BMP7 increases protein synthesis in SW1353 cells and determines rRNA levels in a NKX3-2-dependent manner.

BMP7 is a morphogen capable of counteracting the OA chondrocyte hypertrophic phenotype via NKX3-2. NKX3-2 represses expression of RUNX2, an important transcription factor for chondrocyte hypertrophy. Since RUNX2 has previously been described as an inhibitor for 47S pre-rRNA transcription, we hypothesized that BMP7 positively influences 47S pre-rRNA transcription through NKX3-2, resulting in increased protein translational capacity. Therefor SW1353 cells and human primary chondrocytes were exposed to BMP7 and rRNA (18S, 5.8S, 28S) expression was determined by RT-qPCR. NKX3-2 knockdown was achieved via transfection of a NKX3-2-specific siRNA duplex. Translational capacity was assessed by the SUNsET assay, and 47S pre-rRNA transcription was determined by transfection of a 47S gene promoter-reporter plasmid. BMP7 treatment increased protein translational capacity. This was associated by increased 18S and 5.8S rRNA and NKX3-2 mRNA expression, as well as increased 47S gene promotor activity. Knockdown of NKX3-2 led to increased expression of RUNX2, accompanied by decreased 47S gene promotor activity and rRNA expression, an effect BMP7 was unable to restore. Our data demonstrate that BMP7 positively influences protein translation capacity of SW1353 cells and chondrocytes. This is likely caused by an NKX3-2-dependent activation of 47S gene promotor activity. This finding connects morphogen-mediated changes in cellular differentiation to an aspect of ribosome biogenesis via key transcription factors central to determining the chondrocyte phenotype.

Introduction

In healthy articular cartilage, the chondrocytes’ catabolic and anabolic processes involving maintenance of the cartilage extracellular matrix (ECM) are balanced [1, 2]. However, during osteoarthritis (OA) progression, this homeostasis is disrupted and presents with a hypertrophic chondrocyte phenotype, resulting in the active degradation of the ECM [3, 4]. Previously our group and others demonstrated that bone morphogenetic protein 7 (BMP7) is able to beneficially counteract this chondrocyte hypertrophic phenotype in OA [5-8]. This phenotypic change is characterized by increased chondrogenic gene and protein expression, while the expression of hypertrophic-, cartilage degrading and inflammatory factors is reduced in OA chondrocytes following BMP7 exposure [5-8].

The ribosome is the central player in the cell’s protein translational machinery. The mammalian ribosome consists of two subunits (40S and 60S). Together these subunits contain approximately 80 different ribosomal proteins and 4 ribosomal RNAs (rRNA) [9]. The rRNAs are essential for the ribosome’s translation capacity [10]. Transcription of these rRNAs is a major rate-limiting step in the biogenesis of ribosomes [11, 12]. Three out of four rRNAs are transcribed as a large multi-cistronic 47S precursor by the dedicated RNA Polymerase I [11]. The primary 47S transcript undergoes multiple endo- and exoribonucleolytic cleavage steps, as well as a high number of post-transcriptional modifications [13]. Eventually, the 47S pre-rRNA forms the mature 18S, 5.8S and 28S rRNAs [13].

Aberrant 47S ribosomal DNA (rDNA) gene transcription results in cell-phenotype changes and has been described in relation to normal cell differentiation as well as disease [14-18]. Indeed, ribosome biogenesis is tightly regulated and control of rDNA gene transcription has been described for epidermal growth factor (EGF) [11, 19], insulin-like growth factor-1 (IGF-1) [20-22], and serum [11]. The primary transcriptional targets of these growth factors differ, but all eventually result in modulation of rDNA gene transcription and thus influence ribosome biogenesis. Essential for the hypertrophy-suppressive action of BMP7 on OA chondrocytes is NK3 homeobox 2 (NKX3-2, also known as bagpipe homeobox homolog 1 (Bapx1)) [5, 23, 24]. NKX3.2 represses the expression of runt-related transcription factor 2 (RUNX2), an important transcription factor determinant for chondrocyte hypertrophy [4, 25]. Importantly, RUNX2 was previously demonstrated to inhibit 47S pre-rRNA transcription in osteocytic cells via interaction with HDAC1 (Histone deacetylase 1) and UBTF (Nucleolar transcription factor) [26, 27].

Although BMP7 can beneficially influence the chondrocyte phenotype with increased expression of cartilage ECM-proteins [4, 5, 23–25], its role in chondrocyte translational capacity and ribosome biogenesis has not been investigated before. Transcription of the 47S rRNA precursor is, at least in part, under control of RUNX2 [26-28]. Since BMP7 has been demonstrated to reduce RUNX2 expression levels in chondrocytes via NKX3-2 [5], we therefore hypothesized that BMP7 induces rRNA transcription in a NKX3-2-dependent manner. In this study we investigated the relation between BMP7 and 47S rRNA transcription and the involvement of NKX3.2.

Materials and methods

Cell culture

SW1353 cells [29] (ATCC HTB-94, STR profiled, Middlesex, UK) were cultured in a humidified atmosphere (37°C, 5% CO2) in medium consisting of Dulbecco’s minimal essential medium (DMEM)F12 (Life Technologies, Waltham, Massachusetts, USA) supplemented with 10% fetal calf serum (FCS; Sigma-Aldrich, Dorset, UK) and 1% penicillin/streptomycin (P/S, Invitrogen Life Technologies). Human articular chondrocytes (HACs) were isolated from cartilage obtained from total knee arthroplasty of end-stage (K&L grade 3–4) OA patients. Medical ethical permission was received from the Maastricht University Medical Center medical ethical committee; approval ID: MEC 2017–0183. Informed consent was obtained from all the participants and all methods were performed in accordance with the relevant guidelines and regulations. Chondrocytes were isolated with collagenase as previously described [23]. HACs were cultured in DMEM/F12, complemented with 10% FCS, 1% Antibiotic/antimycotic (Invitrogen Life Technologies) and 1% NEAA (Life Technologies) under a humidified atmosphere (37°C, 5% CO2) until passage 2. Cells (30.000 cells/cm2) were exposed to 1 nM BMP7 (R&D Systems, Minneapolis, Minnesota, USA) or 10 ng/ml Actinomycin D (Sigma-Aldrich) for 24 hours.

Transfection of small interfering RNAs (siRNAs) and overexpression vectors

Transfection of SW1353s or human primary chondrocytes (30.000 cells/cm2) with 100 nM of NKX3-2 siRNA duplex or a scrambled negative control siRNA (Control RNAi; small interfering RNA) was performed according to the manufacturer’s protocol, using HiPerfect (Qiagen, Hilden, Germany). NKX3-2 and the Control siRNA duplexes were custom-made by Eurogentec (Liège, Belgium) and sequences are shown in Table 1. Treatment with BMP7 was started 5 hours post-transfection, and cells were harvested 24 hours post-stimulation for further analysis. The coding sequence of human NKX-3.2 was custom synthesized (GeneCust) with optimized codon usage and cloned into p3XFLAG-CMV-7.1 expression vector (Sigma-Aldrich). FLAG-NKX-3.2 was transiently overexpressed in SW1353 (by Fugene (Promega) according to the manufacturer’s protocol) and human primary chondrocytes (by polyethyleneimine-mediated transfection) (1,000 ng of plasmid/well in 12-well plates). Cells were harvested after 24 hours.

Table 1

siRNA oligo sequences.

	Sequence
Scrambled siRNA [30]	Sense: 5’-AGCUUCAUAAGGCGCAUGCTT-3’
	Antisense: 5’-GCAUGCGCCUUAUGAAGCUTT-3’
NKX3-2 siRNA	Sense: 5’-CCGAGACGCAGGUGAAAAU55-3’
	Antisense: 5’-AUUUUCACCUGCGUCUCGG55-3’
RUNX2 siRNA	Sense: 5’- GCACGCUAUUAAAUCCAAA55-3’
	Antisense: 5’-UUUGGAUUUAAUAGCGUGC55-3’

NKX3-2, RUNX2 and scrambled siRNA sequences are listed.

47S rDNA promoter-reporter assay

The 47S rDNA gene promotor sequence was custom-made by Genecust, containing nucleotides -1000 up to +60 from the human 47S rDNA transcription start site of the 47S rDNA gene sequence (Ensembl), and cloned into the pNL1.2 vector (Promega, Madison, Wisconsin, USA). The pNL1.2_47S-rDNA promoter plasmid was transfected into SW1353 cells (30.000 cells/cm2; n = 6 samples per condition) with Fugene6. Five hours Post-transfection, cells were incubated for 24 hours with 1 nM BMP7. Post-stimulation, cells were harvested for bioluminescence analysis using cell culture lysis buffer (Promega). Promotor-activity was measured with the Nano-Glo Luciferase Assay System (Promega) on a Tristar LB942 (Berthold Technologies, Bad Wildbad, Germany). Relative differences were determined as compared to control conditions following correction for background and normalization by DNA-content. DNA-content was measured using a SYBR-GREEN assay (Invitrogen).

Protein concentration analysis

The protein concentration was determined using the bicinchoninic acid protein assay (Sigma-Aldrich).

Gene expression analysis

Disruption of cells was performed with TRIzol reagent (Life Technologies; n = 3 samples per condition). RNA isolation and quantification were performed as described previously [5]. cDNA synthesis and real-time quantitative polymerase chain reaction (RT-qPCR) was performed as described previously [23]. Primer sequences are shown in Table 2. Data were analyzed using the standard curve method and RNA (including messenger and non-coding RNA) expression was normalized to cyclophilin as a reference gene. Differential gene expression was determined as fold change relative to control conditions.

Table 2

DNA oligo sequences for RT-qPCR.

Gene	Forward primer	Reverse primer
28S rRNA	5’-GCCATGGTAATCCTGCTCAGTAC-3’	5’-GCTCCTCAGCCAAGCACATAC-3’
18S rRNA	5’-CGGACCAGAGCGAAAGCA-3’	5’-ACCTCCGACTTTCGTTCTTGATT-3’
5.8S rRNA	5’-CACTCGGCTCGTGCGTCGAT-3’	5’-CGCTCAGACAGGCGTAGCCC-3’
Cyclophilin	5’-CCTGCTTCCACCGGATCAT-3’	5’-CGTTGTGGCGCGTAAAGTC-3’
RUNX2	5’-TGATGACACTGCCACCTCTGA-3’	5’-GCACCTGCCTGGCTCTTCT-3’
NKX3-2	5’-GCCGCTTCCAAAGACCTAGA-3’	5’-GCTGCGGTCGCCTGAGA-3’
TCOF1	5’-AAGCCACCCCAAGACTAGCA -3’	5’- CCCAGTCTTGCCAGCTTTCT -3’
UBTF	5’-CAGGACCGTGCAGCATATAAAG-3’	5’-GCCTCGCAGCTTGGTCAT-3’

Forward and reverse primer sequences are listed for Homo sapiens.

The expression of unrelated/unaffected genes which are not controlled by the BMP7-NKX3-2- rRNA axis as a negative control are shown in S1 Fig.

SUNsET-assay

Translational capacity of SW1353 cells or human primary chondrocytes was assessed with the SUNsET (surface sensing of translation) assay [31, 32]. Cells were incubated for 10 minutes with 10 μg/ml puromycin (Sigma-Aldrich) in the culture medium. After incubation, cells were washed with 0.9% NaCl and disrupted with radioimmunoprecipitation assay (RIPA) buffer. Cell extracts were sonicated on ice at amplitude 10 for 14 cycles (1 s sonication and 1 s pause; Soniprep 150, MSE, Heathfield, UK). DNA concentration was determined using the SYBR-GREEN assay. Equal DNA quantities were loaded on a nitrocellulose membrane by vacuum-pressure. Puromycin labeling was detected using incubation with the primary anti-puromycin antibody 12D10 (Sigma-Aldrich). Bound primary antibodies were detected with rabbit-anti-mouse secondary immunoglobulins, conjugated with horseradish peroxidase (Dako Agilent, Santa Clara, California, USA). Antibodies were visualized by enhanced chemiluminescence (ECL) using the ChemiDoc XRS+ Imaging System (Bio-Rad, Hercules, California, USA). Relative differences were determined as compared to control conditions.

Statistical analysis

Statistical significance has been calculated with Graphpad PRISM 5.01 (La Jolla, California, USA) using two-tailed paired or unpaired Student’s t-tests or one-way analysis of variance (ANOVA) with Bonferroni’s Multiple Comparison post-hoc analysis. Details per experiment are indicated in the corresponding figure legends. Significance was set at p≤0.05 for all tests. To test for normal distribution of the input data, D’Agostino-Pearson omnibus normality tests were performed. All quantitative data sets presented here passed the normality tests. Error bars in graphs represent mean ± standard error of the mean (SEM).

Results

BMP7 increases protein translation capacity of SW1353 cells and induces increased rRNA levels

We have previously demonstrated that BMP7 is able to induce a phenotypic switch in OA chondrocytes [23], as well as during chondrogenic differentiation of ATDC5 cells [5]. This change of phenotype is accompanied by synthesis of different proteins that build up the protein-rich part of the articular cartilage ECM [5, 6]. In this study we therefore tested whether BMP7 can influence the protein translational capacity of chondrocytic cells. Treatment of SW1353 cells or human primary chondrocytes with 1 nM BMP7 resulted in a significant increase of overall protein translational capacity compared to the control condition (Fig 1A and 1B). Given the central role of rRNAs in ribosome protein translation [10], we next determined rRNA levels in SW1353 cells or human primary chondrocytes that were exposed to 1 nM BMP7 for 24 hours. In concert with the induced translational capacity following BMP7 treatment, 18S and 5.8S rRNA levels were significantly increased compared to control conditions. 28S rRNA levels were increased, albeit not significant (Fig 1C and 1D) [33]. Protein translation is largely dependent on the transcription of rRNAs [10]. As BMP7 increased protein translational capacity (Fig 1A and 1B), we next asked if active rRNA transcription is involved. To inhibit rRNA transcription, we treated SW1353 cells for 24 hours with 10 ng/ml Actinomycin D (a concentration that selectively inhibits RNA polymerase I [34]), and tested whether the observed Actinomycin D-dependent inhibition of protein translation could be rescued by BMP7. We observed that BMP7 could not rescue the Actinomycin D-mediated inhibition of protein synthesis (Fig 1E and 1F). Collectively, these data demonstrate that BMP7 increases translational capacity in SW1353 cells and regulates rRNA levels.

Fig 1

BMP7 exposure increases translational capacity of chondrocytic SW1353 cells and is associated with increased rRNA levels Translational capacity was determined using the SUNsET assay in SW1353 cells (A) or human primary chondrocytes (n = 3 inidividual donors) (B), which were exposed for 24 hours to BMP7 (1nM) or control conditions. Puromycilation data were normalized to DNA content and calculated relative to the control condition (A: n = 6 samples per condition, B: n = 3 samples per donor). In similar samples from A and B, expression levels of 18S rRNA, 5.8S rRNA, and 28S rRNA were determined using RT-qPCR analysis in SW1353 cells (C) or human primary chondrocytes (D). Data were normalized to cyclophilin expression and set relative to the control condition (C: n = 3 samples per condition, D: n = 3 samples per donor). E. Translational capacity was determined in SW1353 cells, which were exposed for 24 hours to Actinomycin D (10 ng/ml) and BMP7 (1 nM) or control conditions. Puromycilation data were normalized to DNA content and calculated relative to the control condition (n = 5 samples per condition). F. In similar samples as E, protein content was determined using a BCA assay. Statistical significance was determined using two-tailed unpaired Student’s t-tests for A, C, E, F and two-tailed paired Student’s t-test for B and D. Bars show the mean ±SEM. * P<0.05, ** P<0.01, *** P<0.001 versus control conditions. ns = not significant.

BMP7 enhances transcriptional activity of the 47S rDNA promoter reporter

We next determined whether the BMP7-dependent increase of rRNA expression is the result of increased transcription of the 47S rDNA gene. Therefore, SW1353 cells were transfected with a 47S rDNA promoter reporter plasmid and subsequently exposed to 1 nM BMP7 for 24 hours. Treatment with BMP7 resulted in enhanced transcriptional activity of the 47S rDNA promoter reporter compared to the control condition (Fig 2A). In addition, expression of two members of the transcription factor complex involved in the transcription of the 47S precursor rRNA; UBTF and TCOF1 (Treacle Ribosome Biogenesis Factor 1) [35] were increased upon BMP7 treatment in SW1353 cells (Fig 2B) and human primary chondrocytes (Fig 2C). These results demonstrate that the BMP7-dependent increase of rRNA expression is supported by a higher activity of the 47S rDNA promoter activity.

Fig 2

rDNA promotor reporter activity is increased in SW1353 cells exposed to BMP7.

SW1353 cells were transfected with an NL1.2_47S-rDNA promoter plasmid. Subsequently, cells were exposed to BMP7 (1nM) for 24 hours and Nanoluc luciferase levels were measured (A). Data were normalized to DNA content and calculated relative to control conditions (RLU) (n = 6 samples per condition). Expression levels of UBTF and TCOF1 were determined using RT-qPCR analysis in SW1353 cells (B) or human primary chondrocytes (C). Data were normalized to cyclophilin expression and set relative to the control condition (B: n = 3 samples per condition, C: n = 3 samples per donor). Statistical significance was determined using two-tailed unpaired Student’s t-tests for A and B and two-tailed paired Student’s t-test for C. Bars show the mean ±SEM. * P<0.05, ** P<0.01, *** P<0.001 versus control conditions.

BMP7-induced rDNA promotor reporter activity, rRNA levels and translational capacity are NKX3-2 dependent

Repression of transcriptional activity of the 47S rDNA gene in higher eukaryotes has, in part, been attributed to RUNX2 [26-28]. Indeed, knockdown of RUNX2 by transient siRNA transfection in SW1353 cells resulted in decreased expression of RUNX2 and its transcriptional target COL10A1, which was accompanied by an increased expression of 18S, 5.8S and 28S rRNA, UBTF and TCOF1 (Fig 3A). Furthermore, RUNX2 knockdown resulted in an increased protein translational capacity (Fig 3B).

Fig 3

BMP7-induced promotor reporter activity and rRNA levels are NKX3-2 dependent.

SW1353 cells were transfected with either a scrambled (Control RNAi) or NKX3-2 (NKX3-2 RNAi) siRNA duplex (100nM) and after 24 hours expression levels of RUNX2, COL10A1, 18S rRNA, 5.8S rRNA, 28S rRNA, UBTF and TCOF1 were measured by RT-qPCR. Data were normalized to cyclophilin expression and set relative to the control condition (n = 3 samples per condition) (A). In similar samples from A, translational capacity was determined using the SUNsET assay. Puromycilation data were normalized to DNA content and calculated relative to the control condition (n = 6 samples per condition) (B). SW1353 cells or human primary chondrocytes were transfected with either a scrambled (Control RNAi) or NKX3-2 (NKX3-2 RNAi) siRNA duplex (100nM) and exposed to BMP7 (1nM) for 24 hours after which expression levels of NKX3-2 (C,G) and RUNX2 (D, G) were determined using RT-qPCR analysis. Data were normalized to cyclophilin expression and set relative to the SCR control condition (n = 3 samples per condition). E. In similar samples as Fig 3C, SW1353 cells were subsequently transfected with a pNL1.2_47S-rDNA promoter plasmid and exposed to BMP7 (1nM) for 24 hours after which Nanoluc luciferase levels were measured. Data were normalized to DNA content and calculated relative to SCR control conditions (RLU) (n = 6 samples per condition). F/G. In similar samples from C and G, expression levels of 18S rRNA, 5.8S rRNA, 28S rRNA, UBTF and TCOF were determined using RT-qPCR analysis. H. In similar samples from C, translational capacity was determined using the SUNsET assay. Puromycilation data were normalized to DNA content and calculated relative to the control condition (n = 6 samples per condition) Statistical significance was determined using a 1-way ANOVA with a Bonferroni’s Multiple Comparison test (E,H) or two-tailed Student’s t-tests (unpaired: A-D, F; paired: G). Bars show the mean ±SEM. * P<0.05, ** P<0.01, *** P<0.001. ns = not significant.

In turn, BMP7 is a potent repressor of RUNX2 expression via NKX3-2 [23]. We therefore investigated whether the BMP7-dependent increase of rRNA levels is modulated via NKX3-2. SW1353 cells were transiently transfected with a NKX3-2 siRNA duplex and cells were then incubated in the presence or absence of BMP7. In agreement with our previous findings [23], BMP7 potently induced expression of NKX3-2 (Fig 3C), while the expression of RUNX2 was inhibited (Fig 3D). Knockdown of NKX3-2 could not be counteracted by BMP7 (Fig 3C) and caused a marked increase of RUNX2 expression (Fig 3D). To determine whether the BMP7-dependent increase of rDNA promoter activity is facilitated by NKX3-2, an rDNA promoter reporter assay was conducted with BMP7 under NKX3-2 knockdown conditions. BMP7 increased the transcriptional activity of the rDNA promoter reporter (Fig 3E). NKX3-2 knockdown caused a marked reduction in rDNA promoter reporter activity (Fig 3E). The reduced rDNA promoter activity could not be rescued by stimulation with BMP7. To confirm whether the alterations in rDNA promoter activity result in changes at the rRNA level, 18S, 5.8S and 28S rRNAs, UBTF and TCOF1 were measured. 18S and 5.8S rRNA levels and UBTF and TCOF expression were significantly induced by BMP7 (Fig 3F, cf. Fig 1B). In contrast, the expression levels of 18S, 5.8S and 28S rRNA and UBTF and TCOF expression were reduced in NKX3-2 knockdown conditions (Fig 3F) which was a NKX3-2 knockdown specific reaction (S2 Fig). This could not be restored when NKX3-2 knockdown cells were stimulated with BMP7 (Fig 3F). Similar gene expression responses were detected in human primary chondrocytes and ATDC5 chondrocytes (Fig 3G and S3 Fig). In addition, the increased protein translational capacity under BMP7 treatment (Fig 1A) was also dependent on NKX3-2 expression (Fig 3H).

Overexpression of NKX3-2 by transfecting SW1353 cells or human primary chondrocytes with a validated 3xFLAG‐NKX3-2 vector [23] resulted in a significantly decreased expression of RUNX2, which was accompanied by an increased expression of 18S rRNA, and 5.8S rRNA, 28S rRNA, UBTF and TCOF1 (Fig 4A–4C). In addition, translational capacity was also increased in the FLAG-NKX3-2 overexpressing SW1353 cells (Fig 4D). These data are reciprocal to the NKX3-2 knockdown presented in Fig 3 and in line with the BMP7-mediated increase in rRNA expression from Figs 1 and 3. Together these results indicate that the BMP7-induced rDNA promoter activity and translational capacity is NKX3-2-dependent and associated with RUNX2 expression.

Fig 4

NKX3-2 overexpression increases rRNA levels and is associated with increased translational capacity.

NKX3-2 was overexpressed by transient transfection of a codon usage optimized FLAG-NKX3-2 vector into SW1353 cells (A,B) or primary chondrocytes (n = 3 donors) (C). FLAG-empty vector was used as a negative control. Expression of mRNA for the indicated genes was determined by real-time RT-qPCR. Data were normalized to cyclophilin expression and set relative to the control condition (A-B: n = 3 samples per condition, C: n = 3 samples per donor). D. Translational capacity was determined in SW1353 cells with and without overexpression of NKX3-2. Puromycilation data were normalized to DNA content and calculated relative to the control condition (n = 5 samples per condition). Statistical significance was determined using two-tailed Student’s t-tests (unpaired for: A,B,D; paired for: C). Bars show the mean ±SEM. * P<0.05, ** P<0.01, *** P<0.001 versus control conditions.

Discussion

The cell’s protein translational capacity is directly linked to ribosome biogenesis and highly dependent on the levels of intracellularly available mature rRNAs [11, 12]. Indeed, our data show that the increased translation capacity induced by BMP7 is accompanied by elevated levels of 18S and 5.8S rRNAs (28S non-significantly increased). We found that this is likely caused by a BMP7-dependent induction of rRNA transcription.

Basic activity of rRNA transcription from the rDNA gene has been described to be maintained by signaling through the insulin and insulin-like growth factor axis, via epidermal growth factor, as well as multiple serum components [11, 20–22, 35–37]. These signaling pathways represent the main physiological routes that are at the basis of cellular protein homeostasis during tissue growth and maintenance. Further control of rRNA synthesis occurs through additional control of basic rRNA transcription [38]. Our current study for the first time demonstrates a BMP-mediated control over rRNA transcription in chondrocytic cells. Our previous work showed that BMP7 is a potent morphogen capable of functionally directing the phenotype of developing chondrocytes and of osteoarthritic chondrocytes towards a phenotype that is less hypertrophic [5, 23]. Chondrocyte phenotypic changes are expected to be associated with important changes in the chondrocyte’s (extracellular cartilaginous) proteome. Therefore, it remains to be determined what the proteomic consequences are of the BMP7-mediated induction of rRNA transcription and translation, and whether this results in a chondrocyte phenotype change detectable at the protein level.

Downstream of cellular signaling by morphogens, the transcription of the 47S precursor rRNA is driven by a transcription factor complex consisting of SL1 (selective factor 1), UBTF, TIF-IA (transcription initiation factor-IA), TBP (TATA-Box Binding Protein) and RNA Polymerase I [35]. This complex is the basic driver of the RNA polymerase I-dependent transcription of the rDNA gene and forms the basis for modulation of transcription. An important part of the activity of this complex is regulated by the phosphorylation of UBTF, which can be mediated by signaling of ERK, mTOR (mammalian target of rapamycin), CK2 (Casein kinase II), CDK (Cyclin-dependent kinase), CBP (CREB-binding protein) and others [38]. Activities of RUNX-family transcription factors have been shown to control rRNA transcription [39] (Fig 3A). In addition, RUNX2 suppresses rRNA transcription via interacting with UBTF [27] and recruitment of HDAC [26], modulating acetylation of UBF and histones at rDNA loci in osteocytes. Although this mechanism has not yet been described in chondrocytes [40], it does provide an important potential link between BMP7 and the here observed consequence of BMP7 on rRNA transcription. Runx2 is a key transcription factor driving chondrocyte hypertrophy, and the hypertrophy suppressive action of BMP7 on chondrocytes involves the inhibition of Runx2 expression. Importantly, BMP7-mediated inhibition of chondrocyte Runx2 expression has been shown to depend on NKX3-2, a pivotal factor in balancing the hypertrophic differentiation program of chondrocytes and particularly known for its repressive action on RUNX2 transcription [23, 25]. In this manner, BMP7-dependent NKX3-2 expression is able to control RUNX2 levels, thereby delivering an important contribution to tuning chondrocyte hypertrophy. The current data indicate that NKX3-2 is also involved in the transcription of rRNA, and needed for the here observed BMP7-mediated induction of rRNA transcription. At this point, the precise mode-of-action of the involvement of NKX3-2 in rRNA transcription remains to be determined. However, since NKX3-2 is well-known for its repression of Runx2 expression, we speculate that NKX3-2 is able to regulate rRNA transcription by determining the levels of Runx2, a repressor of rRNA transcription [26-28]. In this manner BMP7 would be able to induce rRNA transcription via attenuation of Runx2 levels. Future Chromatin immunoprecipitation (ChIP)-assays, addressing RUNX2 occupancy on the rDNA gene promotor, should be able to resolve this.

Our data demonstrate the involvement of BMP7 in RNA polymerase I-directed rDNA gene transcription. Ribosome biogenesis is intricately linked to the rate of protein synthesis and mainly controlled at the level of rDNA transcription by RNA polymerase I [11, 12]. However, ribosome biogenesis is a result of a tightly regulated cascade of molecular events, in which processing of the 47S rRNA precursor gives rise to mature 18S, 5.8S and 28S rRNAs. Supporting our present findings on a role for BMP7 in ribosome biogenesis, we previously showed that BMP7 induces the expression of U3 snoRNA [33]. U3 snoRNA is a key factor in the maturation of rRNAs from the 47S rRNA precursor. This indicates that BMP7 is able to orchestrate rRNA transcription with its maturation. This notion also has implications for BMP7 and NKX3-2 as chondrocyte phenotypic modulators and highlights that morphogen-mediated cellular differentiation is orchestrated with ribosome biogenesis via key transcription factors that are centrally involved in determining the cellular phenotype. Indeed, a similar link between PTHrP (Parathyroid hormone-related peptide; a well-known chondrocyte phenotype regulating morphogen [41]) and chondrocyte ribosome biogenesis was previously reported [42].

Taken together, the results of this study demonstrate that BMP7 increases protein translation and promotes rRNA transcription in SW1353 cell and human primary chondrocytes via an NKX3-2-dependent route (as schematically depicted in Fig 5). It is well established that BMP7 controls the expression of key chondrocyte transcription factors that direct the chondrocyte’s phenotype. Our results now additionally uncover that this is associated with changes in the chondrocyte’s capacity to synthesize ribosomes. Since BMP7 is being explored as a potential treatment option for OA [43-45], this provides a broader understanding of the spectrum of the mode-of-action of BMP7 as an OA disease-modifying molecule.

Fig 5

Graphical representation of the elucidated mechanism.

The results of this study demonstrate that BMP7 increases protein translation and promotes rRNA transcription in SW1353 cells. rRNA transcription in SW1353 cells has been demonstrated to be mediated by a BMP7-induced inhibition of RUNX2 in a NKX3-2-dependent manner.

Unrelated/unaffected genes which are not controlled by the BMP7-NKX3-2- rRNA axis.

A/B. SW1353 cells were transfected with either a scrambled (SCR) or NKX3-2 (NKX3-2 KD) siRNA duplex (100nM) and exposed to BMP7 (1nM) for 24 hours after which expression levels of Viperin, NFAT5, KRT18 or PTCH1 were determined using RT-qPCR analysis. Data were normalized to cyclophilin expression and set relative to the SCR control condition (n = 3 samples per condition). Statistical significance was determined using a two-tailed unpaired Student’s t-tests, an no significant changes for each gene between conditions was observed. Bars show the mean ±SEM. * P<0.05, ** P<0.01, *** P<0.001.

(TIF)

Click here for additional data file.

BMP7-induced rRNA levels are NKX3-2 dependent in ATDC5 cells.

ATDC5 cells (6.400 cells/cm2) were differentiated in the chondrogenic lineage for 6 days to acquire a chondrocyte phenotype and then transfected (according to the manufacturer’s protocol, using HiPerfect, Qiagen) with either a scrambled (Control RNAi (Eurogentec)) or Nkx3-2 (Nkx3-2 RNAi) siRNA duplex (100nM; sense: 5’-CAGAGACGCAAGUGAAGAUTT-3’, anti-sense: 5’-AUCUUCACUUGCGUCUCUGTT-3’) and exposed to BMP7 (1nM) for 24 hours after which expression levels of Nkx3-2, Runx2, 18S rRNA, 5.8S rRNA, 28S rRNA, Ubtf and Tcof1 were measured by RT-qPCR. Data were normalized to cyclophilin expression and set relative to the control condition (n = 3 samples per condition). Differentiation medium for ATDC5 consisted of Dulbecco’s minimal essential medium (DMEM)/F12 (Invitrogen), 5% fetal calf serum (FCS) (Sigma-Aldrich), 1% antibiotic/antimycotic (Invitrogen) and 1% NEAA (non-essential amino acids; Invitrogen), 10mg/ml insulin (Sigma-Aldrich), 10mg/ml transferrin (Roche) and 30 nM sodium selenite (Sigma-Aldrich). Statistical significance was determined using a two-tailed unpaired Student’s t-tests. Bars show the mean ±SEM. * P<0.05, ** P<0.01, *** P<0.001. ns = not significant.

(TIF)

Click here for additional data file.

A-B. NKX3-2 was overexpressed by transient transfection of a codon usage optimized FLAG-NKX3-2 vector into SW1353 cells and FLAG-empty vector was used as a negative control. The next day, these cells were transfected with either a scrambled (Control RNAi) or NKX3-2 (NKX3-2 RNAi) siRNA duplex (100nM) and after 24 hours cells were harvested. Expression of mRNA for the indicated genes was determined by real-time RT-qPCR. Data were normalized to cyclophilin expression and set relative to the control condition (A-B: n = 3 samples per condition). C. Translational capacity was determined and Puromycilation data were normalized to DNA content and calculated relative to the control condition (n = 5 samples per condition). Statistical significance was determined using unpaired two-tailed Student’s t-tests. Bars show the mean ±SEM. * P<0.05, ** P<0.01, *** P<0.001 versus control conditions. ns = not significant.

(TIF)

Click here for additional data file.

(PDF)

Click here for additional data file.

25 Jan 2021

PONE-D-20-37112

BMP7 increases protein synthesis in SW1353 cells and determines rRNA levels in a NKX3-2-dependent manner

PLOS ONE

Dear Dr. Caron,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We regret that it took a long time to evaluate your work, but it is not for lack of editorial effort. We consulted more than 30 experts (including suggested referees), and only recently we secured a second opinion. One of the reviewers is rather critical of your work, and we recommend that you address these comments to the extend possible by experimentation or otherwise modifications in the text. In the latter case, unresolvable concerns by reviewers as always could be adopted by you as your own acknowledgment of limitations to your work in the Discussion section. You could then take the opportunity to add how your work now adds to the field regardless of the current limitations, similar to the statements you would otherwise make in the rebuttal letter. The second reviewer was more enthusiastic about your work and provided constructive recommendations for revision that should not be insurmountable.

Please submit your revised manuscript by Mar 06 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Andre van Wijnen

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.We note that you have a patent relating to material pertinent to this article. Please provide an amended statement of Competing Interests to declare this patent (with details including name and number), along with any other relevant declarations relating to employment, consultancy, patents, products in development or modified products etc. Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

This information should be included in your cover letter; we will change the online submission form on your behalf.

Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have already published that BMP7 regulates rRNA levels via NKX3.2. Thus, the first two figures in this manuscript replicate their own previously published data, but using SW1353 cells rather than primary HACs. In addition, previously published studies have established a role for NKX3.2-mediated repression of RUNX2 in chondrogenic differentiation. Thus, this work fails to meet the journals requirement for novelty.

Additional issues:

Major: The siRNA studies in Figure 3 lack necessary specificity controls. These include; (1) the failure to use more than one NKX3-2 targeted siRNA duplex (2-3 distinct siRNAs should be used to reduce chance of off-target effects), (2) The authors should include a rescue experiment, by re-expression of a NKX3-2 mutant that evades riRNA silencing.

Reviewer #2: The authors present a nicely written manuscript which investigates an interesting aspect in chondrogenic cell biology which not too many labs enquire. However, to fully prove the hypothesis presented, this work needs some further extension.

1. SUNsET assay: it is not very clear how this assay works in SW1353 cells. Please give some more details on how this assay reflects protein translation.

2. To further prove the point of the paper it would be appropriate to show the expression of an unrelated/unaffected gene which is not controlled by the BMP7-NKX3-2- rRNA axis as a negative control.

3. Next, the authors hypothesize that BMP7 influences the protein translational capacity in differentiating chondrocytes leading to a phenotypic change characterized by synthesis of the protein-rich part of the articular cartilage’s ECM. The authors need to demonstrate the direct link between the increased translation of proteins via ribosomal stimulation by BMP7 and to the articular cartilage ECM . Direct comparison between mRNA expression, protein expression and if possible protein ubiquitination of genes involved in cartilage ECM is necessary.

4. A little graphical representation of the elucidated mechanism/pathway would add value to the manuscript and help all the readers which are not too familiar with control of rRNA's transcription and ribosomal translation.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

8 Mar 2021

Dear Editorial Board Member, Dear Academic Editor Andre van Wijnen,

On behalf of all authors, we are pleased to submit the new revision of the attached original research article entitled: “BMP7 increases protein synthesis in SW1353 cells and determines rRNA levels in a NKX3-2-dependent manner” with manuscript ID PONE-D-20-37112 for publication in PLOS ONE.

The manuscript has been adjusted according to the Academic Editor and Reviewers’ comments. In the attached files you can find the requested systematic point-by-point description of how we dealt with the Academic Editor and Reviewers comments in the rebuttal letter, as well as a final marked-up and clean unmarked copy of the manuscript and a new figure.

We again thank the Academic Editor and the Reviewers for their time and effort to critically review our manuscript and hope that our revised manuscript now meets the Academic Editor and Reviewers’ remarks and meets the high standards for publication in PLOS ONE.

All co-authors have read and approved the submitted version of the manuscript. None of the material from this manuscript has been published or is under consideration elsewhere, including the internet.

Conflicts of Interest: MMJ Caron and TJM Welting are inventors on patents WO2017178251 and WO2017178253 (Owned by Chondropeptix). LW van Rhijn and TJM Welting are shareholder in Chondropeptix and are CDO, and CSO of Chondropeptix, respectively. All other authors have no competing interests to declare. This does not alter our adherence to PLOS ONE policies on sharing data and materials.

On behalf of all co-authors,

Sincerely,

Marjolein M.J. Caron, PhD

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

________________________________________

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

________________________________________

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

________________________________________

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

________________________________________

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have already published that BMP7 regulates rRNA levels via NKX3.2. Thus, the first two figures in this manuscript replicate their own previously published data, but using SW1353 cells rather than primary HACs. In addition, previously published studies have established a role for NKX3.2-mediated repression of RUNX2 in chondrogenic differentiation. Thus, this work fails to meet the journals requirement for novelty.

• Authors’ response: We thank the Reviewer for carefully reading our manuscript and we will address the remaining issues point-by-point below.

• The Reviewer is correct in stating that Figure 1A and 1B convey the same message as Figures published in the paper by Ripmeester et al. [1]. Furthermore, the link between BMP7-NKX3-2-RUNX2 repression axis was also previously reported by our group [2]. We also previously found that BMP7 can influence U3 snoRNA expression and thereby maturation of the 47S pre-rRNA [1]. However the involvement of BMP7 in 47S pre-rRNA transcription has not been shown before by us or other authors. In addition, the involvement of NKX3-2-RUNX2 repression as a potential mechanism of action for the observed BMP7 mediated increase in 47S pre-rRNA transcription was also not reported before. Indeed, this work builds upon our previous work but reports novel insights into the molecular interaction between BMP7 and chondrocyte ribosome biogenesis.

Additional issues:

Major: The siRNA studies in Figure 3 lack necessary specificity controls. These include; (1) the failure to use more than one NKX3-2 targeted siRNA duplex (2-3 distinct siRNAs should be used to reduce chance of off-target effects), (2) The authors should include a rescue experiment, by re-expression of a NKX3-2 mutant that evades riRNA silencing.

• Authors’ response: The siRNA against NKX3-2 in this manuscript is the same as the siRNA we previously published [2], were we showed more confirmation that knockdown of NKX3-2 by this siRNA resulted in specific effects on NKX3-2 target genes.

Due to the COVID19 crisis and subsequent restrictions in lab activities, we were not in the possibility to initiate new cell culture experiments plus all downstream activities that would be required for additional siRNA and NKX3-2 re-expression studies. We do however have a previously conducted experiment from which the data further harness that NKX3-2 is involved in regulating the expression of rRNAs. Overexpression of BAPX‐1/NKX3-2 by transfecting SW1353 cells with a validated 3xFLAG‐BAPX‐1/NKX3-2 vector [2] resulted in a significantly decreased expression of RUNX2 accompanied by an increased expression for 18S rRNA and 5.8S rRNA. These data are reciprocal to the NKX3-2 knockdown presented in Figure 3 and in line with the BMP7 mediated increase in rRNA expression from Figure 1. We hope that these data provide additional insight for this Reviewer on the role of NKX3-2 in chondrocyte rRNA expression. This Figure is now included in the Supplemental files accompanying this manuscript.

S2 Fig: Overexpression of NKX3-2 results in increased 18S rRNA and 5.8S rRNA expression. Overexpression of NKX3-2 was achieved by transfecting SW1353 cells with a validated 3xFLAG-NKX3-2 vector [2]. After 24 hours gene expression analysis was performed using RT-qPCR analysis. Data were normalized to cyclophilin expression and set relative to the empty-FLAG control condition (n=3 samples per condition). Increased FLAG-NKX3-2 expression was determined. Overexpression of FLAG-NKX3-2 resulted in decreased gene expression of RUNX2 and increased expression of 18S rRNA and 5.8S rRNA. 28S rRNA expression was not significantly changed by FLAG-NKX3-2. Statistical significance was determined using a two-tailed unpaired Student’s t-tests. Bars show the mean ±SEM. * P<0.05, ** P<0.01, *** P<0.001.

Reviewer #2: The authors present a nicely written manuscript which investigates an interesting aspect in chondrogenic cell biology which not too many labs enquire. However, to fully prove the hypothesis presented, this work needs some further extension.

• Authors’ response: We thank the Reviewer for carefully reading our manuscript and emphasizing that research on protein translation in chondrocyte cell biology is not performed by too many labs. We are grateful for his/her positive remarks and we will happily address the remaining issues point-by-point below.

1. SUNsET assay: it is not very clear how this assay works in SW1353 cells. Please give some more details on how this assay reflects protein translation.

• Authors’ response: The SUNsET assay (surface sensing of translation) uses antibody detection of puromycin to monitor translation via immunohistochemistry. Puromycin mimics the terminus of aminoacyl-tRNA and hence is incorporated co-translationally in the growing nascent polypeptide chain. The amount of puromycin-incorporated peptides reflects the protein translational capacity of the cell, which can be determined by the intensity of the fluorescent signal [3].

2. To further prove the point of the paper it would be appropriate to show the expression of an unrelated/unaffected gene which is not controlled by the BMP7-NKX3-2- rRNA axis as a negative control.

• Authors’ response: We agree with the Reviewer that showing unrelated/unaffected gene expression by the BMP7-NKX3-2-rRNA axis would benefit the data presented in the manuscript as a negative control. The expression of the genes below are not significantly affected by either BMP7 or NKX3-2 knockdown, and this Figure is now included in the Supplemental files accompanying this manuscript.

S1 Fig: Unrelated/unaffected genes which are not controlled by the BMP7-NKX3-2- rRNA axis. A/B. SW1353 cells were transfected with either a scrambled (SCR) or NKX3-2 (NKX3-2 KD) siRNA duplex (100nM) and exposed to BMP7 (1nM) for 24 hours after which expression levels of Viperin, NFAT5, KRT18 or PTCH1 were determined using RT-qPCR analysis. Data were normalized to cyclophilin expression and set relative to the SCR control condition (n=3 samples per condition). Statistical significance was determined using a two-tailed unpaired Student’s t-tests, an no significant changes for each gene between conditions was observed. Bars show the mean ±SEM. * P<0.05, ** P<0.01, *** P<0.001.

3. Next, the authors hypothesize that BMP7 influences the protein translational capacity in differentiating chondrocytes leading to a phenotypic change characterized by synthesis of the protein-rich part of the articular cartilage’s ECM. The authors need to demonstrate the direct link between the increased translation of proteins via ribosomal stimulation by BMP7 and to the articular cartilage ECM. Direct comparison between mRNA expression, protein expression and if possible protein ubiquitination of genes involved in cartilage ECM is necessary.

• Authors’ response: The Reviewer raises a valid point. In order to demonstrate that the effect of BMP7 on increased chondrocyte protein translation depends on rRNA transcription, we conducted an additional experiment. We treated SW1353 cells for 24 hours with Actinomycin D at 10 ng/ml, a concentration that selectively inhibits RNA polymerase I (PMID 21922053) [4]. RNA polymerase I is the only polymerase responsible for 47S rDNA transcription.

The data demonstrate that Actinomycin D mediated inhibition of rRNA transcription results in reduced chondrocyte protein synthesis. This could not be rescued by BMP7. These data strongly suggest that the effect of BMP7 on chondrocyte protein translation requires active rRNA transcription supporting our hypothesis. These data are now added to the main manuscript as Figure 1 C and D.

While we fully acknowledge the added value of measuring cartilage ECM specific protein synthesis in this context, we regret that we were not able to meet this request due to COVID19 related restrictions in local lab activities. We hope the Reviewer accepts this force majeure situation.

A: Translational capacity was determined using the SUNsET assay in SW1353 cells, which were exposed for 24 hours to Actinomycin D (10ng/ml) and BMP7 (1nM) or control conditions. Puromycilation data were normalized to DNA content and calculated relative to the control condition (n=5 samples per condition). Treatment with Actinomycin D reduced translational capacity of SW1353 cells, which could not be rescued by simultaneous exposure to BMP7. B: In similar samples as A, protein content was determined using a BCA assay. Treatment with Actinomycin D reduced total protein content, which could not be rescued by exposure to BMP7. Statistical significance was determined using unpaired Student’s t-tests. Bars show the mean (±SEM). ** P<0.01, *** P<0.001.

4. A little graphical representation of the elucidated mechanism/pathway would add value to the manuscript and help all the readers which are not too familiar with control of rRNA's transcription and ribosomal translation.

• Authors’ response: We agree with the Reviewer that a graphical representation of the elucidated mechanism would benefit the manuscript. We thank the Reviewer for this helpful suggestion and included the graphical representation as shown below in the manuscript as Figure 4.

Fig 4: Graphical representation of the elucidated mechanism. The results of this study demonstrate that BMP7 increases protein translation and promotes rRNA transcription in SW1353 cells. rRNA transcription in SW1353 cells has been demonstrated to be mediated by a BMP7-induced inhibition of RUNX2 in a NKX3-2-dependent manner.

References:

1. Ripmeester EGJ, Caron MMJ, van den Akker GGH, Surtel DAM, Cremers A, Balaskas P, et al. Impaired chondrocyte U3 snoRNA expression in osteoarthritis impacts the chondrocyte protein translation apparatus. Scientific reports. 2020;10(1):13426-. doi: 10.1038/s41598-020-70453-9. PubMed PMID: 32778764.

2. Caron MMJ, Emans PJ, Surtel DAM, van der Kraan PM, van Rhijn LW, Welting TJM. BAPX-1/NKX-3.2 Acts as a Chondrocyte Hypertrophy Molecular Switch in Osteoarthritis. Arthritis & Rheumatology. 2015;67(11):2944-56. doi: 10.1002/art.39293.

3. Goodman CA, Hornberger TA. Measuring protein synthesis with SUnSET: a valid alternative to traditional techniques? Exerc Sport Sci Rev. 2013;41(2):107-15. Epub 2012/10/24. doi: 10.1097/JES.0b013e3182798a95. PubMed PMID: 23089927; PubMed Central PMCID: PMCPMC3951011.

4. Bensaude O. Inhibiting eukaryotic transcription: Which compound to choose? How to evaluate its activity? Transcription. 2011;2(3):103-8. Epub 2011/09/17. doi: 10.4161/trns.2.3.16172. PubMed PMID: 21922053; PubMed Central PMCID: PMCPMC3173647.

Submitted filename: Response to Reviewers - Ripmeester et al..docx

Click here for additional data file.

29 Mar 2021

PONE-D-20-37112R1

BMP7 increases protein synthesis in SW1353 cells and determines rRNA levels in a NKX3-2-dependent manner

PLOS ONE

Dear Dr. Caron,

Thank you for submitting your revised manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

One of the reviewers expressed residual concerns that some of the additional work that was recommended, while logistically very difficult under COVID conditions, would still add value to this work. From an editorial perspective, we have rendered an initial decision based on the reviews of only one reviewer to expedite a decision in light of the fact that many suitable reviewers were not available to assess your work. Since this reduced the number of points that needed to be addressed, it is perhaps not unreasonable for you to reconsider what could be done to satisfy the recommendations of this single reviewer.

Upon personal review of this work, I appreciate the importance of your work. However, it is objectively evident that your paper, even with the supplementary figures you provided, contains a rather minimal amount of data documented in Figures 1 and 3, beyond a simple two component bar graph in Figure 2. Papers for PLOS One typically present a larger volume of high quality work.

Moving forward, I recommend that you follow the advice of the reviewer and let this paper mature and include a bit more data at an extended deadline to allow you to address the original critique. In addition, I believe that the Supplementary Figures should be incorporated in the main text because they present important context for the main findings. With the number of figures even in the revised paper you are not reaching a maximal figure limit yet. We trust that you will be able to make additional modifications, but feel free to contact us by email if you have questions regarding what you could realistically do and not do with an extended deadline.

Please submit your revised manuscript by May 13 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:  http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at  https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Andre van Wijnen

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have responded in a fashion that IF they carried through to complete the studies requested might address earlier critiques. However, due to COVID19 related research restrictions they are unable to complete the necessary experiments. While this is regrettable, the inability to generate this data does not reduce its importance. I would suggest that the authors be permitted an extension until such a time as research activity is restored and these studies can be completed.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

15 Nov 2021

PONE-D-20-37112R1

BMP7 increases protein synthesis in SW1353 cells and determines rRNA levels in a NKX3-2-dependent manner

PLOS ONE

Dear Dr. Caron,

Thank you for submitting your revised manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

One of the reviewers expressed residual concerns that some of the additional work that was recommended, while logistically very difficult under COVID conditions, would still add value to this work. From an editorial perspective, we have rendered an initial decision based on the reviews of only one reviewer to expedite a decision in light of the fact that many suitable reviewers were not available to assess your work. Since this reduced the number of points that needed to be addressed, it is perhaps not unreasonable for you to reconsider what could be done to satisfy the recommendations of this single reviewer.

Upon personal review of this work, I appreciate the importance of your work. However, it is objectively evident that your paper, even with the supplementary figures you provided, contains a rather minimal amount of data documented in Figures 1 and 3, beyond a simple two component bar graph in Figure 2. Papers for PLOS One typically present a larger volume of high quality work.

Moving forward, I recommend that you follow the advice of the reviewer and let this paper mature and include a bit more data at an extended deadline to allow you to address the original critique. In addition, I believe that the Supplementary Figures should be incorporated in the main text because they present important context for the main findings. With the number of figures even in the revised paper you are not reaching a maximal figure limit yet. We trust that you will be able to make additional modifications, but feel free to contact us by email if you have questions regarding what you could realistically do and not do with an extended deadline.

Please submit your revised manuscript by May 13 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

• A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

• A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

• An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Andre van Wijnen

Academic Editor

PLOS ONE

• Authors’ response: We thank the Academic Editor for carefully rereading our manuscript and the generous opportunity and time to revise our manuscript based on comments from the Academic Editor and the Reviewer.

• To meet the Editors’ request regarding the rather minimal amount of data presented in the Figures, we repeated the majority of the experiments in human primary chondrocytes (3 independent donors) and obtained similar results. These data are now added to the manuscript (Figure 1B, 1D, 2C, 3G and 4C). Moreover, we moved the NKX3-2 overexpression gene expression data that was presented in S2 Fig to the main manuscript (Figure 4), repeated the experiment in human primary chondrocytes and added translational capacity data for SW1353 cells. In addition to the presented rRNA promoter data presented in Figure 2, we now measured gene expression of UBTF and TCOF1, two factors critically involved in the transcription of the 47S precursor rRNA (Figure 2, 3 and 4). We find that this additional work adds value to the original presented work and now adheres to the volume and quality of work for publication in PLOS One.

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

________________________________________

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

________________________________________

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

________________________________________

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

________________________________________

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

________________________________________

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have responded in a fashion that IF they carried through to complete the studies requested might address earlier critiques. However, due to COVID19 related research restrictions they are unable to complete the necessary experiments. While this is regrettable, the inability to generate this data does not reduce its importance. I would suggest that the authors be permitted an extension until such a time as research activity is restored and these studies can be completed.

________________________________________

• Authors’ response: We thank the Reviewer for carefully rereading our manuscript and we will address the remaining issue below.

The Reviewers previous comment to our manuscript that we could not address due to COVID19 was: Major: The siRNA studies in Figure 3 lack necessary specificity controls. These include; (1) the failure to use more than one NKX3-2 targeted siRNA duplex (2-3 distinct siRNAs should be used to reduce chance of off-target effects), (2) The authors should include a rescue experiment, by re-expression of a NKX3-2 mutant that evades riRNA silencing.

• Authors’ response: The siRNA against NKX3-2 in this manuscript is the same as the siRNA we previously published [1], were we showed more confirmation that knockdown of NKX3-2 by this siRNA resulted in specific effects on NKX3-2 target genes. We now ordered and tested two new siRNA duplexes for human NKX3-2, but these did not result in successful knockdown of NKX3-2. As a second approach to try to answer the Reviewers request, we designed an siRNA duplex for mouse NKX3-2 and obtained a successful knockdown and similar results regarding rRNA expression in the murine ATDC5 cell line that was pre-differentiated for 5 days to obtain a chondrocyte phenotype. See figure below (in the Response to Reviewers attached file), these data are now added to the manuscript as Supplemental Figure 2. In addition to show more confidence in our NKX3-2 siRNA data generated in the SW1353 cells, we repeated the majority of the experiments in human primary chondrocytes (3 independent donors) using the same human NKX3-2 siRNA duplex and obtained similar results. These data are now added to the manuscript (Figure 3G and 4C).

To meet the Reviewer’s second request for specificity control, we performed the requested experiment using the NKX3-2 siRNA and re-expression of NKX3-2 using a FLAG-NKX3-2 expression vector with optimized codon-usage that evades the NKX3-2 siRNA-mediated silencing. Overexpression of NKX3-2 by transfecting SW1353 cells or human primary chondrocytes (n=3 independent donors) with the FLAG‐NKX3-2 vector [1] resulted in a significantly decreased expression of RUNX2 accompanied by an increased expression of rRNAs and accompanying translational capacity in these cells. These data are reciprocal to the NKX3-2 knockdown (also presented in Figure 3) and in line with the BMP7-mediated increase in rRNA expression and translation capacity from Figure 1. These effects could not be significantly altered by the NKX3-2 siRNA (see Figure below in the Response to Reviewers attached file). We hope that these data provide ample additional insight for the Reviewer on the role of NKX3-2 in chondrocyte rRNA expression and translational capacity. The NKX3-2 overexpression data is now included in the main manuscript as Figure 4 and the whole figure as presented below in the Supplemental files accompanying this manuscript.

S2 Fig: BMP7-induced rRNA levels are NKX3-2 dependent in ATDC5 cells

ATDC5 cells (6.400 cells/cm2) were differentiated in the chondrogenic lineage for 6 days to acquire a chondrocyte phenotype and then transfected (according to the manufacturer’s protocol, using HiPerfect, Qiagen) with either a scrambled (Control RNAi (Eurogentec)) or Nkx3-2 (Nkx3-2 RNAi) siRNA duplex (100nM; sense: 5’-CAGAGACGCAAGUGAAGAUTT-3’, anti-sense: 5’-AUCUUCACUUGCGUCUCUGTT-3’) and exposed to BMP7 (1nM) for 24 hours after which expression levels of Nkx3-2, Runx2, 18S rRNA, 5.8S rRNA, 28S rRNA, Ubtf and Tcof1 were measured by RT-qPCR. Data were normalized to cyclophilin expression and set relative to the control condition (n=3 samples per condition). Differentiation medium for ATDC5 consisted of Dulbecco's minimal essential medium (DMEM)/F12 (Invitrogen), 5% fetal calf serum (FCS) (Sigma-Aldrich), 1% antibiotic/antimycotic (Invitrogen) and 1% NEAA (non-essential amino acids; Invitrogen), 10mg/ml insulin (Sigma-Aldrich),10mg/ml transferrin (Roche) and 30 nM sodium selenite (Sigma-Aldrich). Statistical significance was determined using a two-tailed unpaired Student’s t-tests. Bars show the mean ±SEM. * P<0.05, ** P<0.01, *** P<0.001. ns= not significant.

S3 Fig: NKX3-2 overexpression increases rRNA levels and is associated with increased translational capacity

A-B. NKX3-2 was overexpressed by transient transfection of a codon usage optimized FLAG-NKX3-2 vector into SW1353 cells and FLAG-empty vector was used as a negative control. The next day, these cells were transfected with either a scrambled (Control RNAi) or NKX3-2 (NKX3-2 RNAi) siRNA duplex (100nM) and after 24 hours cells were harvested. Expression of mRNA for the indicated genes was determined by real-time RT-qPCR. Data were normalized to cyclophilin expression and set relative to the control condition (A-B: n=3 samples per condition). C. Translational capacity was determined and Puromycilation data were normalized to DNA content and calculated relative to the control condition (n=5 samples per condition). Statistical significance was determined using unpaired two-tailed Student’s t-tests. Bars show the mean ±SEM. * P<0.05, ** P<0.01, *** P<0.001 versus control conditions. ns = not significant.

References

1. Caron MM, Emans PJ, Surtel DA, van der Kraan PM, van Rhijn LW, Welting TJ. BAPX-1/NKX-3.2 acts as a chondrocyte hypertrophy molecular switch in osteoarthritis. Arthritis Rheumatol. 2015;67(11):2944-56. Epub 2015/08/08. doi: 10.1002/art.39293. PubMed PMID: 26245691.

Submitted filename: Ripmeester et al. Response to reviewers 15112021.pdf

Click here for additional data file.

20 Jan 2022

BMP7 increases protein synthesis in SW1353 cells and determines rRNA levels in a NKX3-2-dependent manner

PONE-D-20-37112R2

Dear Dr. Caron,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Andre van Wijnen

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The revision has addressed my earlier concerns. The manuscript meets the requirements for acceptance to PLoS One.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

31 Jan 2022

PONE-D-20-37112R2

BMP7 increases protein synthesis in SW1353 cells and determines rRNA levels in a NKX3-2-dependent manner

Dear Dr. Caron:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Andre van Wijnen

Academic Editor

PLOS ONE