Literature DB >> 34898622

Development and comparison of loop-mediated isothermal amplification with quantitative PCR for the specific detection of Saprolegnia spp.

Satyaki Ghosh1, David L Straus2, Christopher Good3, Vipaporn Phuntumart1.   

Abstract

Saprolegniasis is an important disease in freshwater aquaculture, and is associated with oomycete pathogens in the genus Saprolegnia. Early detection of significant levels of Saprolegnia spp. pathogens would allow informed decisions for treatment which could significantly reduce losses. This study is the first to report the development of loop-mediated isothermal amplification (LAMP) for the detection of Saprolegnia spp. and compares it with quantitative PCR (qPCR). The developed protocols targeted the internal transcribed spacer (ITS) region of ribosomal DNA and the cytochrome C oxidase subunit 1 (CoxI) gene and was shown to be specific only to Saprolegnia genus. This LAMP method can detect as low as 10 fg of S. salmonis DNA while the qPCR method has a detection limit of 2 pg of S. salmonis DNA, indicating the superior sensitivity of LAMP compared to qPCR. When applied to detect the pathogen in water samples, both methods could detect the pathogen when only one zoospore of Saprolegnia was present. We propose LAMP as a quick (about 20-60 minutes) and sensitive molecular diagnostic tool for the detection of Saprolegnia spp. suitable for on-site applications.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34898622      PMCID: PMC8668100          DOI: 10.1371/journal.pone.0250808

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Oomycetes represent a diverse group of eukaryotic pathogens that can infect a wide range of hosts [1-3] Pathogens in the Saprolegnia genus can infect and kill crustaceans and fish in freshwater, especially in aquaculture where fish are raised at high densities [4]. The most widely studied members of this genus include S. diclina, S. ferax and S. parasitica [5]. Saprolegniasis has been reported in channel catfish (Ictalurus punctatus), rainbow trout (Oncorhynchus mykiss), redear sunfish (Lepomis microlophus), Indian major carps (including Labeo rohita, Catla catla, L. calbasu) and Atlantic salmon (Salmo salar) [6-8]. The majority saprolegniasis occurrence has been reported in temperate environments and commonly found associated with salmonid farming. Saprolegnia can infect all stages of the fish life cycle including the egg stage [9-11]. In the U.S., economic losses due to saprolegniasis in commercial aquaculture is estimated to be approximately 40 million dollars [12, 13]. Almost 50% of the commercial losses to farmed channel catfish is attributed to saprolegniasis [14]. It is estimated that 10% of all hatched salmon succumb to saprolegniasis, which represents a major financial loss given that this industry accounts for approximately 30% of the global fish production for consumption [4, 14–16]. The incidence of saprolegniasis extends to Asian tropical aquaculture systems where over 80% of fish is produced through aquaculture [17]. Therefore, saprolegniasis is among the most impactful diseases in commercial aquaculture. Conventional culture-based strategies coupled with conventional PCR-based approaches for pathogen identification usually take several days [18]. Currently, quantitative-PCR (qPCR) is one of the methods of choice for molecular detection and quantification of target organisms [19]. Detection of pathogens based on qPCR has been reported in several studies including Trypanosoma cruzi, Fusarium spp., Japanese encephalitis virus and bacteria such as Listeria monocytogenes, Francisella tularensis, and Mycobacterium avium [20-23]. Loop-Mediated Isothermal Amplification (LAMP) has emerged as a novel tool for the sensitive and rapid detection of nucleic acids and is suitable for field applications. Since the first publication of LAMP [24], there has been a progressive increase in the number of publications based on this technique to diagnose and detect a variety of organisms including bacteria, viruses and eukaryotic pathogens indicating the success of LAMP as a reliable tool for detection [25-27]. The present focuses on development of a LAMP and a qPCR method for specific detection of Saprolegnia species, and compared these two tests based on sensitivity and specificity. These two molecular approaches targeted the internal transcribed spacer (ITS) region of ribosomal DNA and the mitochondrial cytochrome c oxidase subunit I (C0xI) gene. We first report the standard protocols for specific detection of the pathogens, followed by testing our methods under various scenarios for detection of Saprolegnia species including water samples, infected fish tissue, mycelium and zoospores. Our results show that both of the methods are reliable, specific and sensitive to Saprolegnia, and have the potential to be applied for the detection of other pathogens.

Materials and methods

Isolation and maintenance of oomycete cultures

All Saprolegnia spp. cultures used in this study were grown and maintained on yeast peptone sucrose (YPS) agar (20 g/L D-glucose, 1 g/L KH2PO4, 0.5 mg/L MgSO4, and 1 g/L yeast extract) supplemented with 68 μg/ml chloramphenicol and 68 μg/ml streptomycin. The cultures were incubated at 24°C in the dark [28]. Unless otherwise noted, all laboratory grade chemicals used in this study were purchased from Sigma Aldrich, St. Louis, MO. Saprolegnia spp. isolates used in this study (Table 1) were isolated from various sources including fish, eggs, and waters from commercial aquaculture ponds and from recirculating aquaculture systems (RASs). For isolation of Saprolegnia spp. from water, water samples from each source were collected and filtered through two layers of miracloth (Calbiochem, La Jolla, CA). One ml of the filtrate was spread aseptically onto YPS media and incubated in the dark at 24°C. The resultant mycelial growths were subcultured for several generations to ensure the purity of the culture.
Table 1

Saprolegnia spp. isolates used in the present study.

Organism/Sample IDIsolation Source
S. salmonisSunshine bass eggs from Keo Fish Farm (Keo, AR).
3, 9, 6A, 11A, 1BPond water from J.M. Malone and Sons fish farm (Lonoke, AR)
F1, F2, JMM Shad 3, JMM Shad 72American Shad (A. sapidissima) from ponds at J. M. Malone and Son fish farm (Lonoke, AR)
RAS1, RAS2, RAS3, RAS4, RAS5RAS water from The Freshwater Institute (Shepherdstown, WV)
For isolation of Saprolegnia spp. from infected tissues, adult infected American shad (Alosa sapidissima) with lengths ranging between 48.3cm to 49.5cm and exhibiting visible symptoms of saprolegniasis were used for isolation of Saprolegnia spp following previously published protocols [29]. Briefly, areas of the fish exhibiting visible symptoms were dissected using sterilized scalpels; individual pieces were surface sterilized by treatment with 2.5% bleach for 45 s, followed by submersion in distilled water for 1 min, then in 70% ethanol for 45 s, and finally in distilled water for 1 min. These pieces were then aseptically placed onto YPS agar plates and incubated in the dark at 24°C and observed daily.

DNA isolation

Mycelial mats (90–100 mg) from 4-day old Saprolegnia cultures were collected and were crushed using a mortar and pestle in liquid nitrogen. DNA was isolated using the method of Zelaya-Molina et al. [30] with some modifications. Briefly, the crushed mycelia were treated with lysis buffer (10 mM Tris, 50 mM EDTA, 0.5% SDS, 0.5% Tween-20, and 0.5% Triton X-100), 20 mg/ml Proteinase K and 100 mg/ml RNase A. The tubes were incubated at 37°C for 30 min in a shaking incubator at 150 rpm, vortexed for 30 s and then incubated at 55°C for 30 min with a gentle inversion at 10-min intervals. Next, an equal volume of 25:24:1 phenol-chloroform-isoamyl alcohol (VWR, Radnor, PA) was added and the tubes were vortexed for 30 s followed by centrifugation at 10,000g for 10 min. The supernatant was transferred into a new tube, an equal volume of 24:1 chloroform-isoamyl alcohol was added, vortexed for 30 s and centrifuged at 10,000g for 10 min. The supernatant was transferred into a new tube, DNA was precipitated by adding an equal volume of isopropanol (VWR, Radnor, PA) and incubated at -20°C for 15 min. The tubes were then centrifuged at 10,000g for 10 min and the supernatant was discarded. The resultant pellet was washed with 70% ethanol (Pharmco-AAPER, Shelbyville, KY), dried and resuspended in molecular grade water. The isolated DNA was quantified spectrophotometrically using a Nanodrop 2000c (Thermo Scientific, Wilmington, DE). Assessment of the quality of the isolated DNA was performed by electrophoresis on 0.8% agarose gels stained with SYBR™ Green I Nucleic Acid Gel stain (Invitrogen, Carlsbad, CA) and visualized using a UV transilluminator (Ultra-Lum Inc, Claremont, CA).

Sequence analysis and phylogenetic analysis

Identification of Saprolegnia spp. isolates was performed by PCR of the internal transcribed spacer (ITS) region and a portion of the ribosomal large subunit [16, 31, 32] and of cytochrome C oxidase subunit 1 (CoxI) gene [33]. Amplification products were analyzed by electrophoresis and were purified using the QIAquick PCR purification kit (Qiagen, Germantown, MD) according to the manufacturer’s protocol. The purified amplicons were sequenced at the University of Chicago Comprehensive Cancer Centre, DNA sequencing and Genotyping Facility (Chicago, IL). The resultant sequences were subjected to bioinformatic analysis via BLAST [34] and compared to sequences on both the NCBI [35] and the FungiDB [36] databases. Multiple sequence alignments were generated using Clustal Omega [37]. The maximum-likelihood phylogenetic trees of CoxI and ITS markers were constructed using Mega7 software [38] based on the Tamura-Nei Model [39] with 1,000 bootstrap replicates and default parameters. Reference ITS and CoxI sequences were obtained from NCBI GenBank database; Phytophthora sojae voucher P6497 and Aphanomyces euteiches voucher BR694 were used as the outgroups for both the trees. Concatenated phylogenetic trees of ITS and CoxI regions were constructed using SequenceMatrix version 1.8 (http://www.ggvaidya.com/taxondna/) [40] with 1,000 bootstrap replicates and default parameters.

qPCR for specific detection of Saprolegnia spp.

Primers specific to the ITS region and the CoxI gene of the Saprolegnia genus were designed using Primer3 software with manual modifications (https://bioinfo.ut.ee/primer3-0.4.0/) [41]. Quantitative PCR reactions were carried out using the iTaq™ Universal SYBR® Green Supermix (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions in a CFX Connect Real-Time PCR Detection system (Bio-Rad, Hercules, CA). To generate the standard-curve for absolute quantification, reactions were carried out using a 10-fold dilution series of S. salmonis DNA (ranging from 2 ng/μl to 20 ng/μl, measured spectrophotometrically). To assess the specificity of the developed qPCR, 20 ng/μl of DNA purified from all the Saprolegnia isolates described in Table 1 were used with both the ITS and CoxI primers. The reactions were carried out in triplicate.

LAMP for specific detection of Saprolegnia spp.

To design primers for LAMP against the conserved ITS region specific for Saprolegnia spp., the ITS sequences for S. parasitica CBS 223.65 (Accession No.—PRJNA280969), S. diclina VS20 (Accession No.—PRJNA255245), S. ferax (Accession No.—PRJNA12392), S. delica clone 130 (Accession No.—JX212906.1) and S. salmonis from Argentina (Accession No.—EU551153.1) were retrieved from the NCBI sequence database [35] and aligned using Clustal Omega [37]. Inner and outer primers were generated based on this alignment, using the Primer Explorer v5 (https://primerexplorer.jp/e/, Eiken Chemical Co. Ltd., Tokyo, Japan) tool, with default parameters. To optimize the LAMP reaction, each LAMP reaction (25 μl) contained 20 ng/μl of S. salmonis gDNA, 1.4 mM dNTPs, 0.32 U/ μl Bst 3.0 (New England Biolabs, Ipswich, MA), 8 mM MgSO4, 1.6 μM inner primers, 0.2 μM outer primers, 0.4 μM loop primers and molecular grade water (Invitrogen, Carlsbad, CA). The reactions were incubated at 65°C for 60 min, followed by inactivation of the enzyme to terminate the reaction at 80°C for 5 min. No template controls (NTC) using molecular grade water served as negative controls. To each reaction, 1 μl of 1,000X SYBR Green I (AMRESCO Inc., Solon, OH) was added. Visually, a green color formation was indicative of a positive reaction whereas a golden-brown color indicated a negative reaction. The amplification products were also verified visually by 2% agarose gel electrophoresis.

Comparison of qPCR and LAMP

A sensitivity assay was performed using a 10-fold dilution of purified S. salmonis DNA at 100 ng, 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg and 1 fg. Protocols for qPCR and LAMP assay were as described above. For detection of zoospores, one and ten zoospores were used in each reaction for both LAMP and qPCR. The reactions were performed in triplicate and repeated three times.

Results

Pathogen identification and phylogenetic analysis

Fifteen cultures of the oomycete were isolated from water samples as well as from infected fish tissues (Table 1). To identify the isolates, PCR was performed using both the oomycete-specific CoxI primers and universal ITS primers. The PCR products were visualized on 0.8% agarose gel and were purified, sequenced, and analyzed by BLAST [34] with an E-value cutoff of 0. All of the isolates were identified as Saprolegnia. To further validate our results and to track their genetic diversity, phylogenetic trees were constructed. The maximum-likelihood tree of the ITS sequences showed that all the isolated species grouped within the Saprolegnia genus, in agreement with BLAST results (Fig 1). The S. salmonis isolate grouped closely with S. parasitica with a bootstrap value of 68%. For cultures isolated from the ponds of J.M. Malone and Sons fish farm (Lonoke, AR), isolates 6A and 11A were closest to S. diclina with a bootstrap value of 90%. Isolate 1B was grouped with S. parasitica with a bootstrap value of 98%. Isolate 9 grouped with S. ferax with 80% bootstrap support. Isolate 3 was taxonomically closest to S. diclina with a bootstrap value of 63%. For cultures isolated from infected fish (J.M. Malone and Sons fish farm, Lonoke, AR), isolates F1 and F2 grouped together with S. parasitica with 67% bootstrap support. The JMM Shad 3 and JMM Shad 72 also grouped together and appeared to have S. parasitica as the closest phylogenetic neighbor with 68% bootstrap support. Isolates RAS1, RAS2 and RAS3 grouped closest to S. parasitica, while RAS4 grouped closest to S. ferax with 80% bootstrap support; RAS5 had the closest phylogenetic relationship with S. monoica with 89% bootstrap support. A second maximum-likelihood tree based on the CoxI sequences showed the same phylogenetic groupings with the ITS based tree with slightly different bootstrap values (Fig 2). To increase discriminatory power and the robustness for identification of species within the genus, the sequences of both ITS and CoxI were used to constitute the concatenated phylogenetic tree. Fig 3 showed the same phylogenetic groupings with both the ITS- and CoxI-based trees with slightly different bootstrap values. Overall, the results of the three phylogenetic trees confirmed that the isolates in Table 1 belonged to the Saprolegnia genus.
Fig 1

Maximum-likelihood phylogenetic tree showing evolutionary relationships of 53 Saprolegnia isolates based on the ITS region.

Isolates examined in this study are shown in boldface. Bootstrap values ≥ 50% (1000 replicates) are given at the branchpoints. The scale bar indicates the number of substitutions per site. P. sojae voucher P6497 and A. euteiches BR694 were used as outgroups.

Fig 2

Maximum-likelihood phylogenetic tree showing evolutionary relationships of 53 Saprolegnia isolates based on the CoxI gene.

Isolates examined in this study are shown in boldface. Bootstrap values ≥ 50% (1000 replicates) are given at the branchpoints. The scale bar indicates the number of substitutions per site. P. sojae voucher P6497 and A. euteiches BR694 were used as outgroups.

Fig 3

Concatenation phylogenetic tree based on the sequences of ITS and CoxI.

Isolates examined in this study are shown in boldface. Bootstrap values ≥ 50% (1000 replicates) are given at the branchpoints. The scale bar indicates the number of substitutions per site. P. sojae voucher P6497 and A. euteiches BR694 were used as outgroups.

Maximum-likelihood phylogenetic tree showing evolutionary relationships of 53 Saprolegnia isolates based on the ITS region.

Isolates examined in this study are shown in boldface. Bootstrap values ≥ 50% (1000 replicates) are given at the branchpoints. The scale bar indicates the number of substitutions per site. P. sojae voucher P6497 and A. euteiches BR694 were used as outgroups.

Maximum-likelihood phylogenetic tree showing evolutionary relationships of 53 Saprolegnia isolates based on the CoxI gene.

Isolates examined in this study are shown in boldface. Bootstrap values ≥ 50% (1000 replicates) are given at the branchpoints. The scale bar indicates the number of substitutions per site. P. sojae voucher P6497 and A. euteiches BR694 were used as outgroups.

Concatenation phylogenetic tree based on the sequences of ITS and CoxI.

Isolates examined in this study are shown in boldface. Bootstrap values ≥ 50% (1000 replicates) are given at the branchpoints. The scale bar indicates the number of substitutions per site. P. sojae voucher P6497 and A. euteiches BR694 were used as outgroups.

qPCR for specific detection

The qPCR reaction for CoXI gene using qCOX R1 (5’CTGAAGGACCWGAGTGHGCTTG 3’) and qCOX F1 (5’GGDGCTCCWGATAGGCTTTNCC 3’) was optimized by gradient qPCR. Results showed that annealing temperature at 59°C gave the best specificity and efficiency. We then generated a standard curve using a 10-fold dilution of purified gDNA from S. salmonis (20 ng/μl to 0.2 pg/μl) in triplicate. The Cq values of these standards were plotted against the logarithm of their concentrations. The assay efficiency was calculated to be at 91.4% using the equation y = (-3.546)x + 54.138 with the slope values of -3.546 and R2 values of 0.990 (Fig 4). The melt curve analysis gave rise to a single distinct peak indicating that the qPCR product was a pure, single amplicon and was specific to S. salmonis.
Fig 4

Standard curve of CoxI gene.

Ten-fold dilutions of S. salmonis DNA ranging from 1 fg to 100 ng were amplified in triplicate and the reactions were repeated three times. The iTaq™ Universal SYBR® Green Supermix and qCOXF1+R1 primers were used.

Standard curve of CoxI gene.

Ten-fold dilutions of S. salmonis DNA ranging from 1 fg to 100 ng were amplified in triplicate and the reactions were repeated three times. The iTaq™ Universal SYBR® Green Supermix and qCOXF1+R1 primers were used.

Development of LAMP

Primers for the specific detection of Saprolegnia genus were designed targeting a conserved 201 bp section of the ITS region (Fig 5A). The inner and outer primers were generated based on sequence alignment using Clustal Omega alignment followed by the Primer Explorer v5 (https://primerexplorer.jp/e/, Eiken Chemical Co. Ltd., Tokyo, Japan) tool. The outer and inner primer sets with the highest dG value for dimerization and with acceptable room for generating loop primers, were chosen to ensure that the free energies and the 5’ end of F1c and B1c, and the 3’ end of F2 and B2, were less than or equal to -4.0 kcal/mol (Fig 5B, Table 2).
Fig 5

Lamp primer design.

A. Schematic representation of the ITS region, showing the positioning of the LAMP primers used in the present study. Scale bar represents 100bp. FwdOut = Forward Outer Primer; RevOut = Backward Outer Primer; F2+F1c = Forward Inner Primer; B2c+B1 = Backward Inner Primer; LF = Loop Forward Primer; LB = Loop Backward Primer. B. Positioning and orientation of LAMP primers developed in the present study. Representative ITS sequences from Saprolegnia and non-Saprolegnia oomycetes were aligned and the LAMP primers were positioned on the alignment manually. The LAMP primers amplified the ITS1 regions of the target sequences.

Table 2

LAMP primers used in the present study.

PrimerAbbreviationSequence
Forward Inner PrimerFIP 5’ CACTTACATGAGAAATCTCCGAA-TAGCCGAAGAACGCTTTGGAAGC 3’
Backward Inner PrimerBIP 5’ AATTCAGTGAGTCATCTAAATA-AACATACTCCCAGGACTAACCCGC 3’
Forward Outer PrimerFwdOut 5’ GGTAATGGTGTGGTTTTTTGTGG 3’
Backward Outer PrimerRevOut 5’ TGAAAGAAGTTTGTGTTG 3’
Loop Forward PrimerLF 5’ GCGACGGGAACACCGT 3’
Loop Backward PrimerLB 5’ AGTGCAATATGCGTT 3’

Lamp primer design.

A. Schematic representation of the ITS region, showing the positioning of the LAMP primers used in the present study. Scale bar represents 100bp. FwdOut = Forward Outer Primer; RevOut = Backward Outer Primer; F2+F1c = Forward Inner Primer; B2c+B1 = Backward Inner Primer; LF = Loop Forward Primer; LB = Loop Backward Primer. B. Positioning and orientation of LAMP primers developed in the present study. Representative ITS sequences from Saprolegnia and non-Saprolegnia oomycetes were aligned and the LAMP primers were positioned on the alignment manually. The LAMP primers amplified the ITS1 regions of the target sequences. For optimization of the LAMP reaction, the first factor that was considered was the Mg2+ concentration. We tested the reactions using 2 ng of DNA/reaction with eight different concentrations of Mg2+ ranging from 2 mM-10 mM Mg2+. The experiments were performed in triplicate and repeated three times. Our results showed that concentration of Mg2+ at and above 4 mM showed positive reactions. Interestingly, in no template controls, when concentrations of Mg2+ was at 5 mM and above, the colors of the reactions showed false positives (Fig 6). Therefore, to avoid false positive reaction, the optimal concentration of Mg2+ at 4mM was chosen. Optimization of the other factors including various temperatures, reaction times and primer ratios did not have any impact on the integrity of the reaction. Hence, the optimal condition for the LAMP reaction was selected as 4mM Mg2+, 1:8 outer to inner primer ratio and a reaction temperature of 65°C.
Fig 6

Optimization of Mg2+ concentration for LAMP.

The concentrations of Mg2+ ranging from 2 mm-10 mM were tested. Top panel represents positive controls using 2ng/μl S. salmonis gDNA. The bottom panel, No Template Control (NTC) represents negative controls. Color change to green indicates positive reaction, while golden brown indicates negative reaction. The experiments were performed in triplicate and repeated three times.

Optimization of Mg2+ concentration for LAMP.

The concentrations of Mg2+ ranging from 2 mm-10 mM were tested. Top panel represents positive controls using 2ng/μl S. salmonis gDNA. The bottom panel, No Template Control (NTC) represents negative controls. Color change to green indicates positive reaction, while golden brown indicates negative reaction. The experiments were performed in triplicate and repeated three times. To establish the sensitivity of the LAMP reaction, the experiments were carried out with a 10-fold dilution series of purified S. salmomis DNA ranging from 1 fg to 100 ng, in triplicate. Results showed that LAMP successfully detected as low as 10 fg of S. salmomis DNA (Fig 7). This detection sensitivity was higher than that of qPCR which was at 2 pg (Fig 4). Further testing to determine whether our method can be used to directly detect zoospore from water samples without DNA purification, we subjected one or ten zoospores of S. salmonis to LAMP and qPCR methods. Ten ng of S. salmonis genomic DNA was used as the positive control and NTC was used as negative controls. Each sample was performed in triplicate and repeated three times. The results showed that both the qPCR and LAMP procedures successfully detected one zoospore in the water samples (Fig 8), indicating that our developed methods were highly specific and highly sensitive.
Fig 7

The sensitivity of LAMP.

Ten-fold dilution S. salmonis DNA ranging from 1 fg to 100 ng were used in the presence of 1000X SYBR Green I. Color changes from golden brown to green indicates a positive reaction. The concentrations of template DNA are indicated, NTC = no template control, represents a negative control. The reactions were performed in triplicate and were repeated three times.

Fig 8

Direct detection of zoospores.

A. qPCR and B. LAMP. One and ten zoospores were used in each reaction, S. salmonis DNA (10 ng/μl) was used as the positive control while no template control (NTC) was used as the negative control. Each sample was performed in triplicate and was repeated three times.

The sensitivity of LAMP.

Ten-fold dilution S. salmonis DNA ranging from 1 fg to 100 ng were used in the presence of 1000X SYBR Green I. Color changes from golden brown to green indicates a positive reaction. The concentrations of template DNA are indicated, NTC = no template control, represents a negative control. The reactions were performed in triplicate and were repeated three times.

Direct detection of zoospores.

A. qPCR and B. LAMP. One and ten zoospores were used in each reaction, S. salmonis DNA (10 ng/μl) was used as the positive control while no template control (NTC) was used as the negative control. Each sample was performed in triplicate and was repeated three times. The specificity of the LAMP assay was tested using purified DNA from different isolates of Saprolegnia spp., infected fish tissues other non-Saprolegnia oomycetes (A. astaci and P. sojae), a fungus (Fusarium spp.), Daphnia magna and a bacterium (Escherichia coli). Each sample was tested in triplicate. Results showed that the LAMP reaction was specific only to the Saprolegnia genus (Table 3), demonstrating that our developed LAMP method was specific to pathogens in the genus Saprolegnia and is highly sensitive.
Table 3

Specificity of qPCR and LAMP.

SpeciesIsolation SourceqPCR resultLAMP result
S. salmonis (+ control)Pond water from J.M. Malone and Sons fish farm (Lonoke, AR)++
S. feraxInfected crayfish tissue (Bowling Green, OH)++
S. parasiticaRAS water from The Freshwater Institute (Shepherdstown, WV)++
S. diclinaPond water from J.M. Malone and Sons fish farm (Lonoke, AR)++
S. delicaPond water from J.M. Malone and Sons fish farm (Lonoke, AR)++
A. astaciInfected crayfish tissue (Bowling Green, OH)--
P. sojaeInfected soybean (Bowling Green, OH)--
Fusarium spp.Water from cichlid aquaria (Bowling Green, OH)--
D. magnaWater from BGSU Greenhouse reservoir (Bowling Green, OH)--
E. coliTOP10 (Invitrogen, CA)--

Discussion

The pathogens in the genus Saprolegnia cause significant economic losses in aquaculture; therefore, accurate identification and early detection of pathologically relevant levels is critical. Morphological identification is challenging and less reliable compared to molecular studies. To ensure reliable identification of oomycetes, a combination of molecular markers based on ITS regions along with CoxI and/or CoxII are recommended [33]. The present study develops a standard protocol for identification of pathogens in the genus Saprolegnia using both ITS and CoxI. To determine genetic relationships among Saprolegnia spp. used in this study, phylogenetic trees with a single locus of ITS or CoxI marker as well as a concatenated phylogeny were constructed. These three phylogenetic trees confirmed that the isolates were related and belonged to the Saprolegnia genus. Due to low bootstrap values at some nodes, additional markers are required to conclusively determine the phylogenetic positioning of the isolates within the Saprolegnia genus. For instance, in all three phylogenetic trees, S. salmonis clustered with S. parasitica but bootstrap values were below 68%. Multilocus phylogenetic analysis should, in theory, increase phylogenetic resolution and improve the analysis. Such multi-gene analyses has been conducted by Göker et al. [42] using ꞵ-tubulin, NADH1 and LSU rDNA sequences for several oomycetes. Phylogenetic resolution of the Phytophthora genus was accomplished in this manner by Martin et al. [43]. Richter and Rósselló-Mora [44] suggested that measurement of average nucleotide identity between two genomes could yield more accurate results of species resolution. Finally, it has been suggested that sampling more individuals per species can help resolve incongruences amongst single gene trees [45]. An interesting observation in our phylogenetic studies was that the variation at the species level for the Saprolegnia isolates from RAS, even though the water samples from these systems was collected from the same tank at the same time. However, similar species level spatio-temporal variations have been reported for Phytophthora, Pythium and Phytopythium species in nursery irrigation systems [46]. In this study, we were able to isolate and purify Saprolegnia from environmental sources (water samples and infected tissues), using a similar method for the isolation of Saprolegnia spp. from infected rainbow trout [8], infected crayfish [47], salmon hatcheries [11] and amphibians [48]. Current protocols for detecting and identifying Saprolegnia from environmental sources involve lab culture-based approaches followed by PCR-based molecular identification. Another method of oomycete detection which has been used with some success is baiting [49] using rice seeds [50], hemp seeds [28] and sesame seeds [51], followed by PCR for accurate identification. Finally, immunological detection of Saprolegnia spp. using monoclonal antibodies has also been reported [15]. This study is the first to develop a rapid and sensitive molecular technique for the detection of Saprolegnia spp. using the novel LAMP technique. Previously, LAMP has been employed for the detection of other oomycetes such as Plasmopara viticola [52], P. sojae [53] and Pythium spp. [54]. As an on-site detection tool, LAMP has several advantages compared to conventional PCR and qPCR. It has been applied successfully for on-site detections of the bacteria responsible for foot rot in sheep [55]. A major advantage of LAMP is that it is highly sensitive and does not require major equipment. Our developed LAMP assay successfully detected all 15 isolates in the present study and offered positive results with as low as 10 fg DNA and with only one zoospore of S. salmonis. It is noteworthy that our method can directly detect an organism from a sample without DNA purification, which refers to a one-step LAMP. This method has been reported in several studies such as detection of E. coli, Mycobacterium smegmatis [56] and Mycoplasma ovipneumoniae [57]. Similarly, detection by LAMP at femtogram level has been reported in numerous studies such as acute viral necrobiotic virus in scallop [58], classical swine flu virus [59] and Enterococcus hirae [60]. When our developed LAMP assay from this study was tested on several members of the oomycetes, it was found to be specific for all 15 Saprolegnia isolates used in this study. The sensitivity and specificity of LAMP makes it a suitable candidate for the detection of target organisms from environmental samples, especially when present in extremely low amounts. Although false positives are one of the major drawbacks associated with LAMP, much of the false positive amplification can be eliminated by using six primers and careful optimization of the reaction [61]. We did not experience any false positives in our experiments. While both LAMP and qPCR have their own advantages and drawbacks depending on the circumstance, they can both be used to specifically detect the members of the genus Saprolegnia. The LAMP method is inexpensive and more rapid and sensitive compared to qPCR; therefore, we propose the use of LAMP for sensitive detection of pathologically relevant levels of Saprolegnia for on-site applications. However, to quantify Saprolegnia loads, qPCR is more useful, especially when the epidemic threshold of the disease is known. Incorporation of the LAMP method and qPCR into real-time LAMP would provide the best outcome for detection and quantification. This would enable monitoring the dynamics of Saprolegnia spp. in the water, and at what points their level becomes an issue. Real-time LAMP has been reported for the detection and quantification of Enterocytozoon hepatopenaei [62] and Ustilago maydis [63] and future research should investigate its development use for to detect Saprolegnia and other oomycete pathogens. 6 Aug 2021 PONE-D-21-11810 Development and comparison of Loop-Mediated Isothermal Amplification with Quantitative PCR for the specific detection of Saprolegnia spp. PLOS ONE Dear Dr. Phuntumart, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ============================== I got the recommendations and comments from an expert reviewer on the field. The both reviewer agree that the manuscript is technically sound and the data support the conclusions.However, lack of the real time data, such as no of technical and biological replicates..That is only one one reservation and I totally share their comments. Therefore, I can invite you to submit a revised version of the manuscript that addresses the major point raised by the reviewers. ============================== Please submit your revised manuscript by Sep 20 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Hideyuki Doi Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating the following in the Acknowledgments Section of your manuscript: “This research was funded by Ohio Sea Grant (10000960) and Bowling Green State University.  We thank Gayathri Beligala for her contribution to the experiments. “ We note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: “SG-Ohio Sea Grant (10000960), https://ohioseagrant.osu.edu/ VP-Ohio Sea Grant (10000960), https://ohioseagrant.osu.edu/ The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.” Please include your amended statements within your cover letter; we will change the online submission form on your behalf. Additional Editor Comments (if provided): I got the recommendations and comments from an expert reviewer on the field. The both reviewer agree that the manuscript is technically sound and the data support the conclusions.However, lack of the real time data, such as no of technical and biological replicates..That is only one one reservation and I totally share their comments. Therefore, I can invite you to submit a revised version of the manuscript that addresses the major point raised by the reviewers. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The work is indeed important for all aquaculture pathogen surveliance projects. Good work..Indeed a good manuscipt to be publsihed. the real time data maybe should be made more clearer, such as no of technical and biological replicates..That is only one one reservation ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Subha Bhassu [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 3 Nov 2021 We thank the reviewers for their helpful comments and supportive message. Regarding technical and biological replications in our qPCR experiment, we followed the guiding principles from Blainey, P., Krzywinski, M. & Altman, N. Replication. Nat Methods 11, 879–880 (2014). https://doi.org/10.1038/nmeth.309 We agree with the reviewers that having both technical and biological replication is of a great value. In our case, the qPCR data of Saprolegnia salmonis was relevant to assess the robustness and to quantify other Saprolegnia spp. isolates for future experiments. Additionally, Saprolegnia salmonis has been used as our major biological sample in optimization of the reactions. It was later used as a positive control in all our experiments. We hope you agree that data in Table 3 represents both technical and biological replicates for our experiments. We added this information in each of our experiments where appropriated. Thank you. Submitted filename: Response to Reviewers.docx Click here for additional data file. 8 Nov 2021 Development and comparison of Loop-Mediated Isothermal Amplification with Quantitative PCR for the specific detection of Saprolegnia spp. PONE-D-21-11810R1 Dear Dr. Phuntumart, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Hideyuki Doi Academic Editor PLOS ONE Additional Editor Comments (optional): I carefully checked the revised manuscript as well as the response letter. I agree the revisions according to the reviewers’ comments and now can recommend to publish the paper in this journal. Reviewers' comments: 3 Dec 2021 PONE-D-21-11810R1 ­­­­­­­­Development and comparison of loop-mediated isothermal amplification with quantitative PCR for the specific detection of Saprolegnia spp. Dear Dr. Phuntumart: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Hideyuki Doi Academic Editor PLOS ONE
  50 in total

1.  Identification and Detection of Phytophthora: Reviewing Our Progress, Identifying Our Needs.

Authors:  Frank N Martin; Z Gloria Abad; Yilmaz Balci; Kelly Ivors
Journal:  Plant Dis       Date:  2012-08       Impact factor: 4.438

2.  DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer.

Authors:  Gregg P Robideau; Arthur W A M De Cock; Michael D Coffey; Hermann Voglmayr; Henk Brouwer; Kanak Bala; David W Chitty; Nicole Désaulniers; Quinn A Eggertson; Claire M M Gachon; Chia-Hui Hu; Frithjof C Küpper; Tara L Rintoul; Ehab Sarhan; Els C P Verstappen; Yonghong Zhang; Peter J M Bonants; Jean B Ristaino; C André Lévesque
Journal:  Mol Ecol Resour       Date:  2011-06-20       Impact factor: 7.090

3.  Optimizing copper sulfate treatments for fungus control on channel catfish eggs.

Authors:  David L Straus; Andrew J Mitchell; Ray R Carter; James A Steeby
Journal:  J Aquat Anim Health       Date:  2009-06       Impact factor: 1.625

4.  Saprolegnia diclina: another species responsible for the emergent disease 'Saprolegnia infections' in amphibians.

Authors:  María José Fernández-Benéitez; Manuel Eloy Ortiz-Santaliestra; Miguel Lizana; Javier Diéguez-Uribeondo
Journal:  FEMS Microbiol Lett       Date:  2008-02       Impact factor: 2.742

5.  Easy and efficient protocol for oomycete DNA extraction suitable for population genetic analysis.

Authors:  Lily X Zelaya-Molina; Maria A Ortega; Anne E Dorrance
Journal:  Biotechnol Lett       Date:  2010-11-24       Impact factor: 2.461

6.  Development of a real-time fluorescence loop-mediated isothermal amplification assay for rapid and quantitative detection of Ustilago maydis.

Authors:  Yanyong Cao; Lifeng Wang; Liping Duan; Jingjing Li; Juan Ma; Shuna Xie; Lei Shi; Huiyong Li
Journal:  Sci Rep       Date:  2017-10-17       Impact factor: 4.379

Review 7.  A Basic Guide to Real Time PCR in Microbial Diagnostics: Definitions, Parameters, and Everything.

Authors:  Petr Kralik; Matteo Ricchi
Journal:  Front Microbiol       Date:  2017-02-02       Impact factor: 5.640

8.  FungiDB: An Integrated Bioinformatic Resource for Fungi and Oomycetes.

Authors:  Evelina Y Basenko; Jane A Pulman; Achchuthan Shanmugasundram; Omar S Harb; Kathryn Crouch; David Starns; Susanne Warrenfeltz; Cristina Aurrecoechea; Christian J Stoeckert; Jessica C Kissinger; David S Roos; Christiane Hertz-Fowler
Journal:  J Fungi (Basel)       Date:  2018-03-20

9.  Optimization of a Loop Mediated Isothermal Amplification (LAMP) Assay for In-Field Detection of Dichelobacter nodosus With aprV2 (VDN LAMP) in Victorian Sheep Flocks.

Authors:  Nickala Best; Grant Rawlin; Robert Suter; Brendan Rodoni; Travis Beddoe
Journal:  Front Vet Sci       Date:  2019-03-08

10.  Loop-mediated isothermal amplification-lateral-flow dipstick (LAMP-LFD) to detect Mycoplasma ovipneumoniae.

Authors:  Jie Zhang; Junjun Cao; Mingsong Zhu; Mingguo Xu; Feng Shi
Journal:  World J Microbiol Biotechnol       Date:  2019-01-30       Impact factor: 3.312

View more
  2 in total

1.  Development of multiplex PCR assay for species-specific detection and identification of Saprolegnia parasitica.

Authors:  Khangembam Victoria Chanu; Dimpal Thakuria; Vinita Pant; Sweta Bisht; Ritesh Shantilal Tandel
Journal:  Biotechnol Rep (Amst)       Date:  2022-08-09

2.  Tracing the oomycete pathogen Saprolegnia parasitica in aquaculture and the environment.

Authors:  Dora Pavić; Dorotea Grbin; Sandra Hudina; Uršula Prosenc Zmrzljak; Anđela Miljanović; Rok Košir; Filip Varga; Josip Ćurko; Zoran Marčić; Ana Bielen
Journal:  Sci Rep       Date:  2022-10-05       Impact factor: 4.996

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.