Identification of polymorphisms in mitochondrial cytochrome c oxidase genes as risk factors for gastric cancer.

BACKGROUND: Single nucleotide polymorphisms (SNPs) in the D-Loop region of mitochondrial DNA (mtDNA) have been implied in tumorigenesis of different types of tumors, but the associations involving polymorphisms in mtDNA coding regions still need to be clarified. This study aimed to identify SNPs of mitochondrial cytochrome c oxidase genes (MT-CO) in the occurrence of gastric cancer (GC).
METHODS: The MT-CO genes were sequenced between 170 GC patients and 174 matched healthy controls. The χ 2 test was used to analyze differences in SNP frequencies between the two groups.
RESULTS: The SNPs of MT-CO region were associated with the risk of GC. The genotype 9540T was significantly associated with an increased risk for GC (P=0.018), whereas 9548G was associated with a reduced risk (P=0.029).
CONCLUSIONS: The SNPs in MT-CO genes were found to be risk biomarkers for GC. It may provide a novel insight into the molecular mechanism in GC tumorigenesis and progression. 2020 Translational Cancer Research. All rights reserved.

Introduction

Although the incidence of gastric cancer (GC) has declined substantially in the past few decades, it remains the fifth most common cancer and the third most frequent cause of cancer deaths worldwide (1,2). GC is multifactorial, and it is very important to develop reliable biomarkers for predicting the risk of GC to maximize therapeutic effects and to minimize adverse effects of treatment. Many studies have evaluated the roles of nuclear DNA alterations in gastric tumorigenesis; however, relatively less attention has been paid to mitochondrial DNA (mtDNA) alterations (3).

The proximity of the mitochondrial genome to reactive oxygen species production sites, limited repair mechanisms, and a lack of protective histone proteins all result in a higher mutation rate in the mitochondrial genome than in the nuclear genome (4). In the present study, we have identified associations between mutations in the D-Loop and a wide variety of cancers, including GC, colorectal cancer, non-Hodgkin’s lymphoma, non-small cell lung cancer and breast cancer, etc., but associations involving polymorphisms in mtDNA coding regions remain largely unknown (5-9). Mitochondrial cytochrome c oxidase (MT-CO) genes (including MT-CO1, MT-CO2 and MT-CO3) encode three subunits of respiratory complex IV, a key enzyme in aerobic metabolism. Mutations in MT-CO genes may play important roles in cancer formation by increasing the production of reactive oxygen species during mitochondrial oxidative phosphorylation (10). We have previously found that single nucleotide polymorphisms (SNPs) in MT-CO genes are important in evaluating the risk of hepatocellular carcinoma (11). However, no studies have confirmed that SNPs in MT-CO genes have a good predictive value on GC.

In this study, we sequenced a region of approximately 4,560 bp flanking the majority of MT-CO genes from the blood of patients with GC to identify SNPs associated with cancer and these results may facilitate the precise prediction of the risk of gastric tumorigenesis. We present the following article/case in accordance with the STREGA reporting checklist (available at http://dx.doi.org/10.21037/tcr-19-2227).

Methods

Sample preparation and DNA extraction

Blood samples were obtained from 170 patients with GC, who underwent tumor resection in the Department of General Surgery in 2007–2008 at the Fourth Hospital of Hebei Medical University. Data were collected from each GC patient including gender, age at diagnosis, tumor size, extent of differentiation, and stage. Blood samples of 174 healthy subjects receiving a physical examination were also collected. All procedures were supervised and approved by the Human Tissue Research Committee at the hospital. The number of ethical approval was MEC2008-2. Informed consent was obtained from all participants before enrollment and all the samples were anonymous.

Total mtDNA was isolated from blood samples and cells using the Wizard® Genomic DNA Purification Kit (Promega Corporation, Fitchburg, WI, USA) according to manufacturer’s instructions and immediately stored at −20 °C.

PCR amplification and sequence analysis

The primer pairs for MT-CO1 (bp 5530–6050), MT-CO1 (bp 6040–6530), MT-CO1 (bp 6550–7130), MT-CO2 (bp 7120–7600), MT-CO2 (bp 7640–8180), MT-CO2 (bp 8200–8770), MT-CO3 (bp 8870–9320), MT-CO3 (bp 9320–9810), and MT-CO3 (bp 9640–10090) are listed in . PCR was performed using the PCR Green Master Mix (Thermo, Billerica, MA, USA) according to the manufacturer's instructions and PCR products were purified prior to sequencing. Reaction parameters were as follows: 95 °C for 3 min, followed by 35 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min, and a final extension at 72 °C for 5 min. Cycle sequencing was performed using the Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA), and the products were read using the ABI PRISM® 3100 Genetic Analyzer (Life Technologies, Carlsbad, CA, USA).

Table 1

Primer pairs used to amplify the mitochondrial cytochrome c oxidase genes (MT-CO) region

Gene	Forward primer; reverse primer
MT-CO1 (5530-6050)	5'-GCTACTCCTACCTATCTCCC -3'; 5'- TGTGGTCGTTACCTAGAAGG-3'
MT-CO1 (6040-6530)	5'- CTATTATTCGGCGCATGAGC -3'; 5'- TTGAGGTTGCGGTCTGTTAG -3'
MT-CO1 (6550-7130)	5'- CCTATCTCTCCCAGTCCTAG -3'; 5'- GGATTTTGGCGTAGGTTTGG -3'
MT-CO2 (7120-7600)	5'- GCCATCATAGGAGGCTTCAT-3'; 5'- AGACCTACTTGCGCTGCATG -3'
MT-CO2 (7640-8180)	5'- ACATGCAGCGCAAGTAGGTC-3'; 5'- AACTGTGGTTTGCTCCACAG -3'
MT-CO2 (8200-8770)	5'- CACTTTCACCGCTACACGAC -3'; 5'- TCCGAGGAGGTTAGTTGTGG -3'
MT-CO3 (8870-9320)	5'- CCACAACTAACCTAATCGGA-3'; 5'- AGCGTTATGGAGTGGAAGTG -3'
MT-CO3 (9320-9810)	5'- TCTCAGCCCTCCTAATGACC-3'; 5'- TGACGTGAAGTCCGTGGAAG -3'
MT-CO3 (9640-10090)	5'-GTCCCACTCCTAAACACATC -3'; 5'-GTAAGGCTAGGAGGGTGTTG -3'

Statistical analysis

All the experimental results were calculated using SPSS 24.0 statistical software (SPSS Inc., Chicago, IL, USA). The associations between the SNPs in the MT-CO genes and clinical parameters and the risk of GC were assessed using chi-squared tests. The magnitude of the association was estimated by the odds ratio (OR) and 95% confidence intervals (95% CI). All assays were repeated for at least three times. P<0.05 was considered statistically significant, and all reported P values are two-sided.

Results

A total of 170 patients with GC and 174 healthy controls were enrolled in the study. There were no statistical differences in the SNP frequency distribution with respect to age and gender. This meant that the two groups of patients were comparable ().

Table 2

The clinical characteristics of cases and controls

Group	Case (n=170)1	Control (n=174)	P value
Age (years)			0.393
≤60	85	95
>60	85	79
Gender			0.075
Male	120	107
Female	50	67

1Sample size.

We analyzed mitochondrial MT-CO1 (nucleotides 5904–7445), MT-CO2 (nucleotides 7586–8269), and MT-CO3 (nucleotides 9207–9990) sequences in 28 patients with GC and healthy controls randomly. Nine SNPs with a minor allele frequency exceeding 5% in either patients or controls were used for the cancer risk analysis (). Two potential cancer risk-associated SNPs, 9540T/C (P=0.060) and 9548G/A (P=0.235), determined by χ2 tests were reevaluated using all subjects. Associations of the SNPs with GC are summarized in . The 9540T genotype was significantly associated with a higher risk of GC (P=0.018, OR =1.671, 95% CI: 1.090–2.561), and 9548G was significantly associated with a reduced risk (P=0.029, OR =0.208, 95% CI: 0.044–0.977).

Table 3

Nine single nucleotide polymorphisms (SNPs) between 28 cases and controls

Gene	Allele	Case (n=28)1	Control (n=28)	χ2	P value
MT-CO1	6392T/C	26/2	24/4	0.187	0.666
	6455C/T	24/4	25/3	0.000	1.000
	6962G/A	25/3	27/1	0.269	0.604
	7196C/A	26/2	27/1	0.000	1.000
MT-CO2	7853G/A	26/2	27/1	0.000	1.000
MT-CO3	9540T/C	19/9	12/16	3.541	0.060
	9548G/A	25/3	28/0	1.409	0.235
	9824T/C	24/4	27/1	0.878	0.349
	9950T/C	26/2	28/0	0.519	0.471

1Sample size.

Table 4

The single nucleotide polymorphisms (SNPs) at positions 9,540 and 9,548 between cases and controls

Allele	Case (n=170)1	Control (n=174)	χ2	P value	OR	95% CI
9540T/C	91/79	71/103	5.588	0.018	1.671	1.090–2.561
9548G/A	161/9	172/2	4.772	0.029	0.208	0.044–0.977

1Sample size.

The SNPs related to GC were compared with the clinical characteristics of patients. Data demonstrated that the SNP sites of 9540T/C was associated with age-at-onset of the patients. The age-at-onset for patients with 9540C genotype was significantly earlier than that of patients carrying 9540T (P=0.021). Other clinicopathological variables, such as gender, tumor size, extent of differentiation, and stage showed no significant correlation with nucleotides 9540T/C (). Additionally, there was no significant difference between 9548 allele related to the incidence of GC and the clinical characteristics. The results are shown in .

Table 5

Alterations in alleles 9540 in relation to clinical characteristics of gastric cancer patients

Characteristics	No. of 9540T/Total	Percentage	P value
Gender			0.351
Male	67/120	55.8%
Female	24/50	48.0%
Age (years)			0.021
≤60	38/85	44.7%
>60	53/85	62.4%
Tumor size (diameter)			0.560
≤6 cm	42/82	51.2%
>6 cm	49/88	55.7%
Extent of differentiation			0.451
Moderately differentiated	34/68	50.0%
Poorly differentiated	57/102	55.9%
Clinical stages			0.153
I + II	31/50	62.0%
III + IV	60/120	50.0%

Table 6

Alterations in alleles 9,548 in relation to clinical characteristics of gastric cancer patients

Characteristics	No. of 9548G/Total	Percentage	P value
Gender			0.627
Male	113/120	94.2%
Female	48/50	96.0%
Age (years)			0.304
≤60	82/85	96.5%
>60	79/85	92.9%
Tumor size (diameter)			0.109
≤6 cm	80/82	97.6%
>6 cm	81/88	92.0%
Extent of differentiation			0.263
Moderately differentiated	66/68	97.1%
Poorly differentiated	95/102	93.1%
Clinical stages			0.791
I + II	47/50	94.0%
III + IV	114/120	95.0%

Discussion

Mitochondrial DNA is predicted to be involved in carcinogenesis owing to the high mutation rate and limited repair mechanisms. We previously focused on the role of mitochondrial D-Loop variation in tumor development. In this study, we examined the roles of MT-CO genes in mtDNA coding regions and identified two SNPs at positions 9540 and 9548 associated with GC risk by χ2 analysis. This is the first study to report an association between MT-CO genes and GC. In addition, the present study showed the age-at-onset for patients with 9540C genotype was significantly earlier than that of patients carrying 9540T. SNPs in the MT-CO genes may prove effective for predict age at onset in GC patients, which needs to be further researched in future.

Many cancer-associated mtDNA polymorphisms inhibit the oxidative phosphorylation of respiratory chain (12,13). The MT-CO genes encode three subunits of respiratory complex IV, which is the terminal enzyme in the electron transport chain that catalyzes the final step of electron transfer from reduced cytochrome c to oxygen to generate H2O (14). Homoplasmic polymorphisms in this region are thought to be too subtle to have detectable effects on oxidative phosphorylation, but the long-term accumulation of subtle differences in oxidative phosphorylation activity may result in oxidative stress. Thus, mtDNA polymorphisms can have important roles in tumor formation. There are reports of associations of polymorphisms in mtDNA coding regions with human cancer (15). We previously identified an association between a SNP at nucleotide position 9545 and hepatocellular carcinoma risk (11). However, 9540T/C, 9545A/G, and 9548 G/A in MT-CO3 are synonymous substitutions. This does not exclude the possibility that the nucleotide substitutions cause impairments in RNA processing due to improper precursor RNA folding (16).

There are still some shortcomings due to the limited experimental conditions. For example, the significance of mutations in these genes for the occurrence and development of cancer still needs to be verified by further research. A statistical analysis with big data cannot be performed due to limited experimental subjects and we will conduct a longer follow-up study on the subjects to obtain more valuable guidance.

Taken together, our results combined with those of previous studies suggest that genetic polymorphisms in MT-CO genes may be useful for identifying patients at high risk for developing GC. More extensive biochemical and molecular studies will be essential to determine the pathological significance of these changes.