Literature DB >> 34928958

Selection and validation of reference genes for normalization of qRT-PCR data to study the cannabinoid pathway genes in industrial hemp.

Michihito Deguchi1, Shobha Potlakayala1, Zachary Spuhler1, Hannah George1, Vijay Sheri1, Ruba Agili1, Aayushi Patel1, Sairam Rudrabhatla1.   

Abstract

There has been significant interest in researching the pharmaceutical applications of Industrial hemp since its legalization three years ago. The crop is mostly dioecious and known for its production of phytocannabinoids, flavonoids, and terpenes. Although many scientific reports have showed gene expression analysis of hemp through OMICs approaches, unreliable reference genes for normalization of qRT-PCR data make it difficult to validate the OMICs data. Four software packages: geNorm, NormFinder, BestKeeper, and RefFinder were used to evaluate the differential gene expression patterns of 13 candidate reference genes under osmotic, heavy metal, hormonal, and UV stresses. EF-1α ranked as the most stable reference gene across all stresses, TUB was the most stable under osmotic stress, and TATA was the most stable under both heavy metal stress and hormonal stimuli. The expression patterns of two cannabinoid pathway genes, AAE1 and CBDAS, were used to validate the reliability of the selected reference genes. This work provides useful information for gene expression characterization in hemp and future research in the synthesis, transport, and accumulation of secondary metabolites.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34928958      PMCID: PMC8687539          DOI: 10.1371/journal.pone.0260660

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Industrial hemp (Cannabis sativa L.) has a rich history in the civilization of humans because it can provide both phytochemicals and lignocellulosic biomass. This crop originated in Eurasia and is useful all over the world, largely as a fiber crop [1]. Following the emergence of more economically helpful fiber crops, the demand for hemp reduced, and the purpose shifted to usage as a food additive. Hemp seed contains essential fatty acids and proteins and gamma-linolenic acid, which has many health benefits [2]. Hemp seeds and oils are also used to produce nutritional supplements and cosmetics. Recently, attention has been focused on its rich repertoire of pharmaceutical compounds [3]. Hemp produces a diverse array of phytocannabinoids, terpenes, and phenolic compounds with prominent nutraceutical potential [4]. Among them, phytocannabinoids are the most well-known phytochemicals. The predominant compound, cannabidiol (CBD) and tetrahydrocannabinol (THC) followed by cannabigerol (CBG) and cannabichromene (CBC) are highly promising compounds to improve the quality of human health. They act as therapeutic agents for central nervous system diseases such as epilepsy, inflammation, anxiety, and neurodegenerative disorders such as Parkinson’s, Huntington’s, Tourette’s syndrome, and Alzheimer’s [3]. Terpenes present an array of pharmacological properties, including anxiolytic, antibacterial, anti-inflammatory, and sedative effects on human diseases [5-7]. The increasing popularity of hemp-based phytochemicals has spurred the comprehensive analysis of genome and gene expression studies [8-11]. These analyses are necessary to identify the genes involved in secondary metabolite pathways [12, 13] and have helped to discover transcription factors which are the key proteins that positively or negatively control the synthesis of secondary metabolites [14, 15]. Accurate gene expression studies such as Northern blotting [16], ribonuclease protection assay (RPA) [17], serial analysis of gene expression (SAGE) [18], and quantitative real-time PCR (qRT-PCR) [19] are essential to confirm genomic and transcriptomic data. Among these methods, qRT-PCR is the most frequently used for gene expression analysis because of its high sensitivity, specificity, accuracy, reproductivity, and relatively low cost [20]. qRT-PCR also requires a minimal amount of RNA compared to hybridization-based methods. The assessment of different samples in the same parameter is evaluated by qRT-PCR [21]. The analysis is used to detect changes in the expression of genes of interest relative to a reference gene. Because of the variances incurred during RNA extraction, DNase treatment, and cDNA synthesis, the reliability of gene expression results can be affected by sample size, RNA degradation, reverse transcription efficiency, and cDNA quality [22]. To provide accurate and reproducible results of gene expression profiles, researchers use reference genes as internal controls. Expression levels vary depending on different environmental conditions, making it critical to identify appropriate and reliable reference genes for each experimental set-up in the respective plant tissue and genotype to prevent biased or misinterpreted data [23-25]. Mangeot-Peter et al. (2014) [26] identified suitable reference genes in hemp stem tissue for accurate expression profiling of cell wall synthesizing genes. Subsequently, Guo et al. (2018) [27] studied seven reference genes in various hemp tissues, such as root, stem, leaf, and flower. To our knowledge, there has been no reports on the suitability of reference genes for normalization of gene expression in hemp under different experimental conditions. The F-box gene is used for hemp gene expression analysis. However, its stability under stress conditions has not been analyzed leading to inaccurate normalization of qRT-PCR analysis [26]. This study aims to evaluate stable reference genes under different abiotic stresses/hormone stimuli in hemp.

Materials and methods

Plant material, greenhouse conditions, generation of clones, growth, and care

Industrial hemp and medical marijuana plants share Cannabis sativa as their common scientific name. Therefore, in this paper, the authors referred to industrial hemp as “hemp”, to distinguish it from medical marijuana. The hemp strain, Thunderbird, was grown following the approved guidelines for industrial hemp provided by the Pennsylvania Department of Agriculture—Bureau of Plant Industry under the regulated permits IH-16-P-2017 and IH-17-P-2017. Greenhouse conditions were maintained at 25°C with a 14-hour light photoperiod at 25–40μEm-2s-1. Hemp clones were achieved by collecting a 3-inch segment containing two axillary buds and coating the 45-degree cut with Clonex Rooting gel (Hydrodynamics International, Inc. Lansing, MI). The explant was placed in Root Riot plugs (Hydrodynamics International, Inc. Lansing, MI) and maintained under propagation domes for two weeks at which point they were transferred to four-inch pots containing high porosity soil, HP Mycorrhizae from Pro-Mix (Rivière-du-Loop, Québec, Canada). Genetically identical clones of similar size were obtained by vegetative cuttings from the same female mother plant. Clones were kept under 24-hour light under propagation domes and 12-hour light during the pre-flowering and flowering periods. The temperature was maintained at 25°C. The humidity for rooting clones was maintained at 65% and decreased gradually to 45% once the clones started to flower. Lost Coast Plant Therapy (Plant Protector, Inc. Loleta, CA) was applied to the clones biweekly at a dilution of 30mL per 4 liters to control pests.

Plant stress treatments

All treatments except UV light treatment were performed in the greenhouse on the same day. Four-week-old, cloned plants grown in small pots were soaked in water including 100mM of mannitol (drought stress), 100mM of NaCl (salt stress), 200μM of CuSO4, 100μM CdCl2, or 100μM of Pb(NO3)2 and 200μM of ZnSO4 (heavy metal stresses), and100μM abscisic acid (ABA), 100μM of methyl jasmonate (MeJA), 1mM of gibberellic acid (GA3), or 100μM of salicylic acid (SA) (hormone treatments) for eight hours. For UV treatment, hemp cloned plants were exposed to UV-C radiation for 10 minutes. After each stress treatment, the 3rd and 4th leaves from the top of the plant were sampled and immediately frozen in liquid nitrogen and stored in the -80°C freezer until total RNA was extracted. All the treatments were performed in three biological replicates. For the mock plants, distilled water was used to soak the hemp plants.

Total RNA extraction and cDNA synthesis

Total RNA was extracted from 100mg of each plant sample using the Spectrum™ Plant Total RNA kit (Sigma Aldrich, St. Louis, MO, USA). RNA concentration and absorbance ratios (A260/280 and A260/230) were measured using a NanoVue Plus spectrophotometer (General Electric Healthcare Limited, UK) to measure the quantity and quality of the total RNA. After treatment with DNase I (TaKaRa Bio, Dalian, China) to remove genomic DNA contamination, 2μg of total RNA was used to synthesize cDNA using the high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s protocol.

Candidate reference genes selection, primer design, and PCR reaction

We identified 13 candidate reference genes (Table 1) and two target genes using a BLAST search from NCBI (https://www.ncbi.nlm.nih.gov/) and the Cannabis sativa genome browser gateway (http://genome.ccbr.utoronto.ca/cgi-bin/hgGateway). The Cannabis sativa genome browser gateway is based on the Purple Kush strain of medical marijuana. Primers were designed based on the sequences of 13 genes using Primer3 Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) with the criteria: amplicon size 80–200bp, primer size 18–24bp, Tm 60°C, GC content 45–60%. All primer sequences are listed in Table 1.
Table 1

Gene description, primer sequences, and PCR efficiency for the selection of hemp reference genes.

Gene nameGene symbolAccession numberArabidopsis homolog (Homology)Primer Sequence(5’ → 3’)Amplicon Length (bp)PCR Efficiency(%)RegressionCoefficient (R2)
18S ribosomal RNA18SXM_030651156.1AT5G57280 (72.7%) GAGAATGGGCATGAGTGGAT 140 bp91.220.9956
GCCCCATCAATAAGACCAGA
40S ribosomal protein40SXM_030628282.1AT3G52580 (82.7%) TGCCACTGGTGGTAACAAAA 123 bp98.440.9901
CTGTCAGTTGGGATGGGAGT
Chalcone synthaseCHALXM_030653640.1AT5G13930 (72.0%) GCCAGCCCAAATCAAAGATA 156 bp95.150.9933
CAGTTCCACCAGCAAAACAA
E3 ubiquitin-protein ligaseUBE3XM_030633681.1AT1G79380 (73.2%) GCTCCTTACCGTCAGACTCG 150 bp105.440.9981
GTTTGCGGCAGATAGGACAT
Elongation factor 1- αEF-1αJP480592AT1G09640 (74.0%) GCCCTGTCTTTGAGAGCAAC 111bp95.510.9991
CAATCCACTGCTCAATGTGG
F-box familyF-boxXM_030628913.1AT5G06550 (73.8%) GGGTCCAAGAAATGGGTTTT 81bp111.850.9988
TGCTACCTCAGCACCATCAG
Glyceraldehyde-3- phosphate dehydrogenaseGADXM_030636658AT1G42970 (78.4%) TCCACTGACTTTGTGGGTGA 115bp97.270.9983
TGTAACCCCACTCGTTGTCA
Phytochelatin synthasePCS1JP458288AT5G44070 (70.7%) TGAAGGTTTGGTGTGGTGAA 99 bp94.100.9893
TACACCGGTGAACCACTTGA
Protein phosphatase 2A subunitPP2AXM_030625838AT1G10430 (72.5%) GCTTTGATACCCCTCCACAA 105 bp100.980.9893
AGTATCCGCGAGCTTGACAT
Sand familySANDJP472489AT2G28390 (80.4%) GTTGCTGATTCCGGTGTTTT 95bp113.870.9921
TCATCTGGATGCAGTGAAGC
TATA-box-binding proteinTATAXM_030646209.1AT1G55520 (80.3%) TTTCCAGGCTTGATTTACCG 94 bp107.170.9994
CCCTCACCTTTGCTCCTGTA
TIP41-like family proteinTIP41JP466741AT4G34270 (74.5%) GCGACTGTGGAAATGGAAGT 162 bp106.880.9985
TTCTCCCCACTGTTCAAAGG
Tubulin α -1TUBJP479709AT1G64740 (79.9%) CTCGGCTGAGAAAGCATACC 102 bp105.770.9983
CCATGCCTAGGGTCACACTT
Acyl-activating enzyme 1AAE1JN717233 CGTTGCTTTTCCTCTTCTGG 106 bp103.990.9997
TTTCTGTGCCACCACACATT
Cannabidiolic acid synthaseCBDASAB292682 GATCCGCTGGGCAGAACGGT 188 bp111.010.9994
CAGCAATTCCATTCCCTCAT

qRT-PCR amplification

PCR was performed using cDNA as the template to confirm the specificity of the primers to the target genes. Using a 2% (w/v) agarose gel, all PCR products were analyzed using electrophoresis to confirm a single band of the expected size for each of the primer pairs. To test the PCR amplification efficiency, the regression coefficient (R2) for each gene was calculated using a standard curve generated from a fivefold dilution series of cDNA (1, 1/10, 1/100, 1/1000, and 1/10000) for each primer pair. Based on the slopes of the standard curves, the PCR efficiency of each gene was determined from the respective logarithm of the cDNA dilution and plotted against the mean threshold cycle (Ct) values. The PCR efficiency was calculated using the equation: where E is the efficiency, and the slope is the gradient of the best-fit line in the linear regression. qRT-PCR was performed with 5μL of SYBR Select Master Mix (Applied Biosystems, Waltham, MA, USA) in a 10μL total reaction mixture containing 400nM of the gene-specific primers and 1μL of cDNA. PCR reaction was performed using a Bio-Rad CFX96 system (Bio-Rad, Hercules, CA, USA) under the following reaction conditions: Initial denaturation at 95°C for 10 minutes, 35 cycles of 95°C for 10 seconds, and 60°C for 1 minute. Three technical replicates were used for each biological replicate and average Ct was used for data analysis. As a negative control, water and total RNA were used instead of cDNA to confirm that there was no amplification from contaminated DNA or hemp genomic DNA.

The stability of reference genes and statistical analysis

Boxplots of quantitative cycle (Cq) values for the 13 candidate reference genes were depicted in all leaf samples with every treatment using the boxplot R package to show the variation of each gene expression. The expression of 13 reference genes was analyzed under 11 different stresses using four algorithms, geNorm, NormFinder, BestKeeper, and RefFinder to rank the stability of the candidate reference genes. The pairwise variation (Vn/Vn+1) between two sequential normalization factors was calculated with geNorm to determine the optimal number of candidate reference genes for accurate normalization [28].

Validation of identified reference genes

Two cannabinoid pathway genes, CBDAS and AAE1, were used as target genes to validate the reliability of the selected reference genes using the most stable candidate reference genes and the least stable reference genes. Primer design and calculation of PCR amplification efficiency for these genes was performed as described above. Relative gene expression levels of CBDAS and AAE1 were calculated using the 2−ΔΔCt method (28). Statistical analysis was performed using a paired t-test (a = 0.05) (28).

Results

PCR specificity and amplification efficiency of the candidate reference genes

Thirteen reference genes (18S, 40S, CHAL, UBE2, EF-1α, F-box, GAD, PCS1, PP2A, SAND, TATA, TIP41, and TUB) were identified from NCBI and the Cannabis sativa genome browser gateway based on a homology search with Arabidopsis genes (Table 1). Primers were designed and used to confirm their specificities based on their amplification efficiency and specificity (Table 1). Single bands were amplified in agarose gel electrophoresis for all the gene primers with predicted sizes (Fig 1). For the qRT-PCR amplification, the PCR efficiency (%) ranged from 91.22 to 113.87, and the regression coefficient (R2) varied from 0.9893 to 0.9994 (Table 1).
Fig 1

Amplification results for 13 candidate genes using cDNA synthesized from hemp leaf sample to confirm primer specificity and amplicon size.

Ct values of candidate reference genes

Transcript abundances of 13 candidate reference genes were assessed by qRT-PCR for each gene, tested in triplicates across all 11 treatments and a control, which was 36 biological samples (Fig 2). A majority of the candidate reference genes Ct values ranged from 20 to 30. The lowest expression level with the highest Ct values between 27.4 and 32.1 was PCS1. The EF-1α gene showed the highest expression level, with the lowest Ct values ranging from 18.9 to 25.3. The CHAL gene displayed the highest difference among all 36 samples tested, with a minimum Ct value of 22.3 and a maximum Ct value of 30.9. These Ct value analyses showed that the transcription levels of candidate reference genes are unstable under different stress conditions.
Fig 2

Expression level variability of each candidate reference gene to examine all leaf samples (n = 36).

Boxes show the 25th and 75th percentiles, whisker caps represent the minimum and maximum values, lines across the box represent the median Ct-values.

Expression level variability of each candidate reference gene to examine all leaf samples (n = 36).

Boxes show the 25th and 75th percentiles, whisker caps represent the minimum and maximum values, lines across the box represent the median Ct-values.

Analysis of reference genes by geNorm

The geNorm was used for evaluating the expression stability of the 13 candidate reference genes (Table 2). Data analysis was calculated based on individual 11 different treatments and three different groups of treatments such as osmotic stress (OS: mannitol, NaCl), heavy metal stress (HM: CdCl2, CuSO4, PbNO3, ZnSO4), and hormonal stimuli (PH: ABA, GA3, MeJA, SA). The total ranking was also shown by combining all 11 treatments together. This algorithm evaluated the stability of reference genes (M) based on the average pairwise variation of all tested genes [29]. In this analysis, the lower the M value, the more stable the gene expression. A reference gene that has an M value less than 1.5 is used for qRT-PCR. PP2A and TIP41 were the most stable reference genes with the lowest M value (0.46) whereas CHAL had an M value of 1.07 and was ranked as the least stable gene. Individually, EF-1a and SAND were the most stably expressed genes under osmotic stresses with an M value of 0.22 while F-box and TATA were the least stably expressed genes. The TUB and TATA genes showed the lowest M values of 0.16 among all of the heavy metal stressed clones. Exposure to hormonal stimuli resulted in PP2A and F-box to be the most stable with an M value of 0.27 and CHAL to be the least stable with an M value of 0.75.
Table 2

Stability ranking of the 13 candidate reference genes in hemp leaf analyzed by the geNorm program under different stresses.

RankTotalOSHMPHMannitolNaClCdCl2CuSO4PbNO3ZnSO4ABAGA3MeJASAUV
1PP2AEF-1aTUBPP2AEF-1aEF-1aTIP41EF-1aUBE218S18STATA18SGADF-box
0.460.220.160.270.210.120.060.060.060.000.060.000.000.100.06
2TIP41SANDTATAF-boxSANDTIP41TUBPP2ATIP4140SPCS1TIP41SANDPCS1GAD
0.560.320.200.280.210.140.100.070.060.020.060.100.040.140.08
3TUBTUBUBE2TATATUBSAND18SSANDTATAF-boxTATAPP2AF-boxF-boxTIP41
0.580.320.240.290.310.180.110.090.240.040.060.140.080.160.12
4EF-1aPP2ATIP41TIP41GADTUBTATAF-boxTUBSANDEF-1aF-boxTATAUBE2PP2A
0.620.640.250.350.460.230.120.110.250.080.070.170.280.190.16
5SANDTIP41PP2ASANDPCS118SF-boxTIP41GADTATAPP2A18STIP41EF-1aEF-1a
0.670.770.320.380.740.270.190.120.340.100.140.200.350.210.17
618S18SPCS1TUB40SPP2AEF-1aUBE2PP2APP2A40STUBPCS1PP2AUBE2
0.720.910.360.420.920.320.210.150.430.120.160.250.390.230.20
7UBE240SSANDEF-1aTIP41UBE2GADTATAPCS1TUBTIP41SANDPP2ATATATATA
0.750.970.410.461.000.400.220.170.530.160.170.280.420.270.22
8PCS1UBE2EF-1aUBE2PP2A40SUBE2PCS1SANDEF-1aSANDPCS140SSANDSAND
0.791.000.470.491.070.430.240.200.610.180.190.310.460.320.24
9GADPCS140SPCS118SCHALSAND18S40SPCS1F-boxEF-1aTUBTUB40S
0.821.050.530.511.160.470.270.230.760.220.210.340.490.360.26
1040SGAD18S18SUBE2PCS140STUBEF-1aUBE2UBE2UBE2EF-1aTIP4118S
0.851.100.580.531.230.550.310.270.860.250.230.380.560.400.30
11F-boxCHALGAD40SCHALTATAPCS1CHAL18STIP41CHAL40SUBE218STUB
0.901.200.630.581.430.600.360.320.940.270.250.430.610.510.35
12TATAF-boxF-boxGADTATAF-boxPP2AGADF-boxGADTUBCHALGAD40SPCS1
0.931.320.690.621.620.650.400.401.060.300.280.460.770.590.42
13CHALTATACHALCHALF-boxGADCHAL40SCHALCHALGADGADCHALCHALCHAL
1.071.410.870.751.730.690.530.491.390.580.300.480.930.770.59
F-box was ranked as the second least stably expressed gene under both osmotic and heavy metal stresses, but it was ranked as the first and second most stable gene under UV and plant hormone treatments, respectively. The TATA gene was least stably expressed under osmotic stresses but was among the top two and three under heavy metal stress and plant hormone stimulus, respectively. CHAL was the least stably expressed in response to UV light application. geNorm can determine the minimal number of reference genes that should be used to obtain an accurate normalization. The optimal number of reference genes was determined based on the pairwise variation (Vn) between two normalization factors (NFn) composed of an increasing number of reference genes [29]. The threshold value (Vn/Vn+1 = 0.15) indicates if the number of reference genes less than or equal to the value of n is sufficient to use as a reference gene. As shown in Fig 3, the pairwise variation value V2/V3 of all experimental samples was less than 0.15, demonstrating that two reference genes should be sufficient for normalization under all conditions tested.
Fig 3

Determination of best reference gene number calculated by geNorm pairwise variation (Vn/Vn+1) under different stress treatments in hemp leaf.

Analysis of reference genes by NormFinder

NormFinder is a quantity-model-based software and uses complex statistical models to compute the variation between the expression of genes across different biological groups [30]. The lowest expression stability value represents the most stable reference genes. Results from the NormFinder analysis are summarized in Table 3.
Table 3

Stability ranking of the 13 candidate reference genes in hemp leaf analyzed by the NormFinder program under different stresses.

RankTotalOSHMPHMannitolNaClCdCl2CuSO4PbNO3ZnSO4ABAGA3MeJASAUV
1EF-1aTUBPCS1TATAEF-1a40STATASANDSANDEF-1aTATATUBPCS1F-boxGAD
0.3550.0380.2370.1610.1040.1430.0290.0290.1540.0760.0290.1610.0760.050.029
2TUBSANDEF-1aTIP41TUB18S18SPP2APCS1UBE2PCS1SANDTIP41EF-1aF-box
0.3920.4840.2840.2660.1320.1560.0290.0290.180.0870.0720.1760.0760.0870.029
3PCS1EF-1aPP2AF-boxSANDUBE2TUBEF-1aPP2ATIP4118STATATATAGADPP2A
0.5630.5270.3340.2740.240.1560.0290.0290.3450.0870.1020.1830.0760.090.029
4PP2AGADSANDPP2AGADPP2ATIP41PCS140STATAEF-1aTIP4140SUBE2TIP41
0.6160.7010.3340.3570.7550.2360.0740.1190.3960.1220.1440.1830.290.1160.058
5TIP4140SUBE2PCS1PCS1TUB40STIP41EF-1aPCS140SEF-1aTUBPCS1EF-1a
0.630.7890.4270.3830.7580.4030.2390.1340.6310.1330.1490.2330.4040.1810.115
6SANDPCS1TIP41EF-1aTIP41TIP41UBE2F-box18STUBPP2APCS1F-boxTATATATA
0.6730.8890.4360.3851.1150.5110.2460.1340.7680.1690.1490.2530.4720.2460.165
718S18STATATUB40SSANDEF-1a18SUBE2SANDTIP41PP2ASANDTUBUBE2
0.6891.080.4370.3871.1380.5960.2920.1490.940.2150.1780.4030.6090.330.183
840SPP2ATUBSANDPP2APCS1F-boxUBE2TATA18SF-boxF-box18SPP2ASAND
0.7361.1220.5110.4181.1740.5960.2920.2770.9470.3230.2230.4180.6090.3580.239
9UBE2UBE240SUBE218SEF-1aGADTATATIP4140SSANDUBE2EF-1aSAND40S
0.7521.1790.5350.4491.7160.6410.350.3030.970.3230.2280.4750.620.40.255
10GADTIP4118S18SUBE2TATAPCS1TUBTUBPP2ATUBCHALPP2ATIP4118S
0.7561.2410.6180.5411.8730.6940.510.4771.0750.3310.3310.4830.650.5470.443
11F-boxCHALF-box40SCHALF-boxPP2ACHALF-boxGADCHAL40SUBE218STUB
0.8161.3370.8110.7122.0020.6940.5410.6621.3660.3490.3340.4950.6970.9830.602
12TATAF-boxGADGADTATACHALSANDGADGADF-boxUBE2GADGAD40SPCS1
0.9071.6060.8890.7952.1520.7050.5440.7111.4670.3940.3680.5081.6541.0280.802
13CHALTATACHALCHALF-boxGADCHAL40SCHALCHALGAD18SCHALCHALCHAL
1.7111.7171.791.3462.2030.8471.2340.9823.1412.1120.3850.5151.7231.7331.529
The EF-1α and TUB genes were the most stably expressed in all samples and were ranked as fourth and third by geNorm, respectively. The F-box, TATA, and CHAL were ranked as the three least stable genes both by NormFinder and geNorm. The TUB, PCS1, and TATA genes were the most stably expressed under osmotic stress, heavy metal stress, and plant hormone stimuli, respectively. Compared to geNorm, TUB, PCS1, and TATA were ranked as third, sixth, and third positions in each category, respectively. The least stably ex-pressed reference genes under osmotic stress (CHAL, F-box, TATA), heavy metal stress (CHAL, F-box, TATA), and plant hormone stimuli (40S, GAD, CHAL) had similar rankings when compared to geNorm rankings. The GAD and F-box genes were found to be the most stable reference genes under UV stress while PCS1 and CHAL were the least stable. A similar trend was observed in the geNorm analysis.

Analysis of reference genes by BestKeeper

The BestKeeper program is an excel-based algorithm and uses standard deviation (SD) and coefficient of variation (CV) data of the average Ct values for specific treatments [31] (Table 4). Lower CV ± SD values represent higher stability. When using the BestKeeper algorithm, genes with an SD value > 1 are undesirable reference genes [25]. When all samples were taken into consideration, TATA (SD = 0.74), 40S (SD = 0.79), PCS1 (SD = 0.84), EF-1a (SD = 0.90), and TUB (SD = 0.99) were determined to be reliable reference genes. TATA showed the lowest SD among all 13 reference genes in all samples and the SD values were greater than 1 in osmotic stress (1.29) and mannitol (1.82). The 40S gene was ranked as the second most stable candidate in all samples tested, but the SD value of 40S under NaCl and PbNO stresses were 1.09 and 1.36, respectively. PCS1 was ranked at the third position in all samples tested and SD values were below 1 in any individual treatment and the three treatment groups. The CHAL gene displayed the highest SD value with 1.95 in all samples displaying that this gene is not ideal for gene expression normalization. The CHAL gene exhibited an SD value less than 1 only under GA3 (0.71), ABA (0.27), CdCl2 (0.58), and CuSO4 (0.98) treatments.
Table 4

Stability ranking of the 13 candidate reference genes in hemp leaf analyzed by the BestKeeper program under different stresses.

Data after gene symbols mean Std ± CV%.

RankTotalOSHMPHMannitolNaClCdCl2CuSO4PbNO3ZnSO4ABAGA3MeJASAUV
1TATAPCS1TATA18STUBGAD40S40SGADF-boxSAND18S18S18STUB
0.74±2.850.68±2.280.48±1.860.23±1.000.24±1.050.62±2.600.24±1.010.40±1.630.18±0.790.29±1.130.04±0.180.22±0.960.38±1.630.20±0.860.04±0.17
240SGADUBE2PP2AEF-1aTATATATAGADTIP4118SEF-1aF-boxSAND40SPCS1
0.79±3.220.76±3.190.50±2.110.40±1.690.44±2.050.76±2.870.31±1.200.40±1.640.24±0.990.31±1.310.07±0.320.24±0.980.38±1.540.20±0.840.16±0.50
3PCS140STIP41F-boxPCS1PCS118SPCS1UBE240SPCS1PP2AF-boxTATAUBE2
0.84±2.880.83±3.310.53±2.100.43±1.700.47±1.540.80±2.700.36±1.520.49±1.660.27±1.140.31±1.270.09±0.310.29±1.210.47±1.870.64±2.490.27±0.97
4PP2ATUB40STATATIP41F-boxPCS1SANDTUBSAND18STATAPP2APP2ATATA
0.90±3.670.87±3.680.56±2.280.47±1.820.56±2.300.82±3.150.38±1.300.51±2.010.33±1.470.38±1.500.11±0.480.40±1.570.47±1.960.67±2.770.29±1.06
5TUBPP2ATUB40S40S40STIP41F-boxTATATATAUBE2TIP41TATAGADPP2A
0.99±4.281.05±4.330.57±2.460.52±2.190.58±2.291.09±4.340.38±1.500.53±2.070.38±1.470.40±1.530.13±0.560.40±1.640.76±2.970.69±2.970.40±1.47
618SEF-1aPP2ASANDSANDUBE2TUB18SPP2AEF-1aTATATUBTIP41PCS1EF-1a
1.01±4.231.07±4.800.58±2.400.59±2.410.60±2.391.11±4.550.40±1.750.56±2.330.62±2.570.42±1.930.13±0.520.56±2.540.84±3.480.69±2.450.42±1.73
7GADUBE2PCS1TIP41PP2APP2AUBE2PP2APCS1PP2AF-boxSANDPCS1F-boxF-box
1.03±4.371.10±4.540.65±2.240.65±2.650.71±3.051.29±5.120.44±1.890.56±2.260.82±2.870.42±1.750.20±0.800.60±2.490.87±3.020.82±3.250.44±1.59
8F-box18SSANDEF-1a18S18SPP2AEF-1aSANDUBE240SPCS140SUBE2GAD
1.04±4.041.12±4.660.67±2.680.69±3.270.87±3.641.38±5.660.49±1.990.58±2.580.87±3.540.44±1.890.22±0.930.69±2.420.96±4.130.89±3.740.44±1.69
9TIP41SAND18SPCS1GADTUBEF-1aTIP4140STIP41PP2ACHALTUBEF-1aTIP41
1.04±4.111.12±4.390.69±2.910.71±2.490.89±3.791.49±6.240.51±2.330.62±2.441.36±5.540.53±2.120.22±1.000.71±3.001.02±4.540.89±4.100.49±1.72
10EF-1aTIP41GADTUBUBE2CHALF-boxUBE2EF-1aTUBTIP41GADCHALSAND40S
1.06±4.841.14±4.550.77±3.300.80±3.601.09±4.521.60±5.690.51±2.010.71±2.951.47±6.700.53±2.310.24±1.000.71±3.001.09±4.261.09±4.400.51±1.98
11UBE2TATAEF-1aUBE2CHALTIP41GADTATA18SPCS1CHALEF-1aEF-1aTUBSAND
1.07±4.451.29±4.780.80±3.650.83±3.461.58±5.661.60±6.110.56±2.350.73±2.781.58±6.480.60±2.070.27±1.060.73±3.441.31±6.281.09±4.830.56±1.88
12SANDF-boxF-boxGADTATASANDCHALTUBF-boxGADTUB40SUBE2TIP4118S
1.24±4.891.34±5.090.83±3.210.89±3.891.82±6.611.64±6.320.58±2.120.87±3.701.98±7.510.71±3.090.36±1.610.84±3.471.36±5.661.24±5.010.62±2.29
13CHALCHALCHALCHALF-boxEF-1aSANDCHALCHALCHALGADUBE2GADCHALCHAL
1.95±7.361.55±5.541.65±6.161.21±4.891.87±6.971.69±7.420.71±2.830.98±3.553.11±12.001.73±6.540.40±1.730.87±3.612.02±9.011.93±7.921.40±4.81

Stability ranking of the 13 candidate reference genes in hemp leaf analyzed by the BestKeeper program under different stresses.

Data after gene symbols mean Std ± CV%.

Analysis of reference genes by RefFinder

RefFinder is a web-based tool for comprehensive analysis that integrates geNorm, NormFinder, Delta Ct, and BestKeeper approaches [32]. The reference genes were ranked from the most stable (M value is the lowest) to the least stable expression (M value is the highest) using RefFinder (Table 5). Among them, the most stable candidate was the EF-1α gene, followed by the TUB gene in all samples. The EF-1α and TUB genes were also ranked in third and first places under osmotic stress conditions, respectively. The TATA gene was most stably expressed under heavy metal and plant hormone treatments while this gene was the least stable under osmotic stress. The CHAL gene was ranked as the least stable gene in all samples tested. The GAD and CHAL genes were the most and least stably expressed genes respectively under UV application, which was the same findings as to the NormFinder software.
Table 5

Stability ranking of the 13 candidate reference genes in hemp leaf analyzed by the RefFinder program under different stresses.

RankTotalOSHMPHMannitolNaClCdCl2CuSO4PbNO3ZnSO4ABAGA3MeJASAUV
1EF-1aTUBTATATATAEF-1a18S18SEF-1aUBE218SPCS1TATATIP41F-boxGAD
2.511.862.141.861.412.992.062.213.202.991.862.212.782.142.51
2TUBSANDPCS1F-boxTUB40STATAPP2APP2ATATATATATUB18SGADF-box
2.782.452.552.061.572.992.382.303.223.162.062.452.832.592.55
3PP2AEF-1aUBE2PP2ASANDUBE2TUBSANDTIP41EF-1a18STIP41SANDPCS1PP2A
2.832.713.502.382.714.412.452.453.353.462.452.783.153.502.78
4TIP41PCS1PP2ATIP41PCS1TIP41TIP41PCS1SAND40SEF-1aSANDTATAEF-1aTIP41
3.764.243.663.604.164.462.784.903.723.573.364.453.313.563.83
5PCS1GADTIP4118SGADPP2A40SF-boxPCS1SANDSANDPP2APCS1UBE2EF-1a
3.834.474.125.625.185.094.614.953.743.874.904.583.354.904.95
640S40STUBEF-1aTIP41TUBUBE2TIP41GADF-box40SF-boxF-boxTATAUBE2
6.164.534.236.405.865.486.405.485.074.245.894.764.245.245.24
718SPP2AEF-1aSAND40SEF-1aEF-1aGADTATATUBPP2A18S40S18STATA
6.246.165.926.405.965.536.906.455.186.406.345.055.666.045.86
8TATA18SSANDTUBPP2ASANDF-box18S40SUBE2TIP41PCS1TUBPP2ATUB
6.456.966.057.097.746.487.277.426.006.487.656.626.716.056.04
9SANDUBE240SPCS118SPCS1PCS1UBE2TUBPP2AF-boxEF-1aPP2A40SPCS1
7.097.977.357.548.746.828.347.616.167.368.217.387.097.677.67
10UBE2TIP4118S40SUBE2GADGAD40SEF-1aTIP41UBE2UBE2EF-1aSANDSAND
8.638.419.749.0310.006.858.638.147.957.389.2110.139.978.718.66
11GADCHALGADUBE2CHALTATAPP2ATATA18SPCS1CHALCHALUBE2TUB40S
8.9111.4711.229.1911.006.8510.618.899.237.9310.7410.4411.248.899.24
12F-boxF-boxF-boxGADTATAF-boxSANDTUBF-boxGADTUB40SCHALTIP4118S
10.4612.0011.4912.0012.008.9210.8910.4711.7411.7411.2211.4912.1710.4710.47
13CHALTATACHALCHALF-boxCHALCHALCHALCHALCHALGADGADGADCHALCHAL
13.0012.4713.0013.0013.0010.4412.7411.4713.0013.0013.0011.9312.2413.0013.00

Validation of selected reference genes

To validate the selected reference genes, gene expression levels of AAE1 and CBDAS were measured (Fig 4). Each of the two most stable reference genes, EF-1α and TUB, a combination of these two stable reference genes (EF-1α+TUB), and the least stable reference gene (CHAL) were used as internal controls. AAE1 expression was significantly reduced under drought (Mannitol) and salinity (NaCl) stresses. EF-1α, TUB, and a combination of EF-1α and TUB were used for normalization of qRT-PCR analysis. There was no significant difference in the AAE1 expression between the mock treatment and osmotically stressed samples (Mannitol and NaCl) when CHAL was used as an internal control. The expression of CBDAS was also reduced under osmotic stresses when expression data was normalized with EF-1α, TUB, and a combination of EF-1α and TUB unless the CBDAS expression under NaCl stress was normalized with the TUB gene. When CHAL was used as a reference gene, CBDAS gene expression was reduced under mannitol treatment but there was no difference between mock and NaCl treatments.
Fig 4

Relative expression of target genes in hemp leaf under osmotic stresses using most and least stably expressed reference genes for normalization.

Error bars for qRT-PCR show the standard error of three replicates for EF-1α, TUB, and CHAL, and six replicates for a combination of EF-1α and TUB. The asterisk represents that there is a significant difference in the comparison with the mock treatment by the statistical analysis (P < 0.05) in paired T-tests.

Relative expression of target genes in hemp leaf under osmotic stresses using most and least stably expressed reference genes for normalization.

Error bars for qRT-PCR show the standard error of three replicates for EF-1α, TUB, and CHAL, and six replicates for a combination of EF-1α and TUB. The asterisk represents that there is a significant difference in the comparison with the mock treatment by the statistical analysis (P < 0.05) in paired T-tests.

Discussion

Industrial hemp is from the plant species Cannabis sativa and has gained importance as a medicinal crop because of its potential to produce secondary metabolites such as cannabinoids, terpenes, and phenolic compounds [33]. According to Schluttenhofer and Yuan (2017) [4], hemp was cultivated for commercial or research purposes in at least 47 countries in 2017 and the global hemp market doubled from the year 2016 to 2020. Recently, a comprehensive gene expression analysis is aimed at elucidating the metabolic pathways for cannabinoids and terpene synthesis to improve hemp traits [34-36]. To validate this data, qRT-PCR analysis is suitable, however, appropriate hemp reference genes for accurate gene expression analysis have not been well established. In this report, we evaluated 13 hemp reference genes under 11 different stress conditions. Research in other plant species has revealed that different environmental conditions would require unique reference genes to accurately interpret expression levels [37, 38]. Eleven different conditions including osmotic stresses, heavy metal stresses, plant hormone stimulus, and UV light application were reported to affect the cannabinoid synthesis [28, 39–41]. The results obtained from geNorm, NormFinder, BestKeeper, and RefFinder were not consistent, particularly BestKeeper which was much more distinct from the other software methods (Tables 2–5). This finding was expected because the BestKeeper algorithm evaluates data differently when compared to the three other programs [42]. To rank the most suitable reference genes across all treatments, there was no unanimity when compared to four different algorithms (Table 6), which represented the combined results obtained from four programs. In most cases, one candidate gene was ranked as the most stable gene by two or three programs, which showed that it might be a good reference gene under various treatments. Based on the combined rankings of the four programs used in our study, the overall results showed that the most stable genes varied while the least stable genes were almost the same. Across all plants tested, both NormFinder and RefFinder determined EF-1α as the most stable gene in all samples tested. In previous reports, EF-1α was demonstrated to be the most stable gene under different stresses in a variety of crops such as tobacco [43], maize [44], soybean [45], potato [46, 47]. Interestingly, this gene was not the most stable in any of the three groups (OS, HM, PH). The TUB gene appeared to be best the candidate under osmotic stresses because this gene was ranked as the most stable by both NormFinder and RefFinder which is consistent with the results obtained in Parsley under abiotic stresses [37]. Under heavy metal stress, TATA was ranked as the most stable gene by BestKeeper and RefFinder and the second most stable gene by geNorm. This gene was also ranked as the best reference gene in hormone stimuli by NormFinder and RefFinder. Interestingly, TATA was the least stable gene under osmotic stresses by geNorm, NormFinder, and RefFinder. TUB was the most stably expressed gene under osmotic stresses, whereas TATA was ranked as the best stable gene under both heavy metal stress and hormone stimuli. Unlike most stable genes, CHAL was found to be the least stable gene in most of the rankings with all samples and the three treatment groups (OS, HM, PH) when analyzed by all four programs. According to Wang et al. 2015 [48], candidate genes showing a high level of variation of Ct values should be avoided as internal controls. Our results showed that variation of the Ct value in CHAL was highest among all 13 reference genes (Fig 2), which is consistent with the fact that CHAL was ranked as the least stable by all four programs used in this study.
Table 6

Global ranking of the 13 candidate genes in hemp leaf analyzed by all programs: geNorm, NormFinder, BestKeeper, and RefFinder under different stresses.

RankTotalOSHMPHMannitolNaClCdCl2CuSO4PbNO3ZnSO4ABAGA3MeJASAUV
1EF-1aTUBTATATATAEF-1a18STATASANDUBE218SPCS1TATA18SGADF-box
2TUBEF-1aUBE2F-boxTUB40S18SEF-1aTIP41TATA18STIP41SANDF-boxGAD
3PP2ASANDPCS1PP2ASANDUBE2TUBPP2APP2A40STATATUBTIP41PCS1PP2A
4PCS1PCS1PP2ATIP41PCS1PP2ATIP41PCS1PCS1EF-1aEF-1aPP2ATATAEF-1aTIP41
5TIP4140STIP41SANDGADTIP4140SF-boxSANDSANDSANDF-boxF-boxUBE2EF-1a
618SGADTUB18STIP41TUBUBE2TIP41TATAF-box40SSANDPCS1TATAUBE2
740SPP2ASANDEF-1a40SPCS1EF-1a18SGADUBE2PP2A18S40SPP2ATATA
8SAND18SEF-1aTUBPP2ASANDF-boxUBE2TUBTUBTIP41PCS1PP2A18STUB
9TATAUBE240SPCS118SEF-1aPCS1GAD40SPP2AF-boxEF-1aTUB40SPCS1
10UBE2TIP4118S40SUBE2TATAGAD40SEF-1aTIP41UBE2UBE2EF-1aSANDSAND
11GADCHALGADUBE2CHALGADPP2ATATA18SPCS1CHALCHALUBE2TUB40S
12F-boxF-boxF-boxGADTATAF-boxSANDTUBF-boxGADTUB40SCHALTIP4118S
13CHALTATACHALCHALF-boxCHALCHALCHALCHALCHALGADGADGADCHALCHAL
In previous Cannabis qRT-PCR studies, the F-box gene has been used as an internal control for qRT-PCR [28, 49, 50]. Mangeot-Peter et al. (2016) [26] performed the reference gene analysis in hemp stems and concluded that the F-box gene was ranked as one of the most stable genes and Histone 3 as the least stable gene among 12 reference genes tested under normal conditions. In this study, however, the F-box gene was the second least stable gene by RefFinder and the third least stable gene determined by both the geNorm and NormFinder programs when all samples were analyzed. Based on our group rankings (OS, HM, PH), F-box was ranked the second least stable genes by geNorm, BestKeeper, and NormFinder under both osmotic and heavy metal stresses. The F-box gene was stably expressed under normal conditions in hemp leaves (S2 Fig) and relatively stable under hormone stimuli as evident by its second position as ranked by both geNorm and RefFinder. These results show that F-box may not be a suitable reference gene for hemp qRT-PCR analysis under osmotic and heavy metal stresses. However, it could be acceptable as a reference gene under normal and plant hormone treatments. Overall, our study suggests that the F-box gene may not be the best reference gene for C. sativa, particularly in plant stress-related studies. Guo et al. (2018) [27] have studied the stability of reference genes in different hemp tissues/organs. They ranked ubiquitin and EF-1α as the most stable genes in leaf samples at different stages, and PP2A as the least stable gene in different organs. Notably, EF-1α was the most stable reference gene in our global ranking, showing that EF-1α is most stable under the normal condition and different abiotic stresses and hormonal stimuli. Many studies have proved that the use of more than one reference gene enables the possibility of avoiding variations and achieving more accurate normalization of qPCR data [29]. To assess the optimal number of reference genes for the normalization of qRT-PCR data, we used the geNorm program to perform a stepwise calculation of the pairwise variation (Vn/Vn+1) between sequential normalization factors. In this analysis, a Vn/Vn+1 < 0.15 indicates that introducing an additional reference gene for normalization is unnecessary. Under all treatments, V2/V3 values were less than 0.15, which indicated that two reference genes were enough for the normalization of the real-time PCR data under any treatments in this study. To validate the reliability of the selected reference genes, we measured the relative expression of two cannabinoids pathway genes using EF-1α and TUB as the most stable reference genes and CHAL as the least stable reference gene (Fig 4). Since CBDA content is decreased by the influence of osmotic stress [41], we measured the expression of AAE1 and CBDAS genes that are involved in the rate-determining enzymatic reactions leading to CBDA synthesis under drought and salinity stresses [51, 52]. The expression of these two genes was significantly reduced under drought and salinity stresses when qRT-PCR data were normalized by EF-1α, TUB, and the combination of EF-1α and TUB. Notably, the expression level of both genes was normalized by CHAL under salinity stress and did not show a significant difference when compared with mock plants. These results suggest that EF-1α and TUB genes individually or in combination are suitable reference genes for hemp under osmotic stresses. Our validation study demonstrated the effectiveness of the ranking of reference genes by the programs used geNorm, NormFinder, and RefFinder. To the best of our knowledge, this study is the first report that performed a systematic analysis of hemp reference genes under different abiotic stresses and hormonal stimuli. The knowledge obtained in this study could contribute to enhancing future hemp research related to the elucidation of mechanisms involved in the synthesis, transport, and accumulation of abundant secondary metabolites in hemp.

Original gel picture for the amplification of 13 candidate genes using cDNA synthesized from hemp leaf sample to confirm primer specificity and amplicon size.

(TIF) Click here for additional data file.

Expression level variability of each candidate reference gene to examine among different tissues (n = 12).

(TIF) Click here for additional data file.

Hemp pictures before stress treatments.

(PDF) Click here for additional data file.

Hemp pictures after stress treatments.

(PDF) Click here for additional data file.

Ct values to make a standard curve generated from different dilution series of cDNA for each primer pair.

(XLSX) Click here for additional data file.

Ct values to study expression level variability of each candidate reference gene under different stresses in all leaf samples.

(XLSX) Click here for additional data file.

Ct values to analyze the reference genes using four algorithms, geNorm, NormFinder, BestKeeper, and RefFinder.

(XLSX) Click here for additional data file.

Ct values to evaluate the validation of identified reference genes.

(XLSX) Click here for additional data file.

Ct values to study expression level variability of each candidate reference gene in different tissues.

(XLSX) Click here for additional data file.
  51 in total

1.  Evaluation of reference genes for RT-qPCR analysis in wild and cultivated Cannabis.

Authors:  Rong Guo; Hongyan Guo; Qingying Zhang; Mengbi Guo; Yanping Xu; Min Zeng; Pin Lv; Xuan Chen; Ming Yang
Journal:  Biosci Biotechnol Biochem       Date:  2018-08-21       Impact factor: 2.043

2.  Selection of suitable soybean EF1α genes as internal controls for real-time PCR analyses of tissues during plant development and under stress conditions.

Authors:  Kátia D C Saraiva; Dirce Fernandes de Melo; Vanessa D Morais; Ilka M Vasconcelos; José H Costa
Journal:  Plant Cell Rep       Date:  2014-05-13       Impact factor: 4.570

3.  Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress.

Authors:  Nathalie Nicot; Jean-François Hausman; Lucien Hoffmann; Danièle Evers
Journal:  J Exp Bot       Date:  2005-09-27       Impact factor: 6.992

4.  Serial analysis of gene expression.

Authors:  V E Velculescu; L Zhang; B Vogelstein; K W Kinzler
Journal:  Science       Date:  1995-10-20       Impact factor: 47.728

5.  Nutraceutical potential of hemp (Cannabis sativa L.) seeds and sprouts.

Authors:  Stefania Frassinetti; Eleonora Moccia; Leonardo Caltavuturo; Morena Gabriele; Vincenzo Longo; Lorenza Bellani; Gianluca Giorgi; Lucia Giorgetti
Journal:  Food Chem       Date:  2018-04-22       Impact factor: 7.514

6.  Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress.

Authors:  Gregor W Schmidt; Sven K Delaney
Journal:  Mol Genet Genomics       Date:  2010-01-23       Impact factor: 3.291

7.  Suitable Reference Genes for Accurate Gene Expression Analysis in Parsley (Petroselinum crispum) for Abiotic Stresses and Hormone Stimuli.

Authors:  Meng-Yao Li; Xiong Song; Feng Wang; Ai-Sheng Xiong
Journal:  Front Plant Sci       Date:  2016-09-30       Impact factor: 5.753

8.  Selection of Appropriate Reference Genes for Gene Expression Analysis under Abiotic Stresses in Salix viminalis.

Authors:  Valentin Ambroise; Sylvain Legay; Gea Guerriero; Jean-Francois Hausman; Ann Cuypers; Kjell Sergeant
Journal:  Int J Mol Sci       Date:  2019-08-28       Impact factor: 5.923

9.  Enhanced tolerance of industrial hemp (Cannabis sativa L.) plants on abandoned mine land soil leads to overexpression of cannabinoids.

Authors:  Rabab Husain; Hannah Weeden; Daniel Bogush; Michihito Deguchi; Mario Soliman; Shobha Potlakayala; Ramesh Katam; Stephen Goldman; Sairam Rudrabhatla
Journal:  PLoS One       Date:  2019-08-29       Impact factor: 3.240

View more
  1 in total

1.  In planta Female Flower Agroinfiltration Alters the Cannabinoid Composition in Industrial Hemp (Cannabis sativa L.).

Authors:  Michihito Deguchi; Seema Dhir; Shobha Potlakayala; Sarwan Dhir; Wayne R Curtis; Sairam Rudrabhatla
Journal:  Front Plant Sci       Date:  2022-07-21       Impact factor: 6.627

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.