The isolated intestinal crypt was embedded in a 35 μL Matrigel (Corning, Bedford, MA, USA) dome and stored in complete IntestiCult organoid growth medium (Stemcell Technologies, Vancouver, Canada) at 37°C and 5% CO2. Immediately before use, the desired antibiotics were added to fresh or thawed IntestiCult Organoid Growth Medium supplemented with 50 μg/mL gentamicin (nacalai tesque, Kyoto, Japan) and 100 units/100 μg per mL penicillin/streptomycin (Wako Chemical). The medium was replaced every 2–3 days, and the organoids were subcultured every 7–9 days by mechanical shearing and reimplantation in the 35 μL Matrigel dome at a split ratio of 1:2 to 1:3.

Cell stimulation

To investigate the effect of cytokines on SAA expression, small intestinal organoids were stimulated with IL-1β (100 ng/mL), IL-6 (10 ng/mL), IL-10 (50 ng/mL), IL-22 (50 ng/mL), IL-23 (50 ng/mL), or TNF-α (10 ng/mL) for 24 h. In addition, the organoids were exposed to flagellin (10 μg/mL) or LPS (1 μg/mL) for 3 h, respectively, to investigate the effect of TLR ligands on the expression of SAA. The BAY11-7082 (20 μM) inhibitor was used to assess involvement of the NF-κB pathway in SAA expression, and 5-ASA (40 mM), commonly used for UC treatment, was also administered. The intestinal organoids were incubated with each inhibitor 1 h prior to adding flagellin.

Statistical analyses

All statistical analyses were performed using EZR (Saitama Medical Center, Jichi Medical Center), a graphical user interface for R (The R Foundation for Statistical Computing, version 2.13.0) [16]. The Mann–Whitney U test was performed to compare multiple groups. A P-value < 0.05 was considered to indicate a statistically significant difference.

Results

DSS-induced colitis enhances intestinal SAA expression in vivo

Using the DSS enterocolitis mouse model, the expression of SAA1-4 and CRP was evaluated in the liver and several parts of the intestinal tract to determine the main organ of SAA expression in enteritis. We hypothesized that the high sensitivity of SAA was a result of SAA being expressed primarily in the intestinal tract; however, SAA1-4 was expressed primarily in the liver (Fig 1A). Next, the expression of SAA1-4 in the liver, terminal ileum, ascending colon, and rectum was compared between the control group (untreated mice) and DDS-treated model mice. SAA1 expression level was higher in the DSS group for all tested samples (Fig 1B), suggesting that DSS-induced inflammation in the intestinal tract significantly enhanced local SAA1 expression. SAA2 was significantly upregulated in organs other than the ascending colon (Fig 1C). SAA3 expression level was not increased in the terminal ileum and ascending colon but was significantly increased in the liver and rectum. In particular, SAA3 expression level was strongly increased in the rectum (Fig 1D). SAA4 expression was also significantly upregulated in the liver and rectum (Fig 1E). In contrast, DSS treatment suppressed SAA4 expression in the ascending colon (Fig 1E). However, it is not surprising that the expression level of SAA4 was reduced because SAA4 expression is not associated with inflammation.

Fig 1

Expression of SAA1-4/CRP in the liver and intestine of mice with dextran sulfate sodium (DSS)-induced colitis.

(A) Normalized CRP and SAA expression levels in the liver and each part of the intestinal tract 7 days after DSS administration. (B) After DSS administration, SAA1 expression level increased in the liver, terminal ileum, ascending colon, and rectum when compared to untreated controls. (C) SAA2 was significantly upregulated in organs other than the ascending colon. (D) SAA3 expression level was significantly increased in the liver and rectum but not in the terminal ileum and ascending colon. In particular, SAA3 expression level was strongly increased in the rectum. (E) SAA4 expression was significantly upregulated in the liver and rectum. On the contrary, in the ascending colon, treatment with DSS suppressed the expression of SAA4. Data are represented as the mean ± standard deviation (n = 6) upon normalization to ACTB expression. **P < 0.01 and *P < 0.05 versus untreated controls. N.D., not detected; L, liver; TI, terminal ileum; PC, proximal colon; R, rectum.

Inflammatory cytokines promote SAA expression in small intestinal organoids

Next, we evaluated whether different cytokines could impact the expression of SAA in mouse small intestinal organoids. In addition to IL-22, which upregulates SAA1 as previously reported [11], our study revealed that IL-6 and TNFα upregulate SAA1 in the intestinal epithelium (Fig 2A, 2B, and 2E). No statistically significant difference was observed for IL-1β, however, SAA1 expression level tended to increase in the presence of this cytokine (Fig 2C). SAA1 expression level remained unaltered in the presence of IL-23 (Fig 2D). IL-1β (1, 50, 100 ng/mL) and IL-23 (10, 50, 100 ng/mL) levels were also tested and similarly showed no significant induction of SAA in intestinal organoid cultures. In contrast, SAA1 expression was inhibited by IL-10, but this result was not statistically significant (Fig 2F), which is consistent with previous reports demonstrating that IL-10 is an anti-inflammatory cytokine that can suppress colitis [17, 18]. It was difficult to evaluate SAA2 and SAA4 expression because their expression levels were not quantifiable (Fig 2A–2F). The expression level of SAA3 was significantly increased by IL-22 and IL-23 (Fig 2D and 2E). However, unexpectedly, SAA3 was downregulated by IL-1β (Fig 2C).

Fig 2

SAA1-4 expression in mouse small intestinal organoids upon stimulation with several cytokines.

Normalized SAA expression levels in small intestinal organoids upon stimulation with (A) IL-6 (10 ng/mL), (B) TNF-α (10 ng/mL), (C) IL-1β (100 ng/mL), (D) IL-23 (50 ng/mL), (E) IL-22 (50 ng/mL), or (F) IL-10 (50 ng/mL) for 24 h. Only IL-6, TNF-α, and IL-22 promoted a significant increase in SAA1 expression level when compared with untreated controls. Although not statistically significant, the expression level of SAA1 tended to increase upon IL-1β stimulation and was suppressed by stimulation with IL-10. It was difficult to evaluate SAA2 and SAA4 expression because their expression levels were not detectable (A-F). The expression level of SAA3 was significantly increased by IL-22 and IL-23 (D, E). However, unexpectedly, SAA3 was downregulated by IL-1β (C). SAA expression level was normalized to that of ACTB and is represented as the mean ± standard deviation (n = 5). **P < 0.01 versus untreated controls. N.S., not significant; N.D., not detected.

Toll-like receptor (TLR) stimulation promotes SAA expression in vitro via the NF-κB pathway

TLR4, which recognizes LPS (a component of the outer membrane of Gram-negative bacteria), and TLR5, which recognizes flagellin (a major structural protein in bacterial flagella), have been reported to induce inflammatory cytokine production via NF-κB [19-23]. NF-κB was also previously reported to be involved in the induction of SAA expression [24]. Therefore, we questioned whether SAA expression in intestinal epithelial cells could be enhanced via TLR-stimulated NF-κB signaling triggered by flagellin or LPS. The addition of flagellin or LPS to small intestinal organoid cultures significantly increased the expression level of SAA1/3 (Figs 3A and S1A). Interestingly, the presence of an NF-κB inhibitor (BAY11-7082) suppressed the flagellin-induced SAA1/3 expression (Fig 3A). Immunofluorescence staining also showed that flagellin strongly induced SAA1 expression, and NF-κB inhibitors suppressed flagellin-induced SAA expression in intestinal epithelial cells (Fig 3B). As previously reported, SAA3 was induced by flagellin via NF-κB, and the same pathway was thought to be involved in SAA1 induction [25]. In contrast to the flagellin pathway, LPS-mediated SAA expression is NF-κB-independent (S1B Fig). The expression of SAA2 and SAA4 was not observed after stimulation with LPS or flagellin (Figs 3A and S1A).

Fig 3

Flagellin promotes SAA1-4 expression in small intestinal organoids via NF-κB.

(A) Normalized SAA expression levels in small intestinal organoids upon stimulation with Toll-like receptor ligands flagellin (10 μg/mL) for 3 h. The addition of flagellin significantly increased the expression level of SAA1/3, an effect that was inhibited by NF-κB inhibitor BAY11-7082 (20 μM). SAA expression level was normalized to that of ACTB and is represented as the mean ± standard deviation (n = 5). **P < 0.01. (B) Immunostaining of mouse small intestinal organoids confirmed that flagellin enhanced SAA1 levels. This effect was suppressed in the presence an NF-κB inhibitor. All samples were photographed under the same conditions. Negative controls were also photographed under the same conditions (exposure time, etc.) to confirm the absence of autofluorescence. Scale bar, 10 μm.

5-ASA suppresses the production of SAA1 via NF-κB

In previous reports, NF-κB was suppressed by 20–40 mM 5-ASA in HCT-116 and Caco-2 human colon cancer cell lines [26, 27]. Based on these findings, SAA expression was evaluated in the presence of flagellin with or without 40 mM 5-ASA. mRNA analysis revealed that SAA1/3 expression was suppressed by the presence of 5-ASA (Fig 4A). In normal cells, NF-κB is mainly found in the cytoplasm in its inactive form, associated with inhibitory proteins I kappa B (IκB)-α and p100. However, upon receiving the activation signal, inhibitory proteins are degraded, while NF-κB is activated and translocates into the nucleus where it functions as a transcription factor [28]. In fact, the IκB protein degradation was observed after 30 min of flagellin stimulation of small intestinal organoids (Fig 4B). The protein expression level of IκB was then increased at 3 h after flagellin stimulation, which may be because IκB is restored at 2 h, as previously reported [27]. In addition, sulfasalazine reportedly represses IκBα gene expression [29], and the protein expression of IκBα was also repressed by 5-ASA in the present study (Fig 4B). It has been reported that 5-ASA exerts its anti-inflammatory effect by inhibiting NFκB phosphorylation [27]. In this study, the inhibition of p65 phosphorylation by 5-ASA was not apparent at 30 min but clear 3 h after flagellin stimulation. (Fig 4B). When TLR stimulation was induced via flagellin in the small intestinal organoid, immunofluorescence revealed that NF-κB translocated into the nucleus (Fig 4C). Taken together, these results suggested that flagellin-induced SAA expression in normal small intestinal epithelium is mediated by the NF-κB pathway. Furthermore, immunofluorescence revealed that NF-κB translocation into the nucleus was suppressed by the addition of 5-ASA (Fig 4C). Thus, 5-ASA prevented NF-κB nuclear translocation, in turn suppressing SAA expression.

Fig 4

5-Aminosalicylic acid (5-ASA) suppresses SAA1-4 expression via NF-κB in small intestinal organoids.

(A) Normalized SAA expression levels in small intestinal organoids upon stimulation with flagellin alone (10 μg/mL) or plus 5-ASA (40 mM) after 3 h. SAA1/3 was suppressed by the addition of 5-ASA. SAA expression level was normalized to that of ACTB and is represented as the mean ± standard deviation (n = 5). **P < 0.01, *P < 0.05. (B) Small intestinal organoids were stimulated with flagellin at 30 min and 3 h with and without 5-ASA. The protein expression levels of phosphorylated-p65 and IκB were examined by SimpleWesternTM. The protein degradation of IκB was observed after 30 min of flagellin stimulation of small intestinal organoids, and the protein expression of IκBα was also repressed by 5-ASA. The inhibition of p65 phosphorylation by 5-ASA was not apparent at 30 min but clear 3 h after flagellin stimulation. This experiment was performed twice independently, and similar results were obtained. A scan of the original untrimmed gel image is displayed in S2 Fig. (C) Flagellin promotes activation of the NF-κB pathway, as observed by immunostaining data showing translocation of NF-κB into the nucleus. Immunofluorescence confirmed that NF-κB translocation into the nucleus was inhibited with the addition of 5-ASA. Each negative control was photographed under the same conditions (exposure time, etc.) to confirm the absence of autofluorescence. Scale bar: 10 μm.

Discussion

To date, it has been reported that SAA is a superior inflammatory biomarker to CRP in certain diseases [8]. We previously reported that SAA performed well as a biomarker of endoscopic mucosal activity in clinical remissive UC [7]. This led us to question why SAA was more sensitive than CRP in clinical remissive UC. One possibility is that SAA expression level in the intestinal tract is higher than CRP expression level. To address this, the expression levels of SAA and CRP in the intestinal tract of DSS-induced enterocolitis mouse models were detected. Although SAA expression was mainly detected in the liver, it was also found to be significantly upregulated in the intestinal tract upon DSS treatment, in contrast to CRP which was not expressed in the intestinal tract. When UC is active, cytokines produced in the intestinal tract can reach the liver via the portal vein, potentially inducing the expression of CRP. However, in clinical remissive mild UC, the inflammatory process is localized to the intestinal tract, and thus, cytokines may remain there rather than travel throughout circulation. This may be one of the reasons for the superior performance of SAA as a biomarker of intestinal inflammation in clinical remissive UC.

The regulatory mechanisms controlling SAA expression are poorly known and may differ between cancer and normal cells. To unveil these molecular mechanisms, mouse small intestinal organoids composed of normal cells were used. Stimulation of organoids with cytokines, such as IL-6, IL-22, and TNF-α, as well as TLR ligands (flagellin and LPS) promoted SAA1 expression, suggesting that SAA could be produced independently in the intestine. A previous study had already demonstrated that IL-22 could enhance SAA expression in small intestinal organoids [11]. However, the data described herein reveals the involvement of additional cytokines in the regulation of SAA production. Therefore, the signaling network underlying SAA regulation may be more complex than initially presumed. In addition, the promotion of SAA production by flagellin and LPS is thought to be involved in immune activation by bacteria. Segmented filamentous bacteria (SFB), which engraft in the intestinal epithelium, were described to induce SAA expression through the activation of innate lymphoid cells and the promotion of Th17 cell differentiation [11]. Moreover, there are also reports that SFB contains flagellin [30], which may be involved in SAA production.

Further experiments revealed that the expression of SAA was suppressed by adding 5-ASA to the small intestinal organoid. 5-ASA is known to inhibit the phosphorylation of NF-κB at certain concentrations [26, 27], in turn downregulating SAA production.

The effect of 5-ASA on nuclear translocation of NF-κB is currently unknown due to contradictory experimental findings. A previous report has stated that 5-ASA does not inhibit nuclear translocation [29], whereas another paper demonstrated nuclear translocation by 5-ASA in a cancer cell line [31]. In this paper, we demonstrate that 5-ASA inhibits the nuclear translocation of p65 in a normal cell line. We also hypothesize that SAA is a direct target gene of NFκB, as it has been previously shown that the NFκB binding region (5’-GGGACTTTCC-’3) is present in the enhancer region of the SAA gene [32]. 5-ASA is the most used drug for the treatment of UC, suppressing inflammation of the intestinal tract. The data described herein revealed that one of the mechanisms by which 5-ASA exerts its anti-inflammatory effects may be through the direct suppression of SAA expression in the intestinal epithelium, similarly to anti-inflammatory cytokine IL-10.

In conclusion, in a mouse model of DSS enteritis, SAA is also expressed in the intestinal tract but is mainly expressed in the liver. Proinflammatory cytokines such as IL-6, TNF-alpha, and IL-22 induce SAA in normal intestinal epithelium. TLR stimulation with flagellin induces SAA via NF-κB, and 5-ASA inhibits this pathway and suppresses SAA expression. The non-NF-κB-dependent pathway that may be involved in the induction of SAA expression by LPS is a subject of future research.

The lipopolysaccharide (LPS)-induced increase in serum amyloid A (SAA) expression is independent of the NF-κB pathway.

The addition of LPS significantly increases the expression level of SAA1/3 (A), an effect that is not inhibited by the NF-κB inhibitor, BAY11-7082 (B). The SAA expression level was normalized to that of ß-actin (ACTB) and is presented as the mean ± standard deviation (n = 5). **P < 0.01.

(TIF)

Click here for additional data file.

Scan of the original untrimmed gel image of Fig 4B.

(TIF)

Click here for additional data file.

26 Aug 2021

PONE-D-21-23414

Promoting mechanism of serum amyloid A family expression in mouse intestinal epithelial cells

PLOS ONE

Dear Dr. Hayashi,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Oct 10 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:  http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at  https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Wendy Huang, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for including your ethics statement in the online submission form. Please ensure you include this statement (both the name of the ethics committee that approved your study, and the method of euthanasia) in the manuscript Methods.

3. Please include your full ethics statement in the ‘Methods’ section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors previously published their finding that SAA can be used better for biomarker as well as endoscopic mucosal activity in ulcerative colitis rather than well-used biomarkers, such as CRP. In this manuscript, they aimed to determine the major organs of SAA expression as well as the underlying mechanisms of SAA expression in the GI tract using the DSS mouse model. To improve it, there were several concerns in this manuscript.

Major

I would like to know that the experiment was repeated, especially DSS colitis. If it was repeated, please mention that in the text (Materials and Methods). The error bars of SD was relatively big. Showing each value as a dot must be the best approach for all the readers. Please show all the RT-PCR data in the graphs using dot plots.

Please explain how the authors determined the concentration of these cytokines for the detection of SAAs. Basically, the authors should have had several titrations (dilution) to optimize the experiment. The concentration which showed saturated expression of SAA must not be used.

In this study, the best option was to use human organoids to check the SAAs expression; even the authors used the DSS animal model in Figure 1. Please consider doing this experiment. So far, only using cell line and mouse organoid are very weak.

The biggest concern (issue) in this paper was the analyzing method for the RT-PCR data. What does “normalized SAA expression” mean? All the data looks like a relative expression somewhere. Each data sets have 1.0 in somewhere. Did the author set one data set 1.0, and then relative levels were presented? In the method section, it was mentioned that samples were normalized for (must be by) ACTB expression in each organ and organoid). This was the right way. However, the expression of SAAs was quite low. For example, if you have just 0.00001 for SAA1 in untreated, then they should not use the relative expression. If the quite low value was set as 1.0, then the obtaining relative expression value must be really high, and all the samples are messed up and cannot be compared. Based on this point, all the data did not completely make sense. The authors must learn this and re-analyze all the RT-PCR data correctly.

Minor:

It would be interesting if the author shows the expression levels of cytokine receptors using organoids (ideally both mouse and human organoids).

Please show fluorescent minus one for the immunohistochemistry data for Figures 3C and 4B)

Please provide the information about 5-ASA. Need to explain in more detail why the authors used this drug? What are the differences between NFkb inhibitors (BAY11-7082) and 5-ASA? The author mentioned that In previous reports, NF-κB was suppressed by 20–40 mM 5-ASA in HCT-116 and Caco-2 human colon cancer cell lines. Then what was the purpose of the use of 5-ASA? It sounds just like a very similar experiment.

Reviewer #2: In this manuscript, Wakai et al. present data which leads them to conclude that the expression of serum amyloid A (SAA), in particular SAA1, is regulated by the NF-kB signaling pathway through toll-like receptor (TLR) stimulation in ulcerative colitis (UC) mouse model. SAA is significantly expressed in the intestinal track of UC mouse model and a good inflammatory biomarker. However, the mechanism underlying SAA expression remains to be. Using a dextran sulfate sodium (DSS)-induced enterocolitis mouse model, the authors study SAA expression by various cytokines and TLR ligands. The pre-treatment with an NF-kB inhibitor, BAY11-7082, dampened the expression of SAA mRNA leads the authors to conclude that TLR stimulation induces SAA via NF-kB. This is an interesting topic; however, I found some of the data are relatively weak to support the conclusion with the following major concerns.

1) In Figure 3, the authors showed both LPS (through TLR4) and flagellin (through TLR 5) induced SAA1 and 3’s mRNA expression. However, the NF-kB inhibitor BAY11-7082 treatment was only done in flagellin (Fig 3B) but LPS (Fig 3A) stimulation. LPS is known to activate both canonical and non-canonical NF-kB signaling. Do the authors have any idea/data suggesting with pathways it is?

2) After pre-treatment with BAY11-7082, the NF-kB activities was not monitored. BAY11-7082 was known to inhibit IkBalpha phosphorylation, as well as directly inhibit functions on the NLRP3 inflammasome by blocking the sensor's ATPase activity. Therefore, showing the IkBa’s protein degradation and NF-kB nuclear translocation is necessary to support the inhibitory effects of SAA expression was through NF-kB signaling.

3) If the expression of SAA is regulated by NF-kB, is SAA a direct target gene of NF-kB or it is a secondary effect of NF-kB activation? If it is a direct target gene, what is the kB binding site(s)?

4) The authors only showed SAA mRNA expression level upon different cytokines and TLR ligands stimulation, how about the SAA proteins’ expression level? It will be interest to see the protein level as well.

5) In general, all the gene expression figures have huge error, especially Figure 1 and 2; some panels the error bar is larger than the bar graph itself. Figure 1A does not have p-value either. Box & Whisker plots with overlay of individual data points are needed to show the significance of the data.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

26 Nov 2021

We have revised the manuscript in accordance with the suggestions made by the editor and reviewers. Please refer to the response to reviews for more details.

Submitted filename: Response_to_Reviews.docx

Click here for additional data file.

6 Jan 2022

2 Feb 2022

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Reply:

We have confirmed that the reference list is complete and accurate.

In response to Reviewer #1, point #2, the authors stated that “We examined the expression of SAA with these cytokines in a concentration-dependent manner… and found no significant difference”. No data figure were shown. The authors should at least include in the revised Result text section the exact range of the concentrations tested that yield the negative result. For example, “IL-1β (1, 100, 1000 ng/mL) and IL-23 (5, 50, 500 ng/mL) were also tested and similarly returned no significant induction of SAA in the intestinal organoid culture.”

Reply:

Thank you very much for your valuable suggestion. We have added the following text to the Results section (Page 11, Lines 222–224):

“IL-1β (1, 50, 100 ng/mL) and IL-23 (10, 50, 100 ng/mL) levels were also tested and similarly showed no significant induction of SAA in intestinal organoid cultures.”

Related to Reviewer #2, point #1: On page 12 of the text, the text stated “Figure 3. Flagellin and lipopolysaccharide (LPS) promote SAA1-4 expression in small intestinal organoid via NF-kB”. However, Fig 3 only included NF-kB inhibition results in the Flagellin condition, but not the LPS treatment. Therefore, Reviewer #2 asked NF-kB inhibitor to be tested on LPS treated cells. As the authors noted on page 59 of the point-by-point, result of this additional experiment suggest LPS induced SAA expression is NF-kB independent (data not shown). Given this new information, the authors should consider moving the Figure 3A(LPS) panel to a separate figure and take “LPS” out of the Figure 3 title/legend etc – the current writing would give readers the wrong impression that LPS induced SAA is dependent on NFkB. Instead, LPS+NFkB inhibitor results should be shown under a separate figure - texts in the results section should include description of the negative result (e.g. In contrast to the flagellin pathway, LPS induced SAA expression is NF-kB independent.). Discussion should be revised to comment on potential non-NFkB dependent pathway that maybe involved in LPS induced SAA expression subject to future studies.

Reply:

We agree with the pertinent comments made by you. In accordance with your suggestion, the two graphs showing the change in SAA expression with LPS have been separated into separate figures (Supplement Fig 1A and 1B). We have also removed the word “LPS” from the title of Figure 3. In contrast to the flagellin pathway, the induction of SAA expression by LPS is NF-κB-independent; we have mentioned this in the Results section (Page 12, Lines 259–260). A mention of the need for further research to decipher the non-NF-κB-dependent pathway that may be involved in the induction of SAA expression by LPS has been made in the Discussion section (Page 17, Lines 367–368.)

Related to the author’s response to Reviewer #2, point #2: For Figure 4B, western experiment missing loading control (e.g. beta-actin or GAPDH). Figure legend needs to state how many time this experiment had been performed independently showing similar results. Original un-cropped gel images/scans should be displayed.

Reply:

Thank you for your valuable feedback. Figure 4B shows panels for GAPDH expression, used as a control. We have also mentioned in the text that this experiment was repeated twice and that the same trend was observed (Page 14, Line 309–310). The original, untrimmed gel image is shown in Supplement Figure 2, and the figure has been referred to in the manuscript (Page 14-15, Lines 310–311).

Submitted filename: Response_to_Reviews.docx

Click here for additional data file.

18 Feb 2022

Promoting mechanism of serum amyloid A family expression in mouse intestinal epithelial cells

PONE-D-21-23414R2

Dear Dr. Hayashi,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Wendy Huang, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

10 Mar 2022

PONE-D-21-23414R2

Promoting mechanism of serum amyloid A family expression in mouse intestinal epithelial cells

Dear Dr. Hayashi:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Wendy Huang

Academic Editor

PLOS ONE