| Literature DB >> 34955856 |
Mengru Ding1, Zhiyan Tang1, Wei Liu1, Taili Shao1,2,3, Pingchuan Yuan1,2,3, Kaoshan Chen1,2,3, Yuyan Zhou1,2,3, Jun Han1,2,3, Jing Zhang4, Guodong Wang1,2,3.
Abstract
Hyperglycemia-induced apoptosis and oxidative stress injury are thought to play important roles in the pathogenesis of diabetic nephropathy (DN). Attenuating high glucose (HG)-induced renal tubular epithelial cell injury has become a potential approach to ameliorate DN. In recent years, burdock fructooligosaccharide (BFO), a water-soluble inulin-type fructooligosaccharide extracted from burdock root, has been shown to have a wide range of pharmacological activities, including antiviral, anti-inflammatory, and hypolipidemic activities. However, the role and mechanism of BFO in rat renal tubular epithelial cells (NRK-52E cells) have rarely been investigated. The present study investigated the protective effect of BFO on HG-induced damage in NRK-52E cells. BFO could protect NRK-52E cells against the reduced cell viability and significantly increased apoptosis rate induced by HG. These anti-oxidative stress effects of BFO were related to the significant inhibition of the production of reactive oxygen species, stabilization of mitochondrial membrane potential, and increased antioxidant (superoxide dismutase and catalase) activities. Furthermore, BFO increased the expression of Nrf2, HO-1, and Bcl-2 and decreased the expression of Bax. In conclusion, these findings suggest that BFO protects NRK-52E cells against HG-induced damage by inhibiting apoptosis and oxidative stress through the Nrf2/HO-1 signaling pathway.Entities:
Keywords: NRK-52E cells; apoptosis; burdock fructooligosaccharide; high glucose; oxidative stress
Year: 2021 PMID: 34955856 PMCID: PMC8695902 DOI: 10.3389/fphar.2021.784187
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Primers used for quantitative real-time PCR.
| Gene | Forward (5'-3') | Reverse (5'-3') |
|---|---|---|
| Nrf2 | AATTGCCACCGCCAGGACT | TCAAACACTTCTCGACTTACCCC |
| HO-1 | CAGCATGTCCCAGGATTTGTC | CCTGACCCTTCTGAAAGTTCCTC |
| Bax | ATGGGCTGGACACTGGACTT | TTCCAGATGGTGAGTGAGGCA |
| Bcl-2 | TTGTGGCCTTCTTTGAGTTCG | GCATCCCAGCCTCCGTTAT |
| GAPDH | CTGGAGAAACCTGCCAAGTATG | GGTGGAAGAATGGGAGTTGCT |
FIGURE 1Preparation and fractionation of BFO. (A) Elution curve of gel filtration chromatography on a Sephadex G75 column. (B) Molecular weight and homogeneity of BFO determined by HPGPC.
FIGURE 2Effect of BFO on the viability of NRK-52E cells. The cell viability was determined by a Cell Counting Kit-8 (CCK-8) test of NRK-52E cells cultured with high glucose (HG) and different concentrations of BFO. All data are expressed as the mean ± SD. ## p < 0.01 vs. normal glucose (NG), * p < 0.05 vs. HG, ** p < 0.01 vs. HG.
FIGURE 3Effect of BFO on apoptosis in NRK-52E cells. Apoptosis of NRK-52E cells cultured with high glucose (HG) and different concentrations of BFO was measured by Annexin V-FITC/PI staining. (A) Representative images of apoptotic NRK-52E cells determined via flow cytometry. (B) Quantification of apoptotic NRK-52E cells. All data are expressed as the mean ± SD. ## p < 0.01 vs. normal glucose (NG), ** p < 0.01 vs. HG.
FIGURE 4Effect of BFO on the level of reactive oxygen species (ROS) in NRK-52E cells. (A) Representative images of ROS generation measured by flow cytometry using the DCFH-DA probe. (B) Histogram representing the quantitative analysis of ROS accumulation in NRK-52E cells. All data are expressed as the mean ± SD. ## p < 0.01 vs. normal glucose (NG), * p < 0.05 vs. HG, ** p < 0.01 vs. HG.
FIGURE 5Effect of BFO on mitochondrial membrane potential in NRK-52E cells. (A) Representative images of mitochondrial membrane potential determined by flow cytometry using the JC-1 probe. (B) Histogram representing the quantitative analysis of mitochondrial membrane potential in NRK-52E cells. All data are expressed as the mean ± SD. ## p < 0.01 vs. normal glucose (NG), * p < 0.05 vs. HG, ** p < 0.01 vs. HG.
FIGURE 6Effect of BFO on SOD (A) and CAT (B) levels in NRK-52E cells. All data are expressed as the mean ± SD. ## p < 0.01 vs. normal glucose (NG), * p < 0.05 vs. HG, ** p < 0.01 vs. HG.
FIGURE 7Effect of BFO on the protein and mRNA expression in NRK-52E cells. (A) Representative bands of Nrf2, HO-1, Bax, and Bcl-2 obtained by western blotting. Relative protein levels (band density) of Nrf2 (B), HO-1 (C), Bax (D), and Bcl-2 (E) were calculated by Image J. Relative mRNA levels of Nrf2 (F), HO-1 (G), Bax (H), and Bcl-2 (I) in NRK-52E cells were determined by real-time PCR. All data are expressed as the mean ± SD. # p < 0.05 vs. normal glucose (NG), ## p < 0.01 vs. NG, * p < 0.05 vs. HG, ** p < 0.01 vs. HG.