| Literature DB >> 36091833 |
Qian Zhang1, Xinhua Xiao1, Ming Li1, Miao Yu1, Fan Ping1.
Abstract
Diabetic nephropathy (DN) is a severe diabetic complication of the kidney and is the main cause of end-stage kidney disease worldwide. Cordyceps sinensis (C. sinensis) is not only a traditional Chinese medicine (TCM) but also a healthy food. In China, C. sinensis has been widely used to treat various kidney diseases. Bailing Capsule, which active ingredient is C. sinensis, is approved to treat kidney disease, respiratory disease, and immune disease. However, its underlying mechanism in DN remains unclear. The purpose of the present study was to investigate the underlying mechanism of Bailing Capsule on kidney in diabetic rats. The DN model was established by streptozotocin (STZ) injection. Low and high doses of Bailing Capsule were orally administrated for 12 weeks after diabetes induction. Renal function was evaluated by serum creatinine, blood urea nitrogen, 24-h urinary protein, and urinary albumin. Mesangial matrix expansion and renal fibrosis were measured using histopathology staining. We found that the disorder of renal function and pathology in DN rats was significantly modified by Bailing Capsule treatment. Consistently, Bailing Capsule markedly alleviated DN rat glomerulosclerosis, tubulointerstitial injury and renal fibrosis as shown by pathological staining. Moreover, Bailing Capsule significantly reduced the kidney triglyceride content and renal lipid droplet formation in DN rats. The renal transcriptome revealed that Bailing Capsule-treated kidneys had 498 upregulated genes and 448 downregulated genes. These differentially expressed genes were enriched in the peroxisome proliferator activated receptor (PPAR) pathway and fatty acid metabolism function ontology. mRNA and protein expression analyses revealed substantial enhancement of the lipolysis pathway and inhibition of lipogenesis in Bailing Capsule-treated rat kidneys compared to DN rats. Bailing Capsule activated the expression of PPARα, ACOX1 (acyl-CoA oxidase 1), and SCD (stearoyl-CoA desaturase) in diabetic nephropathy while suppressing the expression of FASN (fatty acid synthase). In conclusion, Bailing Capsule could attenuate renal triglyceride accumulation in diabetic rats by moderating PPARα pathway.Entities:
Keywords: Cordyceps sinesis; PPARα; diabetic nephropathy; lipid accumulation; transcriptome analysis
Year: 2022 PMID: 36091833 PMCID: PMC9453879 DOI: 10.3389/fphar.2022.915592
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
FIGURE 1Schematic of group design. SD, standard diet; HFD, high-fat diet; DN, diabetic nephropathy; BC-L, low dosage of Bailing Capsule; BC-H, high dosage of Bailing Capsule.
Primers used for qPCR.
| Gene (rat) | Gene bank ID | Forward primer (5′ to 3′) | Reverse primer (3′ to 5′) | Product size (bp) |
|---|---|---|---|---|
|
| NM_017340 | TGTCTGTCACTTCTGTCGCC | CGGACTGCCATCCAAGATGT | 135 |
|
| NM_013196 | CTGTCCGCTACTTCGAGTCC | TCAAGGGGACAACCAGAGGA | 135 |
|
| NM_139192 | GTTCTTCATCGACTGCATGGC | GAACAGGAACTCAGAAGCCCA | 143 |
|
| NM_017332 | GAGCACTGATGAGCACACCT | CCATCAGGTTTCAGCCCCAT | 111 |
Acox1, acyl-CoA oxidase 1; Ppara, peroxisome proliferator activated receptor alpha; Scd, stearoyl-CoA desaturase; Fasn, fatty acid synthase.
FIGURE 2Representative UPLC chromatograms of Bailing Capsule. 1) adenine (390.85 μg/ml), 2) uracil (73.41 μg/ml), 3) uridine (1342.18 μg/ml), 4) adenosine (2136.96 μg/ml), 5) 2′-deoxyadenosine (203.36 μg/ml), 6) guanosine (20.25 μg/ml), and 7) thymidine (1.46 μg/ml).
FIGURE 3Bailing Capsule improved blood glucose and kidney function. (A) Bailing Capsule significantly reduced fasting blood glucose (FBG). (B) Bailing Capsule significantly reduced kidney hypertrophy. (C) Bailing Capsule significantly reduced 24 h urinary protein. (D) Bailing Capsule significantly reduced urinary albuminuria. (E) Bailing Capsule significantly reduced serum creatinine. (F) Bailing Capsule significantly reduced blood urea nitrogen (BUN). DN, diabetic nephropathy; BC-L, low dosage of Bailing Capsule; BC-H, high dosage of Bailing Capsule. Data are expressed as mean ± SD (n = 8). *p < 0.05 and **p < 0.01.
FIGURE 4Bailing Capsule alleviated morphological changes of kidney. (A) H&E staining (400 X) of kidney showed morphological changes in DN rat kidney, including glomerular basement membrane thickening and tubular basement membrane thickening. Bailing Capsule treatment alleviated these changes. Red arrow showed the basement membrane. (B) PAS staining (400 X) of kidney showed morphological changes in DN rat kidney, including glomerular mesangial matrix accumulation. Bailing Capsule treatment alleviated these changes. Blue arrow showed glomerular mesangial matrix accumulation. (C) Masson staining (400 X) of kidney showed collagen fiber deposition. Bailing Capsule relieved renal fibrosis in DN rats. The blue stain by the black arrow indicated is collagens fiber. Scale bar = 20 μm. (D) The quantification of mesangial area/glomerular area (%) of kidney. (E) The quantification of collagen area (%) of kidney. DN, diabetic nephropathy; BC-L, low dosage of Bailing Capsule; BC-H, high dosage of Bailing Capsule. Data are expressed as mean ± SD (n = 8). *p < 0.05 and **p < 0.01.
FIGURE 5Bailing Capsule reduced kidney lipid accumulation. (A) Kidney triglyceride (TG) content. Bailing Capsule reduced kidney TG contents in DN rats. (B) Lipid droplets were detected by Oil Red O staining (400 X). Bailing Capsule reduced the percentage of lipid deposits in DN rats. Black arrow showed the lipid droplets. Scale bar = 20 μm. (C) The quantification of percentage of lipid deposits. DN, diabetic nephropathy; BC-L, low dosage of Bailing Capsule; BC-H, high dosage of Bailing Capsule. Data are expressed as mean ± SD (n = 8). **p < 0.01.
Top 5 enriched GO terms in each catalog associated with differentially expressed genes in Bailing capsule-treated group vs. DN group (p < 0.001).
| Term ID | Term name | Count |
| Involved genes | Fold enrichment | FDR | Catalog |
|---|---|---|---|---|---|---|---|
| GO:0006629 | lipid metabolic process | 19 | 2.42 × 10−8 |
| 5.16 | 8.14 × 10−5 | biological processes |
| GO:0042493 | response to drug | 40 | 1.72 × 10−6 |
| 2.32 | 0.0027 | biological processes |
| GO:0006631 | fatty acid metabolic process | 15 | 2.49 × 10−6 |
| 4.81 | 0.0027 | biological processes |
| GO:0009410 | response to xenobiotic stimulus | 39 | 6.99 × 10−6 |
| 2.22 | 0.0058 | biological processes |
| GO:0006954 | inflammatory response | 27 | 2.17 × 10−5 |
| 2.56 | 0.014 | biological processes |
| GO:0005615 | extracellular space | 100 | 7.11 × 10−9 |
| 1.80 | 3.52 × 10−6 | cellular components |
| GO:0009986 | cell surface | 53 | 4.98 × 10−8 |
| 2.28 | 1.23 × 10−5 | cellular components |
| GO:0016324 | apical plasma membrane | 35 | 6.01 × 10−7 |
| 2.62 | 9.91 × 10−5 | cellular components |
| GO:0005576 | extracellular region | 57 | 1.74 × 10−6 |
| 1.97 | 2.16 × 10−4 | cellular components |
| GO:0016323 | basolateral plasma membrane | 26 | 2.91 × 10−6 |
| 2.95 | 2.88 × 10−4 | cellular components |
| GO:0042802 | identical protein binding | 95 | 1.20 × 10−4 |
| 1.46 | 0.053 | molecular function |
| GO:0042803 | protein homodimerization activity | 45 | 1.25 × 10−4 |
| 1.83 | 0.053 | molecular function |
| GO:0005178 | integrin binding | 16 | 1.60 × 10−4 |
| 3.17 | 0.053 | molecular function |
| GO:0005102 | receptor binding | 28 | 3.47 × 10−4 |
| 2.12 | 0.0807 | molecular function |
| GO:0052689 | carboxylic ester hydrolase activity | 9 | 4.90 × 10−4 |
| 4.82 | 0.080 | molecular function |
FIGURE 6Bioinformation analysis of enriched GO (gene ontology) term and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways of differentially expressed genes from BC-H (high dosage of Bailing Capsule) group vs. DN (diabetic nephropathy) group. (A) Top 5 significant GO term of DEGs (differentially expressed genes) identified by transcriptional analysis in each catalogue. (B) KEGG enrichment analysis for DEGs identified by transcriptomics analysis.
Top 10 enriched KEGG pathways associated with differentially expressed genes in Bailing Capsule-treated group vs. DN group (p < 0.01).
| Pathway ID | Pathway term | Count |
| Involved genes | Fold enrichment | FDR |
|---|---|---|---|---|---|---|
| rno04610 | Complement and coagulation cascades | 15 | 4.62 × 10−6 |
| 4.5 | 6.84 × 10−4 |
| rno03320 | PPAR signaling pathway | 15 | 4.62 × 10−6 |
| 4.5 | 6.84 × 10−4 |
| rno04979 | Cholesterol metabolism | 11 | 1.40 × 10−5 |
| 5.79 | 0.0013 |
| rno01100 | Metabolic pathways | 89 | 1.87 × 10−4 |
| 1.43 | 0.0138 |
| rno04976 | Bile secretion | 13 | 2.52 × 10−4 |
| 3.56 | 0.014 |
| rno01040 | Biosynthesis of unsaturated fatty acids | 7 | 0.0017 |
| 5.31 | 0.084 |
| rno04146 | Peroxisome | 10 | 0.0062 |
| 2.96 | 0.259 |
| rno04151 | PI3K-Akt signaling pathway | 24 | 0.0075 |
| 1.79 | 0.259 |
| rno05204 | Chemical carcinogenesis - DNA adducts | 9 | 0.0087 |
| 3.05 | 0.259 |
| rno00980 | Metabolism of xenobiotics by cytochrome P450 | 9 | 0.0087 |
| 3.05 | 0.259 |
FIGURE 7PPAR (peroxisome proliferator activated receptor) signaling pathway affected by Bailing Capsule in DN (diabetic nephropathy) rats. All the different expression genes of BC-H (high dosage of Bailing Capsule) group vs. DN group in PPAR pathway. Red represents up-regulated; green represents down-regulated, white represents no significant change. FC, fold change in BC-H vs. DN group.
FIGURE 8Real-time PCR analysis for main DEGs (differentially expressed genes) expression. Bailing Capsule increased the mRNA levels of Acox1 (acyl-CoA oxidase 1), Ppara (peroxisome proliferator activated receptor α), Scd (stearoyl-CoA desaturase) and inhibited the mRNA levels of Fasn (fatty acid synthase) in DN (diabetic nephropathy) rats. DN, diabetic nephropathy; BC-L, low dosage of Bailing Capsule; BC-H, high dosage of Bailing Capsule. Data are expressed as mean ± SD (n = 8). **p < 0.01.
FIGURE 9Effect of Bailing Capsule treatment on the expression levels of PPAR (peroxisome proliferator activated receptor) pathway in kidneys of rats shown by immunohistochemistry staining. (A) Representative immunohistochemistry staining for ACOX1, PPARα, SCD, and FASN (400 X). Scale bar = 20 μm. Black arrows showed ACOX1 (+), PPARα (+), SCD (+) and FASN (+) cells in the kidney. Immunohistochemistry staining showed that Bailing Capsule increased the protein levels of ACOX1, PPARα, SCD and inhibited the protein levels of FASN in DN rats. (B) Intensity of ACOX1 (+), PPARα (+), SCD (+) and FASN (+) cells in kidney of rats. DN, diabetic nephropathy; BC-L, low dosage of Bailing Capsule; BC-H, high dosage of Bailing Capsule. Data are expressed as mean ± SD (n = 8). **p < 0.01.
FIGURE 10Effect of Bailing Capsule treatment on the relative protein expression levels of ACOX1, PPARα, SCD and FASN in kidneys of rats shown by western blot. (A) Representative immunoblots of ACOX1, PPARα, SCD, and FASN in kidneys of rats among different groups. Western blot showed that Bailing Capsule increased the protein levels of ACOX1, PPARα, SCD and inhibited the protein levels of FASN in DN rats. (B) Quantification of immunoblots of ACOX1, PPARα, SCD, and FASN. DN, diabetic nephropathy; BC-L, low dosage of Bailing Capsule; BC-H, high dosage of Bailing Capsule. Data are expressed as mean ± SD (n = 8). *p < 0.05 and **p < 0.01.
FIGURE 11Mechanism underlying renal-protective effect of Bailing Capsule. Intracellular lipid accumulation is governed by the syntheses and oxidation of triglyceride in kidney. In diabetic condition, lipogenesis is activated by FASN, whereas lipolysis is inhibited, through PPARα and ACOX1, leading to renal lipid accumulation. Bailing capsule inhibited this triglyceride accumulation through PPAR pathway.