Literature DB >> 34968160

microRNA-20b-5p overexpression combing Pembrolizumab potentiates cancer cells to radiation therapy via repressing programmed death-ligand 1.

Kexin Jiang1, Huawei Zou2.   

Abstract

Radiation therapy (RT) is widely applied in cancer treatment. The sensitivity of tumor cells to RT is the key to the treatment. This study probes the role and mechanism of miR-20b-5p in Pembrolizumab's affecting the radiosensitivity of tumor cells. After Pembrolizumab treatment or cell transfection (miR-20b-5p mimics and miR-20b-5p inhibitors), tumor cells (NCI-H460 and ZR-75-30) were exposed to RT. The sensitivity of NCI-H460 and ZR-75-30 to RT was evaluated by monitoring cell proliferation and apoptosis. The dual-luciferase reporter assay and RNA immunoprecipitation (RIP) were adopted to evaluate the binding relationship between miR-20b-5p and CD274 (PD-L1). The xenograft model was established in nude mice to examine the mechanism of action of Pembrolizumab in vivo. Our outcomes exhibited that either Pembrolizumab treatment or miR-20b-5p overexpression potentiated radiosensitivity of tumor cells. Overexpressing miR-20b-5p enhanced radiosensitization of Pembrolizumab in vivo and in vitro by targeting PD-L1 and inactivating PD-L1/PD1. Overall, miR-20b-5p overexpression combined with Pembrolizumab potentiated cancer cells' sensitivity to RT by repressing PD-L1/PD1.Abbreviations Akt: serine/threonine kinase 1; cDNA: complementary DNA; CO2: carbon dioxide; EDTA: Ethylene Diamine Tetraacetic Acid; ENCORI: The Encyclopedia of RNA Interactomes; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; IGF2BP2: insulin like growth factor 2 mRNA binding protein 2; IHC: Immunohistochemistry; LncRNA MALAT1: Long non-coding RNA metastasis-associated lung adenocarcinoma transcript 1; miRNAs: MicroRNAs; Mt: Mutant type; MTT: 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide; NC: negative control; NR2F2: nuclear receptor subfamily 2 group F member 2; NSCLC: non-small cell lung cancer; OD: optical density; PBS: phosphate-buffered saline; PD-L1: Programmed death-ligand 1; PD-1: programmed death 1; PI3K: phosphatidylinositol 3-kinase; qRT-PCR: Quantitative reverse transcription-polymerase chain reaction; RIP: RNA immunoprecipitation; RIPA: Radio Immunoprecipitation Assay; RRM2: ribonucleotide reductase regulatory subunit M2; RT: Radiation therapy; U6: U6 small nuclear RNA; V: volume; WB: Western blot; Wt: wild type; x ± sd: mean ± standard deviation.

Entities:  

Keywords:  Mir-20b-5p; PD-L1/PD1; Pembrolizumab; cancer; radiation therapy

Mesh:

Substances:

Year:  2022        PMID: 34968160      PMCID: PMC8805988          DOI: 10.1080/21655979.2021.2014617

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   3.269


Introduction

Cancer is a threat to all humankind, characterized by its infinite proliferation and heredity [1]. Genetic mutations in human somatic cells are responsible for cancer. These mutations cause the cells to manifest different phenotypes and an escape from maintaining a balanced state of normal cell numbers [2]. In addition, tumourigenesis is linked to the tumor microenvironment, as tumor cells can interact with surrounding cells through the circulatory and lymphatic systems, which in turn affects cancer progression [3]. With advances in science, technology and medical treatment, cancer treatment has been increasingly improved. To date, the main cancer treatment options include surgery, radiotherapy (RT), chemotherapy, immunotherapy, photodynamic therapy and molecular targeted therapy [4-6]. RT remains an essential approach to cancer treatment, with the main aim of abating cancer cell proliferation [7]. Nonetheless, data from clinical applications suggest that reduced radiosensitivity is a serious impediment to treatment effectiveness. Thus, it is imperative to identify innovative ways to boost the radiosensitivity of tumor cells. The alteration of immune microenvironment has been regarded as an outstanding characteristic during tumorigenesis and tumor progression [8,9]. Cancer immunotherapies, including checkpoint inhibitors and adoptive cell therapy, manipulate the immune system to recognize and attack cancer cells [10]. Programmed death-ligand 1 (PD-L1, also known as CD274) is an immune checkpoint protein that represses immune function by binding to the programmed death 1 (PD-1) receptor [11]. Pembrolizumab, an anthropogenic inhibitor of PD-1, has been extensively researched in various malignancies [12-15]. Besides, Pembrolizumab improves survival in patients with chemotherapy-resistant gastric cancer [16]. These reports provide ample evidence of the application and value of Pembrolizumab in cancer. Notwithstanding, the functions and underlying mechanisms of Pembrolizumab in terms of tumor radiosensitivity remain the subject of exploration. MicroRNAs (miRNAs) are a class of non-coding RNAs of approximately 22 nucleotides in length that modulate cell growth, development and metabolism by targeting messenger RNAs and repressing gene expression [17-19]. Uncontrolled aberrant expression of miRNAs correlates with cancer and may have either oncogenic or tumor-suppressive effects [20,21]. Interestingly, several miRNAs have been found altered in the immune microenvironment of cancers and function as a biomarker of immunotherapies [22-24]. miR-20 family members have been confirmed to regulate multiple tumors, such as osteosarcoma [17] and liver cancer [18]. For instance, miR-20b-5p blocks colon cancer cells’ cycle, migration, and invasion by targeting cyclin D1 [19]. Nevertheless, the involvement of miR-20b-5p in the modulation of tumor radiosensitivity by Pembrolizumab is uncertain. In this study, we found that miR-20b-5p reduced the proliferation and promoted cell apoptosis of two cancer cell lines, including NCI-H460 (a human lung cancer cell line) and ZR-75-30 (a human breast cancer line). In addition, miR-20b-5p enhanced Pembrolizumab-mediated radiosensitivity of tumor cells. PD-L1 was found as a potential target of miR-20b-5p, and negatively regulated by the latter. Therefore, we guessed that miR-20b-5p combined with Pembrolizumab enhanced the radiosensitivity of tumor cells by hampering PD-L1/PD1. We hope this study provides a new reference for the cancer immunotherapy clinically.

Materials and methods

Cell culture and transfection

Lung cancer cells (NCI-H460) and breast cancer cells (ZR-75-30) were ordered from American Type Culture Collection (Rockville, USA). The above cells were grown in RPMI-1640 complete medium (Thermo Fisher Scientific, Shanghai, China) comprising 10% fetal bovine serum and 1% penicillin/streptomycin. They were then maintained at 37°C with 5% CO2 and saturated humidity, with the medium substituted once every 2 to 3 days. During cells’ logarithmic growth phase, 0.25% trypsin (Thermo Fisher HyClone, Utah, USA) was adopted for trypsinization and passage. The tumor cells were handled with Pembrolizumab (Cat.No.GC19531, Cas.No.1374853–91-4, GLPBIO, USA) at different concentrations (0, 0.125, 0.25, 0.5, 1, 2, 4, 8, 16 µM) for 24 hours, and the medium was replaced with a fresh one. Afterward, the cells were trypsinized with 0.25% trypsin for subsequent experiments. The above drug-treated and untreated cell lines were inoculated into 6-well plates and further cultured in an incubator. When the cells reached more than 70% confluence, they were transfected with miR-20b-5p mimics and miR-20b-5p’s negative controls (miR-NC), followed by 48 hours of culturing. After trypsinization with 0.25% trypsin, the cells were employed for subsequent experiments [20].

Cell radiation therapy

X-rays generated by a linear accelerator source (Elekta, Stockholm, Sweden) were adopted for cell radiation at a dose rate of 300 cGy/min. NCI-H460 and ZR-75-30 cells were treated with Pembrolizumab (1–2 μM) for 24 hours, or transfected with miR-20b-3p mimics for 48 hours. Next, the cells were subjected to X-rays with varying intensities (0, 0.5, 1, 2, 3, 4 Gy) for 24 hours [21]. After that, the proliferation and apoptosis of the cells were detected.

3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) assay

After tumor cells (NCI-H460 and ZR-75-30) were treated differently, the primary culture medium was discarded, and the cells were inoculated into 96-well plates (5 × 103/mL) for further culture for 48 hours. Subsequently, 20 µL MTT (MedChem Express, New Jersey, USA) solution (5 mg/mL) was added to each well and cultured for 4 hours. The supernatant was discarded, and 150 µL dimethyl sulfoxide (Solarbio, Beijing, China) was added to each well. The plates were placed on a shaking table and oscillated at a low speed for 10 minutes. After the crystal was dissolved, the optical density (OD) value at 450 nm was measured with a microplate reader [22]. Cell survival score = Experimental group (OD)/control group (OD).

Flow cytometry

After different treatments, tumor cells (NCI-H460 and ZR-75-30) were trypsinized with EDTA (Ethylene Diamine Tetraacetic Acid)-free trypsin, centrifuged and harvested. After washing twice with phosphate-buffered saline (PBS), the cells were stored at a low temperature. AnnexinV-PE/7-AAD (Yeasen Biotech Co., Ltd.) was employed to examine apoptosis [22]. The above procedure was repeated three times and averaged.

Western blot (WB)

Total protein was extracted out of tumor cells (NCI-H460 and ZR-75-30) and tumor tissues with the RIPA (Radio Immunoprecipitation Assay) lysate, and the protein content was determined by the BCA method. Next, the protein was separated by 10% polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes. The membranes were then blocked with 5% skimmed milk and maintained with the primary Anti-Bax antibody (1:1000, ab32503), Anti-Bcl2 antibody (1:1000, ab32124), Anti-Caspase-3 antibody (1:1000, ab13847), Anti-PD-L1 antibody (1:1000, ab205921), Anti-PD1 antibody (1:1000, ab237728), and Anti-β-actin antibody (1:1000, ab8226) at 4°C overnight. After the membranes were washed with PBST, they were incubated with the secondary Goat Anti-Rabbit IgG (1:2500, ab6721) at room temperature for 2 hours. The above antibodies were purchased from Abcam (MA, USA). The strips were developed using an efficient chemiluminescence kit after re-washing with PBST [23]. The gray intensity of images was analyzed by ImageJ software.

Quantitative reverse transcription-polymerase chain reaction (qRT-PCR)

The total RNA was extracted by the TRIzol method. The RNA purity was determined and complementary DNA (cDNA) was obtained by utilizing the TaKaRa RNA reverse transcription kit (TaKaRa, Japan). PCR amplification was performed using specific primers of miR-20b-5p (Sangon Biotech, Shanghai, China), with cDNA as a template. U6 (U6 small nuclear RNA) and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) were employed as housekeeping genes for miR-20b-5p and CD274, respectively. Relative expression of genes was calculated by 2−ΔΔCT, and all experiments were done three times [23]. The primer sequences are shown in Table 1.
Table 1.

The primer sequences

Genes Primer sequence (5ʹ3ʹ) 
miR-20b-5p F: TGTCAACGATACGCTACGAR: GCTCATAGTGCAGGTAGA 
U6 F: CAACAGGCTCGTGAAAGACCR: GTTCGTCAACCTAGCGCAG 
CD274 F: ACACAAGGAGCTCTGTTGGAR: CGTTGTGCTTGAACCCTTGA 
GAPDH F: CTCCTCCTGTTCGACAGTCAGCR: CCCAATACGACCAAATCCGTT 
The primer sequences

Dual-luciferase reporter assay

Luciferase reporter vectors (CD274-Wt and CD274-Mt) and luciferase activity detection kits were provided by Promega (Madison, WI, USA). The concentration of tumor cells (NCI-H460 and ZR-75-30) was adjusted to 4 × 104/ mL, and the cells were then inoculated into 48-well plates. When the cell abundance rate reached 70%, CD274-Wt (wild type) or CD274-Mt (Mutant) were co-transfected with miR-20b-5p mimics or their negative control miR-NC using lipofectamine 2000. Luciferase activity was measured with a luciferase assay kit 48 hours after the transfection, as instructed by the manufacturer [24]. All experiments were repeated three times, and the mean value was taken for data analysis.

RNA immunoprecipitation (RIP)

The above-mentioned tumor cells were transfected with miR-NC or miR-20b-5p mimics, respectively. Forty-eight hours later, the ThermoFisher RIP kit (ThermoFisher Technologies, Massachusetts, USA) was employed for RIP detection of transfected cells. The cells were then incubated with anti-Ago2 antibody (Millipore) or negative control IgG (Millipore). Finally, qRT-PCR was conducted to verify the relative enrichment of miR-20b-5p and CD274 [24].

Tumor formation in nude mice

This animal experiment was authorized by the Animal Ethics Committee of Shengjing Hospital of China Medical University. Twenty BALB/c nude mice (6–8 weeks old; weighing 16–24 g) were ordered from the Animal Experiment Center of China Medical University. NCI-H460 cells stably transfected with miR-NC or miR-20b-5p mimics were taken and irradiated by X-ray (1 Gy) after the addition of Pembrolizumab (1 µM) or an equal volume of sterile saline. After cell treatment, single-cell suspensions (1 × 107 cells/mL) were made. Then, 0.2 mL of the suspension was injected subcutaneously into the left axilla of nude mice (n = 5) using a 1 mL syringe. The mice’s growth status was observed. At weeks 1, 2, 3 and 4 after the injection, tumor volumes were calculated according to the formula V (volume) = long diameter×short diameter2 × 0.5. Thirty days later, all nude mice were executed by a high concentration of CO2 (carbon dioxide) [25], and the tumor tissues carried by the nude mice were stripped and weighed.

Immunohistochemistry (IHC)

After conventional paraffin embedding and sectioning (4 μM), xenografted tumor tissues were routinely dewaxed in xylene, hydrated in gradient alcohol, and inactivated by 3% hydrogen peroxide for 10 min. Microwave repair (Hydrogen ion concentration = 6.0, 15 minutes) was performed by applying 0.01 mol/L sodium citrate buffer. After the sections were closed with 5% bovine serum albumin for 20 minutes, the primary antibody anti-PD-L1 (Abcam, 1:250, ab213524) was added dropwise and maintained overnight at 4°C. The next day, the goat anti-rabbit secondary antibody (Abcam, 1:2000, ab6721) was added dropwise and maintained for 20 minutes at room temperature, and the sections were developed with DAB after PBS washing. Following hematoxylin re-staining, the sections were dehydrated, transparentized, mounted, and examined microscopically [26].

Statistical analysis

Data were analyzed using GraphPad Prism 8 (GraphPad Software, USA). Measurement data were expressed as mean ± standard deviation (x± sd). An independent sample t test was used for the comparison between the two groups, and the multi-factor comparison was made by one-way analysis of variance. P < 0.05 indicated statistical significance.

Results

Pembrolizumab (MK-3475) heightened radiosensitivity of tumor cells

To characterize the influence of Pembrolizumab (MK-3475) on the radiosensitivity of tumor cells, we exposed Pembrolizumab-treated tumor cells to various intensities of X-ray radiation and then assayed the alterations in tumor cell proliferation and apoptosis. MTT assay was employed to verify the toxicity of Pembrolizumab to tumor cells (NCI-H460, ZR-75-30). As a result, high concentrations of Pembrolizumab (4, 8, 16 µM) substantially heightened tumor cell viability (P < 0.05, Figure 1(a,b)), while low concentrations of Pembrolizumab (0.25, 0.5, 1, 2 µM) had no substantial influence on tumor cells (P > 0.05, Figure 1(a,b)). As exhibited in Figure 1(c,d), the MTT assay demonstrated that Pembrolizumab at 2 µM facilitated the radiosensitivity of tumor cells (P < 0.05). As indicated by flow cytometry, X-ray radiation (1 Gy) evidently strengthened tumor cell apoptosis. After using Pembrolizumab on the basis of X-ray (1 Gy), the apoptotic level of tumor cells was further augmented (P < 0.05, Figure 1(e,f)). Besides, the higher the concentration of Pembrolizumab, the more pronounced the pro-apoptotic effect. The expression of apoptosis-related proteins was evaluated by WB. As a result, the application of X-ray radiation (1 Gy) alone resulted in facilitated expression of Bax and Caspase-3 and declined expression of bcl-2 in the tumor cells. Moreover, Pembrolizumab (1, 2 µM) elevated the expression of Bax and Caspase-3 and dampened the bcl-2 expression in tumor cells versus the X-ray radiation (1 Gy) group (P < 0.05, Figure 1(g,h)). These results corroborated that Pembrolizumab boosted the radiosensitivity of tumor cells.
Figure 1.

Pembrolizumab heightened radiosensitivity of tumor cells a-b. We evaluated the toxicity of Pembrolizumab (0, 0.25, 0.5, 1, 2, 4, 8, 16 µM) to tumor cells (NCI-H460 and ZR-75-302) using the MTT assay. After 24 hours of treatment with Pembrolizumab (1, 2 µM), tumor cells were treated with X-ray radiation (0, 0.5,1, 2, 3, 4 Gy). c-d. The radiosensitivity of tumor cells was gauged by MTT. G-I. The apoptosis was verified by flow cytometry. e-f. WB compared the expression of Bax, bcl-2, and Caspase-3. nsP>0.05, *P < 0.05, **P < 0.01(vs.con group). nsP>0.05, +P < 0.05, ++P < 0.01(vs.1 Gy group). n = 3.

Pembrolizumab heightened radiosensitivity of tumor cells a-b. We evaluated the toxicity of Pembrolizumab (0, 0.25, 0.5, 1, 2, 4, 8, 16 µM) to tumor cells (NCI-H460 and ZR-75-302) using the MTT assay. After 24 hours of treatment with Pembrolizumab (1, 2 µM), tumor cells were treated with X-ray radiation (0, 0.5,1, 2, 3, 4 Gy). c-d. The radiosensitivity of tumor cells was gauged by MTT. G-I. The apoptosis was verified by flow cytometry. e-f. WB compared the expression of Bax, bcl-2, and Caspase-3. nsP>0.05, *P < 0.05, **P < 0.01(vs.con group). nsP>0.05, +P < 0.05, ++P < 0.01(vs.1 Gy group). n = 3.

The effect of Pembrolizumab (MK3475) on miR-20b-5p and the PD-L1/PD1 pathway

To elucidate the mechanism by which Pembrolizumab affected the radiosensitivity of tumor cells (NCI-H460 and ZR-75-30), we conducted qRT-PCR to check the expression of miR-20b-5p and WB to monitor the expression of the PD-L1/PD1 pathway. Tumor cells were processed with Pembrolizumab (1 and 2 µM). qRT-PCR outcomes demonstrated that Pembrolizumab dramatically enhanced the miR-20b-5p expression (P < 0.05, Figure 2(a,b)). WB monitored the PD-L1/PD1 pathway expression and validated that Pembrolizumab distinctly hampered the expression of PD-L1 and PD1 (P < 0.05, Figure 2(c,d)). These findings affirmed that Pembrolizumab boosted miR-20b-5p levels and abated the PD-L1/PD1 expression.
Figure 2.

The effect of Pembrolizumab on miR-20b-5p and the PD-L1/PD1 pathway Tumor cells (NCI-H460 and ZR-75-302) were handled with Pembrolizumab (1 and 2 µM) for 24 hours. a-b. qRT-PCR examined the miR-20b-5p expression. d-f. The PD-L1/PD1 pathway expression was monitored by WB. c-d. The transfection validity of miR-20b-5p was examined by qRT-PCR. nsP>0.05, *P < 0.05, **P < 0.01(vs.con group). n = 3.

The effect of Pembrolizumab on miR-20b-5p and the PD-L1/PD1 pathway Tumor cells (NCI-H460 and ZR-75-302) were handled with Pembrolizumab (1 and 2 µM) for 24 hours. a-b. qRT-PCR examined the miR-20b-5p expression. d-f. The PD-L1/PD1 pathway expression was monitored by WB. c-d. The transfection validity of miR-20b-5p was examined by qRT-PCR. nsP>0.05, *P < 0.05, **P < 0.01(vs.con group). n = 3.

Overexpressing miR-20b-5p strengthened the radiosensitivity of tumor cells

We transfected NCI-H460 and ZR-75-30 cells with miR-20b-5p mimics and miR-NC to probe the effect of miR-20b-5p on the radiosensitivity of tumor cells. As displayed in Figure 3(a,b), MTT illustrated that tumor cells’ radiosensitivity was amplified after the transfection of miR-20b-5p mimics versus the miR-NC group (P < 0.05). Cell apoptosis was gauged by flow cytometry, which substantiated that apoptosis was higher in the miR-20b-5p mimics group than in the miR-NC group under treatment with X-ray radiation (1 Gy) (P < 0.05, Figure 3(c,d)). The transfection validity of miR-20b-5p was examined by qRT-PCR. As shown in Figure 3(e,f), after the tumor cells were transfected with miR-20b-5p mimics, the expression of miR-20b-5p was higher than that of the miR-NC group (P < 0.05). Also, WB manifested that overexpressing miR-20b-5p elevated the expression of Bax and Caspase-3 and hindered the bcl-2 expression in tumor cells (P < 0.05, Figure 3(g,h)). These outcomes hinted that overexpression of miR-20b-5p boosted the radiosensitivity of tumor cells.
Figure 3.

Overexpressing miR-20b-5p promoted the radiosensitivity of tumor cells The miR-20b-5p overexpression model was constructed in tumor cells. a-b. The radiosensitivity of tumor cells was tested by MTT. c-d. The apoptosis was determined by flow cytometry. e-f. The transfection efficiency of miR-20b-5p was examined by qRT-PCR. g-h. The expression of apoptosis-related proteins was monitored by WB. nsP>0.05(vs.con group). *P < 0.05, **P < 0.01(vs.miR-NC group). n = 3.

Overexpressing miR-20b-5p promoted the radiosensitivity of tumor cells The miR-20b-5p overexpression model was constructed in tumor cells. a-b. The radiosensitivity of tumor cells was tested by MTT. c-d. The apoptosis was determined by flow cytometry. e-f. The transfection efficiency of miR-20b-5p was examined by qRT-PCR. g-h. The expression of apoptosis-related proteins was monitored by WB. nsP>0.05(vs.con group). *P < 0.05, **P < 0.01(vs.miR-NC group). n = 3.

miR-20b-5p targeted PD-L1

Following a query of base sequences using the ENCORI (The Encyclopedia of RNA Interactomes, http://starbase.sysu.edu.cn) database, the dual-luciferase reporter assay and RIP experiment were undertaken to delineate the association between miR-20b-5p and CD274 (PD-L1). As shown in Figure 4(a), there was a complementary base sequence between miR-20b-5p and CD274. The dual-luciferase reporter assay confirmed that overexpressing miR-20b-5p repressed the luciferase activity of CD274-Wt, but it had little impact on CD274-Mt in NCI-H460 and ZR-75-30 (P < 0.05, Figure 4(b)). RIP was conducted to further verify the binding relationship between miR-20b-5p and CD274. It turned out that miR-20b-5p and CD274 enriched by anti-AGO2 were more than those in the Anti-IgG group (P < 0.05, Figure 4(c)). The PD-L1/PD1 pathway expression was determined by WB. Interestingly, overexpressing miR-20b-5p impeded PD-L1 and PD1 expression (P < 0.05, Figure 4(d,e)). Thus, we concluded that miR-20b-5p targeted and reversely modulated the PD-L1/PD1 pathway.
Figure 4.

miR-20b-5p targeted PD-L1/PD1 a. Base complementary sequence. b. The association between miR-20b-5p and CD274-Wt and CD274-Mt was determined by the dual-luciferase reporter assay. nsP>0.05, *P < 0.05, (vs.miR-NC group). c, RIP assay checked the binding relationship between miR-20b-5p and CD274. ***P < 0.001(vs. Anti-IgG group). d-e. WB monitored the PD-L1/PD1 pathway expression. ns P > 0.05(vs.con group). * P < 0.05, ** P < 0.01, (vs.miR-NC group). n = 3.

miR-20b-5p targeted PD-L1/PD1 a. Base complementary sequence. b. The association between miR-20b-5p and CD274-Wt and CD274-Mt was determined by the dual-luciferase reporter assay. nsP>0.05, *P < 0.05, (vs.miR-NC group). c, RIP assay checked the binding relationship between miR-20b-5p and CD274. ***P < 0.001(vs. Anti-IgG group). d-e. WB monitored the PD-L1/PD1 pathway expression. ns P > 0.05(vs.con group). * P < 0.05, ** P < 0.01, (vs.miR-NC group). n = 3.

Overexpressing miR-20b-5p potentiated radiosensitization of Pembrolizumab (MK3475)

To figure out the role of miR-20b-5p in the effect of pembrolizumab (MK-3475) on tumor radiosensitivity, tumor cells were exposed to X-ray radiation (1 Gy) after being treated with MK-3475 (1 µM) with or without transfection of miR-20b-5p mimics. As shown in Figure 5(a,b), overexpressing miR-20b-5p significantly facilitated the radiosensitivity of tumor cells (NCI-H460 and ZR-75-302) versus the MK-3475 (1 µM) group (P < 0.05). As indicated by flow cytometry results, under the X-ray radiation (1 Gy), overexpressing miR-20b-5p strengthened the apoptotic rate compared to that of the MK-3475 (1 µM) group (P < 0.05, Figure 5(c,d)). Also, WB outcomes manifested that compared with the MK-3475 (1 µM) group, overexpressing miR-20b-5p elevated the expression of Bax and Caspase-3 and repressed the bcl-2 level under the X-ray radiation (1 Gy) (P < 0.05, Figure 4(e,f)). These data uncovered that overexpressing miR-20b-5p enhanced the radiosensitivity of Pembrolizumab to tumor cells.
Figure 5.

Overexpressing miR-20b-5p enhanced radiosensitization of Pembrolizumab Tumor cells were treated with 1 µM Pembrolizumab (MK-3475) for 24 hours and transfected with miR-20b-5p mimics for 48 hours. The tumor cells were then exposed to 1 Gy of X-ray radiation. a-b. The radiosensitivity of tumor cells was tested by MTT. C-D. Tumor cell apoptosis was verified by flow cytometry. e-f. The expression of apoptosis-related proteins was compared by WB. nsP>0.05, *P < 0.05, **P < 0.01(vs.con group). +P < 0.05, ++P < 0.01(vs.MK-3475 group). n = 3.

Overexpressing miR-20b-5p enhanced radiosensitization of Pembrolizumab Tumor cells were treated with 1 µM Pembrolizumab (MK-3475) for 24 hours and transfected with miR-20b-5p mimics for 48 hours. The tumor cells were then exposed to 1 Gy of X-ray radiation. a-b. The radiosensitivity of tumor cells was tested by MTT. C-D. Tumor cell apoptosis was verified by flow cytometry. e-f. The expression of apoptosis-related proteins was compared by WB. nsP>0.05, *P < 0.05, **P < 0.01(vs.con group). +P < 0.05, ++P < 0.01(vs.MK-3475 group). n = 3.

Pembrolizumab combined with miR-20b-5p curbed tumor cell growth in vivo via repressing PD-L1/PD1 axis

To investigate the mechanism and effect of Pembrolizumab (MK-3475) combined with miR-20b-5p in vivo, we set up a xenograft model in nude mice through subcutaneous injection of NCI-H460 cells treated with MK-3475 (1 μM)/miR-20b-5p mimics. Then, the injected mice were treated with X-ray radiation (1 Gy). The tumor tissues stripped from nude mice were exhibited in Figure 6(a). The volume and wright analysis of tumor tissues illustrated that Pembrolizumab (compared with the 1 Gy group) significantly enhanced the inhibitory effect of X-ray on tumor tissues. Meanwhile, overexpressing miR-20b-5p (vs. 1 Gy+1 μM) further restrained the growth of tumor volume and weight (P < 0.05, Figure 6(b,c)). IHC data displayed a decreasing trend in PD-L1 expression in the control group, the 1 Gy group, the 1 Gy+1 μM group, and the 1 Gy+1 μM+miR-20b-5p group (P < 0.05, Figure 6(d)). WB results revealed that X-ray (compared with the control group) and Pembrolizumab (compared with the 1 Gy group) and miR-20b-5p overexpression (compared with the 1 Gy+1 μM group) evidently restrained the protein expression of PD-L1 and PD1, hampered Bax and Caspase-3 levels and elevated the bcl-2 expression in tumor tissues (P < 0.05, Figure 6(e,f)). These results hinted that Pembrolizumab repressed the PD-L1/PD1 pathway expression by up-regulating miR-20b-5p, thus strengthening the sensitivity of NCI-H460 cells to X-rays.
Figure 6.

Pembrolizumab and miR-20b-5p hindered tumor cell growth in vivo via the PD-L1/PD1 axis The xenograft model was constructed in nude mice via subcutaneous injection of NCI-H460 cells treated with varying factors. a.Tumor images. b and c. Volume and weight analysis of tumor tissues. d. The PD-L1-positive number was counted by IHC. e. WB was implemented to test the expression of PD-L1 and PD1. f. The profiles of apoptosis-related proteins (Bax, bcl-2, and Caspase-3) were checked by WB.

Pembrolizumab and miR-20b-5p hindered tumor cell growth in vivo via the PD-L1/PD1 axis The xenograft model was constructed in nude mice via subcutaneous injection of NCI-H460 cells treated with varying factors. a.Tumor images. b and c. Volume and weight analysis of tumor tissues. d. The PD-L1-positive number was counted by IHC. e. WB was implemented to test the expression of PD-L1 and PD1. f. The profiles of apoptosis-related proteins (Bax, bcl-2, and Caspase-3) were checked by WB.

Discussion

Cancer is among the world’s deadliest health problems. On the one hand, it reduces the patients’ quality of life. On the other hand, it causes a huge economic burden [27]. RT is an important part of cancer treatment [28,29]. Although advances in technology have facilitated the precision of RT [30], RT inevitably causes damage to adjacent normal tissues while killing cancer cells, which weakens its therapeutic effects and limits its clinical application. Fortunately, in this study, we discovered that overexpressing miR-20b-5p combining Pembrolizumab enhanced the radiosensitivity of tumor cells by blocking the PD-L1/PD1 pathway (Figure 7).
Figure 7.

The Schematic diagram miR-20b-5p targets and inhibits PD-L1 expression. Overexpressing miR-20b-5p shows anti-tumor effects, and it enhances Pembrolizumab-mediated RT sensitivity on tumor cells by abating PD-L1/PD1 pathway.

The Schematic diagram miR-20b-5p targets and inhibits PD-L1 expression. Overexpressing miR-20b-5p shows anti-tumor effects, and it enhances Pembrolizumab-mediated RT sensitivity on tumor cells by abating PD-L1/PD1 pathway. Several reports have illustrated that miR-20b-5p is implicated in tumor development and functions as a prognostic factor for tumors [31-33]. Here, we selected lung cancer cells (NCI-H460) and breast cancer cells (ZR-75-30) as study objects and explored the regulatory effect and potential mechanism of miR-20b-5p on RT of these cells. A review of previous studies revealed that the abnormal expression of miR-20 is associated with diversified tumors. For example, long non-coding RNA metastasis-associated lung adenocarcinoma transcript 1 (LncRNA MALAT1) heightens the proliferation, migration, and drug sensitivity of colorectal cancer cells by negatively regulating miR-20b-5p [34]. In parallel, miR-20a-5p, another member of miR-20, acts as a tumor suppressor of NSCLC by regulating the ribonucleotide reductase regulatory subunit M2 (RRM2)-mediated PI3K (phosphatidylinositol 3-kinase)/Akt (serine/threonine kinase 1) axis [35]. In addition, a recent paper claimed that LncRNA COL4A2 antisense RNA 1 targets miR-20b-5p to up-regulate hypoxia-inducible factor 1 alpha subunit, so as to stimulate the proliferation and glycolysis of colorectal cancer cells [36]. These studies support that miR-20 exerts a tumor-suppressive effect on breast cancer cells, lung cancer cells and colorectal cancer cells. Here, we adopted MTT to gauge the sensitivity of tumor cells under different conditions and flow cytometry and WB to evaluate apoptosis. Our results testified that overexpressing miR-20b-5p intensified radiosensitivity and apoptosis of tumor cells (NCI-H460 and ZR-75-302). Further mechanistic studies revealed that PD-L1 was a functional target of miR-20b-5p, and miR-20b-5p inhibited PD-L1/PD1 axis in tumor cells. With the development of science and technology, immunotherapy has been widely studied and applied in cancer treatment. Nevertheless, immunotherapy induces serious adverse reactions such as autoimmunity and nonspecific inflammation due to the regulation of the body’s immune system [37]. Therefore, it is indispensable to explore new drugs to alleviate the toxic and side effects of immunotherapy. Studies have revealed that PDL1 is up-regulated in breast cancer and is associated with its poor prognosis [38]. The interplay between PD-L1 and insulin-like growth factor 2 mRNA binding protein 2 (IGF2BP2) in hypopharyngeal carcinoma has also been reported in the literature. The suppression of PD-L1 and the down-regulation of IGF2BP2 exhibited an inhibitory effect on the survival of FaDu cells both in vitro and in vivo [39]. Pembrolizumab is an immune checkpoint inhibitor and inhibits tumor progression by down-regulating the PDL1/PD1 pathway, confirming the importance of blocking the PD-1 pathway using antibodies to immune blocking proteins in cancer treatment [40]. The anti-tumor effect of Pembrolizumab has been well-established [41]. However, emerging studies have found that tumors gain resistance to Pembrolizumab or the other immune checkpoint inhibitors therapy [42]. It is recognized that eribulin is a highly effective anti-tumor drug that has been approved for pretreatment of metastatic breast cancer, and a controlled clinical trial demonstrated that Pembrolizumab in combination with eribulin was more effective than eribulin alone in the treatment of metastatic breast cancer [43,44]. Here, Pembrolizumab is identified to enhance the radiosensitivity of tumor cells in vitro and in vivo, facilitating miR-20b-5p and choking the PD-L1/PD1 pathway. However, it is worth noting that the experimental objects of this study are limited to tumor cells (NCI-H460 and ZR-75-302) cultured in vitro. Therefore, more studies should be performed in the other tumor cells both in vitro and in vivo. In addition, whether the miR-20b-5p inhibitor could reverse the anti-tumor role of Pembrolizumab needs confirmation. Third, we need to conduct more experiment on verifying the immune microenvironment alterations after miR-20b-5p and Pembrolizumab administration.

Conclusion

Overall, this study revealed that miR-20b-5p was a novel inhibitor of PD-L1 by targeting the 3ʹUTR of PD-L1 mRNA. Overexpressing miR-20b-5p not only shows anti-tumor effects, but also enhances Pembrolizumab-mediated RT sensitivity on tumor cells by abating PD-L1/PD1 (Figure 7). This study provides a promising method in enhancing the anti-tumor effects of immune checkpoint inhibitors by upregulating miR-20b-5p, which brings a new theoretical basis and research direction for cancer immunotherapy and radio-sensitization of tumor cells.
  44 in total

1.  Tumor Suppressor miRNA-204-5p Regulates Growth, Metastasis, and Immune Microenvironment Remodeling in Breast Cancer.

Authors:  Bok Sil Hong; Han Suk Ryu; Namshin Kim; Jisun Kim; Eunshin Lee; Hyunhye Moon; Kyoung Hyoun Kim; Min-Sun Jin; Nam Hoon Kwon; Sunghoon Kim; Donghyun Kim; Doo Hyun Chung; Kyeonghun Jeong; Kwangsoo Kim; Ki Yoon Kim; Han-Byoel Lee; Wonshik Han; Jihui Yun; Jong-Il Kim; Dong-Young Noh; Hyeong-Gon Moon
Journal:  Cancer Res       Date:  2019-02-08       Impact factor: 12.701

2.  Regulation of BTG3 by microRNA-20b-5p in non-small cell lung cancer.

Authors:  Lijun Peng; Shaobin Li; Yuchan Li; Minghui Wan; Xisheng Fang; Yongxin Zhao; Wei Zuo; Yiwen Xuan
Journal:  Oncol Lett       Date:  2019-05-07       Impact factor: 2.967

Review 3.  Association of miR-760 with cancer: An overview.

Authors:  Monika Kaushik Siddharth Manvati; Juveria Khan; Neeraj Verma; Pawan K Dhar
Journal:  Gene       Date:  2020-04-03       Impact factor: 3.688

Review 4.  Molecular targeted therapy: Treating cancer with specificity.

Authors:  Yeuan Ting Lee; Yi Jer Tan; Chern Ein Oon
Journal:  Eur J Pharmacol       Date:  2018-07-20       Impact factor: 4.432

5.  MicroRNA-20b-5p functions as a tumor suppressor in renal cell carcinoma by regulating cellular proliferation, migration and apoptosis.

Authors:  Yifan Li; Duqun Chen; Lu Jin; Jiaju Liu; Zhengming Su; Yuchi Li; Yaoting Gui; Yongqing Lai
Journal:  Mol Med Rep       Date:  2015-12-17       Impact factor: 2.952

Review 6.  Advances in the treatment of gastric cancer.

Authors:  David H Ilson
Journal:  Curr Opin Gastroenterol       Date:  2018-11       Impact factor: 3.287

7.  LncRNA XIST/miR-34a axis modulates the cell proliferation and tumor growth of thyroid cancer through MET-PI3K-AKT signaling.

Authors:  Hua Liu; Haoyu Deng; Yajie Zhao; Can Li; Yu Liang
Journal:  J Exp Clin Cancer Res       Date:  2018-11-21

8.  STAT3 regulated miR-216a promotes ovarian cancer proliferation and cisplatin resistance.

Authors:  Pengfei Jin; Yanjun Liu; Ruijuan Wang
Journal:  Biosci Rep       Date:  2018-08-29       Impact factor: 3.840

9.  miR-448 targets IDO1 and regulates CD8+ T cell response in human colon cancer.

Authors:  Qiong Lou; Ruixian Liu; Xiangling Yang; Weiqian Li; Lanlan Huang; Lili Wei; Huiliu Tan; Nanlin Xiang; Kawo Chan; Junxiong Chen; Huanliang Liu
Journal:  J Immunother Cancer       Date:  2019-08-07       Impact factor: 13.751

10.  Potentiality of α-fetoprotein (AFP) and soluble intercellular adhesion molecule-1 (sICAM-1) in prognosis prediction and immunotherapy response for patients with hepatocellular carcinoma.

Authors:  Weiwei Cao; Yu Chen; Wei Han; Juzheng Yuan; Weimin Xie; Kun Liu; Yan Qiu; Xudan Wang; Xiao Li
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

View more
  5 in total

Review 1.  Implication of microRNAs in Carcinogenesis with Emphasis on Hematological Malignancies and Clinical Translation.

Authors:  Zsuzsanna Gaál
Journal:  Int J Mol Sci       Date:  2022-05-23       Impact factor: 6.208

2.  Everolimus (RAD001) combined with programmed death-1 (PD-1) blockade enhances radiosensitivity of cervical cancer and programmed death-ligand 1 (PD-L1) expression by blocking the phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/mammalian target of rapamycin (mTOR)/S6 kinase 1 (S6K1) pathway.

Authors:  Lili Song; Shikai Liu; Sufen Zhao
Journal:  Bioengineered       Date:  2022-04       Impact factor: 6.832

3.  The effect and mechanism of miR-30e-5p targeting SNAI1 to regulate epithelial-mesenchymal transition on pancreatic cancer.

Authors:  Ziyu Liang; Shaomei Tang; Rongquan He; Wei Luo; Shanyu Qin; Haixing Jiang
Journal:  Bioengineered       Date:  2022-04       Impact factor: 6.832

4.  Long noncoding RNA regulatory factor X3- antisense RNA 1 promotes non-small cell lung cancer via the microRNA-577/signal transducer and activator of transcription 3 axis.

Authors:  Yanjing Hu; Zhi Zhao; Gang Jin; Junhao Guo; Fangyuan Nan; Xin Hu; Yunsheng Hu; Qun Han
Journal:  Bioengineered       Date:  2022-04       Impact factor: 6.832

Review 5.  The Features of Immune Checkpoint Gene Regulation by microRNA in Cancer.

Authors:  Fatimat Kipkeeva; Tatyana Muzaffarova; Alexandra Korotaeva; Danzan Mansorunov; Pavel Apanovich; Maxim Nikulin; Olga Malikhova; Ivan Stilidi; Alexander Karpukhin
Journal:  Int J Mol Sci       Date:  2022-08-18       Impact factor: 6.208

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.