Literature DB >> 34872591

GR-mediated transcriptional regulation of m6A metabolic genes contributes to diet-induced fatty liver in hens.

Yue Feng1,2, Yanlin Li1,2, Wenduo Jiang1,2, Yun Hu1,2, Yimin Jia1,2, Ruqian Zhao3,4.   

Abstract

BACKGROUND: Glucocorticoid receptor (GR) mediated corticosterone-induced fatty liver syndrome (FLS) in the chicken by transactivation of Fat mass and obesity associated gene (FTO), leading to demethylation of N6-methyladenosine (m6A) and post-transcriptional activation of lipogenic genes. Nutrition is considered the main cause of FLS in the modern poultry industry. Therefore, this study was aimed to investigate whether GR and m6A modification are involved in high-energy and low protein (HELP) diet-induced FLS in laying hens, and if true, what specific m6A sites of lipogenic genes are modified and how GR mediates m6A-dependent lipogenic gene activation in HELP diet-induced FLS in the chicken.
RESULTS: Laying hens fed HELP diet exhibit excess (P < 0.05) lipid accumulation and lipogenic genes activation in the liver, which is associated with significantly increased (P < 0.05) GR expression that coincided with global m6A demethylation. Concurrently, the m6A demethylase FTO is upregulated (P < 0.05), whereas the m6A reader YTHDF2 is downregulated (P < 0.05) in the liver of FLS chickens. Further analysis identifies site-specific demethylation (P < 0.05) of m6A in the mRNA of lipogenic genes, including FASN, SREBP1 and SCD. Moreover, GR binding to the promoter of FTO gene is highly enriched (P < 0.05), while GR binding to the promoter of YTHDF2 gene is diminished (P < 0.05).
CONCLUSIONS: These results implicate a possible role of GR-mediated transcriptional regulation of m6A metabolic genes on m6A-depenent post-transcriptional activation of lipogenic genes and shed new light in the molecular mechanism of FLS etiology in the chicken.
© 2021. The Author(s).

Entities:  

Keywords:  Chicken; FTO; Fatty liver syndrome; GR; Lipogenesis; YTHDF2; m6A

Year:  2021        PMID: 34872591      PMCID: PMC8650238          DOI: 10.1186/s40104-021-00642-7

Source DB:  PubMed          Journal:  J Anim Sci Biotechnol        ISSN: 1674-9782


Background

Fatty liver syndrome (FLS) is a metabolic disease mostly observed in laying hens, which is characterized by increased lipid accumulation in the liver [1]. FLS occurs at the rate between 4% and 20% in chickens kept in intensive systems, which may cause dramatic drop in egg production and increased mortality, leading to considerable economic losses [2, 3]. Several factors have been reported to contribute to the development of FLS, including genetics, environment, nutrition, toxic substances, and hormones [4, 5]. Among these, nutrition is considered the main cause of FLS in the modern poultry industry. Nutritionally over-fed laying hens are at risk for developing FLS [4], and a high-energy maize diet produces a higher incidence of FLS than a low-energy barley diet [6]. Also, high-energy low-protein (HELP) diet is used to establish a model of FLS in some previous publications [7-9]. FLS is caused primarily by an imbalance of hepatic energy influx and efflux. Glucocorticoids (GC) play an important role in hepatic metabolic homeostasis. Chronically elevated GC level is a common feature of fatty liver in humans and animal models [10, 11]. The actions of GC are primarily mediated by glucocorticoid receptor (GR) [12]. Over-activation of GR pathway leads to transcriptional up-regulation of lipogenic genes, causing hepatic steatosis [13]. In chickens, corticosterone (CORT) is the main active form of GC [14]. We have shown previously that excessive CORT administration causes FLS in chickens, which is characterized by excessive lipid accumulation in the liver [15-17]. GR is up-regulated in the liver of FLS chickens [15-17], yet it remains unknown how GR contributes to diet-induced FLS in the chicken. Three families of protein components are involved in the dynamic m6A methylation. The methyltransferases complex formed by methyltransferase-like 3 (METTL3), methyltransferase-like 14 (METTL14), and Wilms’ tumor 1-associating protein (WTAP) [18-20] are “writers” to transfer methyl group to the adenosine of the consensus m6A motif in the target RNA. The two demethylases, termed as “erasers”, fat mass and obesity-associated protein (FTO) and α-ketoglutarate-dependent dioxygenase AlkB homolog 5 (ALKBH5) [21, 22], are responsible to remove the methyl group from the m6A. The “readers”, such as YTH-domain family 1–3 (YTHDF1–3), can recognize this methylation and regulate the RNA metabolism including stability or translation efficiency of the mRNA [23-26]. m6A modification plays a key role in lipid accumulation and energy metabolism [27, 28]. Recently, GR is reported to mediate corticosterone-induced fatty liver in the chicken by transactivation of FTO, leading to demethylation of m6A and post-transcriptional activation of lipogenic genes such as sterol regulatory element-binding protein-1 (SREBP1), fatty acid synthase (FASN) and stearoyl-CoA desaturase (SCD) [17]. However, it remains unclear what specific sites of lipogenic genes are demethylated and which m6A binding protein is involved in mediating m6A-dependent post-transcriptional activation of lipogenic genes. Therefore, this study was aimed to investigate whether GR and m6A modification are involved in HELP diet-induced FLS in laying hens, and if yes, what specific m6A sites of lipogenic genes are modified and how GR mediates m6A-dependent lipogenic gene activation in HELP diet-induced FLS in the chicken.

Methods

Animals and treatment

Forty-eight Hy-Line Variety Brown laying hens (260 days of age, 1.69 ± 0.09 kg in body weight) were raised in the animal house of Nanjing Agricultural university, with the room temperature at approximately 24 °C, and the light regime of 16 L: 8D. Three hens were housed in each cage (60 cm × 46 cm × 44 cm) equipped with a nipple drinker. Hens were randomly divided into control (CON, twenty-four chickens in eight cages) and high-energy low protein diet (HELP, twenty-four chickens in eight cages) groups, fed control diet (2,610 kcal/kg metabolizable energy, 16.9% crude protein) and HELP diet (3,100 kcal/kg metabolizable energy, 12.1% crude protein), respectively, for 12 weeks. The ingredient and calculated composition of the diets used in the current study are presented in Table 1. Hens were subjected to feed restriction (110 g per hen per day) with free access to water throughout the experiment. After 12 weeks of dietary treatment, 1 hen from each cage was randomly selected and killed by rapid decapitation that is considered acceptable for euthanasia of birds according to American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals: 2013 Edition. Liver samples were rapidly frozen in liquid nitrogen and kept at − 80 °C for further analysis. Among eight hens from HELP group, six hens were diagnosed as FLS according to the hepatic triglyceride (TG) content. So, the sample size was adjusted of both CON and HELP group to six. We conducted a statistical assessment with the replicate number by using G*Power 3.1.9.2 with power (1-β) set at 0.95 and α = 0.05. According to the TG content in the liver (CON = 21.62 ± 2.85 mg/g; HELP = 42.45 ± 7.62 mg/g), we have calculated the effective size d = 3.62. A sample size of 8 participants (4 per group) was needed. Therefore, 12 participants (6 per group) provide sufficient power to study the molecular mechanism underlying the diet-induced FLS in the present study.
Table 1

Ingredient and calculated composition of the diets (based on air-dried weight)

ItemsCONHELP
Ingredient, %
 Corn62.168.21
 Soybean meal2613
 Soybean oil06.5
 Limestone8.98.9
 Lysine00.34
 Methionine00.14
 Premixa33
 Total100100
Calculated composition, %
 Metabolizable energy, kcal/kg2,6103,100
 Crude protein16.912.1
 Calcium3.213.17
 Available P0.590.58
 Lysine0.800.77
 Methionine0.380.34

aThe premix was composed of the following per kg diet: VA 9,000 IU; VD3, 3,600 IU; VE, 12 IU; VK3, 3.00 mg; VB1, 2.00 mg; VB2, 6.90 mg; VB6, 2.70 mg; VB12, 0.02 mg; D-Biotin, 0.23 mg; nicotinic acid, 31.20 mg; Folic acid, 1.00 mg; VB5, 10.80 mg; Choline chloride, 0.30 g; Fe (as FeSO4), 60.00 mg; Cu (as CuSO4), 12.00 mg; Mn, 90.00 mg; Zn (as ZnSO4), 90.00 mg; I (as KI), 0.80 mg; Se (as Na2SeO3), 0.30 mg

Ingredient and calculated composition of the diets (based on air-dried weight) aThe premix was composed of the following per kg diet: VA 9,000 IU; VD3, 3,600 IU; VE, 12 IU; VK3, 3.00 mg; VB1, 2.00 mg; VB2, 6.90 mg; VB6, 2.70 mg; VB12, 0.02 mg; D-Biotin, 0.23 mg; nicotinic acid, 31.20 mg; Folic acid, 1.00 mg; VB5, 10.80 mg; Choline chloride, 0.30 g; Fe (as FeSO4), 60.00 mg; Cu (as CuSO4), 12.00 mg; Mn, 90.00 mg; Zn (as ZnSO4), 90.00 mg; I (as KI), 0.80 mg; Se (as Na2SeO3), 0.30 mg

Histological evaluation

To visualize the hepatic fat droplets, fresh frozen liver samples were embedded in optimal cutting temperature (OCT) compound and sliced into 8 μm sections. The frozen sections were stained with oil red O (Sigma Aldrich, Saint Louis, MO, USA) for 30 min, counter-stained with H&E for 30 s, then mounted in neutral resin. The slides were observed by using an optical light microscope (Olympus-BX53, Tokyo, Japan).

Determination of triglyceride content in liver

TG content in liver was measured by using TG assay kits (E1013, Applygen Technologies Inc., Beijing, China) following the manufacturer’s instructions. Briefly, 50 mg of frozen liver sample was homogenized in 1 mL of isopropanol manually in a glass homogenizer with 10 passes on ice, incubated at 4 °C for 10 min. The supernatants were collected and used to measure the hepatic TG contents following the instruction of the TG assay kit.

Determination of corticosterone content in plasma

CORT content in plasma was measured by using chicken CORT ELISA Kit (E-EL-0160c, Elabscience, TX, USA) following the manufacturer’s instructions.

Total RNA isolation and real-time PCR

Total RNA was isolated from liver sample (30 mg) using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcribed into cDNA by using HiScript II Q RT SuperMix for qPCR (+gDNA wiper) (R223–01, Vazyme, Nanjing, China). The coding sequences were used to design specific oligonucleotide primers (GenScript Biotech Co., Nanjing, China) for PCR (Table 2) with AceQ qPCR SYBR Green Master Mix (Q111–02, Vazyme, Nanjing, China) on the Applied Biosystems QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The relative mRNA abundance was calculated with the 2−ΔΔCt method using GAPDH as an internal reference.
Table 2

Nucleotide sequences of primers

Target genesPrimer sequences (5′to 3′)Used for
SREBP1F: CTACCGCTCATCCATCAACGReal-time PCR
R: CTGCTTCAGCTTCTGGTTGC
FASNF: CGTCATCACCGTCTATCReal-time PCR
R: GTAGGCTCCTCCCATC
SCDF: CTATGCGGGGCTACTTReal-time PCR
R: GGATGGCTGGAATGAA
GRF: CTTCCATCCGCCCTTCAReal-time PCR
R: TCGCATCTGTTTCACC
METTL3F: GCTCCATCCAGGCCCATAAGReal-time PCR
R: CCCACTCACCGTATCGATGG
METTL14F: GTGATTCTCCTGGAGCCACCReal-time PCR
R: TGGGGTCCAGAGTCTTCGTT
FTOF: TGAAGGTAGCGTGGGACATAGAReal-time PCR
R: TGAAGGTAGCGTGGGACATAGA
YTHDF1F: ACAAGCGTTGACCCTCAGAGAReal-time PCR
R: TGTTCCCCAAGCTGAGAAGG
YTHDF2F: TCCTACTCTCTGGGTGAGGCReal-time PCR
R: GCGTAATTGCTGCTGTAGCC
YTHDF3F: CCACCAACACTGGTGCAAAGReal-time PCR
R: GCCCACACCCCTATTACGAG
FTO FragmentF: AAAACTGAGGGGGGATChIP PCR
R: ACAACTGTGGGCAAGG
YTHDF2 Fragment 1F: GTGCTTGTTGCTACTCGTChIP PCR
R: CCATAGAGGAACCCAATC
YTHDF2 Fragment 2F: GGGCTCAGGTGGTTTGTTChIP PCR
R: CACGTCCAGCGATTCATC
YTHDF1 FragmentF: GCAGGTATTTTGACACTTChIP PCR
R: TATGCATTGACCAGAACT

Protein extraction and Western blotting analysis

Protein was extracted from 40 mg frozen liver sample as previously described [29]. The protein concentration was determined with a Pierce BCA Protein Assay Kit (Thermo Fisher, Waltham, MA, USA). Forty micrograms of protein were used for electrophoresis on the 10% SDS-PAGE gel. Western blot analysis for SREBP1 (AB12162, Abcam, Cambridge, MA, USA, diluted 1:500), SCD (sc-30081, Santa Cruz, CA, USA, diluted 1:200), GR (Custom made for chickens by Genecreate Biotech Co., Wuhan, China, diluted 1:1,000), METTL3 (AB98009, Abcam, diluted 1:1,000), METTL14 (AB98116, Abcam, diluted 1:1,000), FTO (AB77547, Abcam, diluted 1:1,000), YTHDF1 (17479–1-AP, Proteintech, Chicago, IL, USA, diluted 1:2,000), YTHDF2 (24744–1-AP, Proteintech, diluted 1:2,000) and YTHDF3 (25537–1-AP, Proteintech, diluted 1:1,000) were carried out according to the recommended protocols provided by the manufacturers, The density of each protein band was normalized by that of Tubulin α, the internal control. All antibodies were verified to work with chicken samples in previous publications [16, 17]. Images were captured by VersaDoc 4000MP system (Bio-Rad, Hercules, CA, USA) and the band density was analyzed with Quantity One software (Bio-Rad, USA).

RNA m6A dot blot assays

For m6A dot blot, 500 ng RNA sample was denatured at 95 °C for 5 min and transferred onto a Hybond-N+ membrane (GE Healthcare, Piscataway, NJ, USA). After UV crosslinking, the membrane was washed with TBST buffer, blocked with 5% non-fat milk, and incubated with anti-m6A antibody (AB151230, Abcam, diluted 1:1,000) overnight at 4 °C. Then, the membrane was incubated with secondary antibody at room temperature for 2 h. The signals were visualized by the chemiluminescence system (Bio-Rad, USA) and the dot density was analyzed with Quantity One software (Bio-Rad, USA), with staining of 0.02% methylene blue (in 0.3 mol/L sodium acetate, pH = 5.2) as loading control.

SELECT for detection of m6A

From the m6A-seq database obtained in a previous study on CORT-induced FLS chickens [17], sequences with m6A peaks were retrieved for lipogenic mRNAs including SREBP1, SCD and FASN, and subjected to specific m6A site analysis with SRAMP (http://www.cuilab.cn/sramp). One very high/high confidence m6A site was selected for each gene and verified by using a single-base elongation- and ligation-based qPCR amplification method (termed as “SELECT”). Briefly, 5 μg total RNA was incubated with 40 nmol/L Up Primer, 40 nmol/L Down Primer and 5 nmol/L dNTP in 17 μL 1× CutSmart buffer (50 mmol/L KAc, 20 mmol/L Tris-HAc, 10 mmol/L MgAc2, 100 μg/mL BSA) and annealed under the program as follows: 90 °C (1 min), 80 °C (1 min), 70 °C (1 min), 60 °C (1 min), 50 °C (1 min) and 40 °C (6 min). Next, 17 μL annealing products were incubated with a 3 μL of enzyme mixture containing 0.01 U Bst 2.0 DNA polymerase, 0.5 U SplintR ligase and 10 nmol ATP. The final 20 μL reaction mixture was incubated at 40 °C for 20 min, denatured at 80 °C for 20 min and kept at 4 °C. Quantitative PCR analysis was run under the following conditions: 95 °C, 5 min; (95 °C, 10 s; 60 °C, 45 s) for 40 cycles. The SELECT products of tested site were normalized to the RNA abundance of the mRNA transcript bearing this site. Primers used in SELECT assay are listed in the Table 3.
Table 3

Nucleotide sequences of SELECT method

TargetSequences (5’to 3′)
SREBF1 3’UTR X siteUp Probe: tagccagtaccgtagtgcgtgCCCATTGGTTTCGGAAAGAG
Down Probe: CCCCTTTGGTGGCACGACGGcagaggctgagtcgctgcat
SREBF1 3’UTR N siteUp Probe: tagccagtaccgtagtgcgtgCACGACGGGGTCCCGCTGGA
Down Probe: CGGCGAGAGGGTCCCACTCAcagaggctgagtcgctgcat
SCD 3’UTR X siteUp Probe: tagccagtaccgtagtgcgtgCTTGTGACTCCCATCTCCAG
Down Probe: CCGCATTTTCCGGGCCAAGAcagaggctgagtcgctgcat
SCD 3’UTR N siteUp Probe: tagccagtaccgtagtgcgtgTTTTCCGGGCCAAGATGACC
Down Probe: CCTTGGAGACCTTCTTGCGAcagaggctgagtcgctgcat
FASN 3’UTR X siteUp Probe: tagccagtaccgtagtgcgtgGTGCTCCAGGATTATCTCAG
Down Probe: TCTTCTTTCTTAATGTTATTcagaggctgagtcgctgcat
FASN 3’UTR N siteUp Probe: tagccagtaccgtagtgcgtgATGGCGATGAGAAGCCGTGC
Down Probe: CCAGGATTATCTCAGTTCTTcagaggctgagtcgctgcat
qPCRForward Prime: ATGCAGCGACTCAGCCTCTG
Reverse Prime: TAGCCAGTACCGTAGTGCGTG

Chromatin immunoprecipitation (ChIP) assay

ChIP was carried out as previously described [30]. Briefly, 200 mg frozen liver samples were ground in liquid nitrogen and washed with PBS containing protease inhibitor cocktail (Roche, Basel, Switzerland). After cross-linking in 1% formaldehyde, the reaction was stopped with 2.5 mol/L glycine. The pellets were lysed and chromatin was sonicated to an average length of ∼ 300 bp and the protein-DNA complex was diluted in ChIP dilution buffer, incubated with 2 μg of GR antibody (sc-1004, Santa Cruz, California, USA) overnight at 4 °C. A negative control was included with normal IgG or no antibody. Protein G agarose beads (sc-2003, Santa Cruz, California, USA) were added to capture the immunoprecipitated chromatin complexes. Reverse cross-linking was performed at 65 °C for 5 h to release DNA fragments from the immunoprecipitated complex and DNA was purified. The putative GREs in FTO, YTHDF1 and YTHDF2 promoters were predicted using JASPAR 2020 (http://jaspar.genereg.net) [31]. Immunoprecipitated DNA was used as a template for real-time PCR. The primers used to amplify the sequences covering these putative GREs are listed in Table 2. Nucleotide sequences of primers Nucleotide sequences of SELECT method

Statistical analysis

Differences between two groups were analyzed by t-test using SPSS 20.0 software (SPSS Inc., Chicago, IL, USA). Data are expressed as means ± SEM. Pearson correlation analysis was performed for correlation analysis. The differences were considered statistically significant when P < 0.05.

Results

Lipogenic genes are activated in the liver of chickens fed HELP diet

Chickens fed HELP diet had significantly higher hepatic lipid accumulation compared with their control counterparts, as seen in Oil Red O staining (Fig. 1A) and hepatic TG (Fig. 1B) content (P < 0.05). Meanwhile, plasma CORT concentration was significantly elevated (P < 0.05) in HELP group (Fig. 1C). Moreover, hepatic expression of lipogenesis genes, such as SREBP1, FASN and SCD were significantly up-regulated (P < 0.05) at both mRNA (Fig. 1D) and protein (Fig. 1E) levels.
Fig. 1

Lipogenic genes are activated in the liver of chickens fed HELP diet. A histological sections stained with oil-red, n = 3; B liver concentration of TG, n = 6; C the plasma corticosterone level, n = 6; D mRNA expression of SREBP1, FASN and SCD with qPCR, n = 6; E protein content of SREBP1 and SCD with western blot, n = 6. CON = Control; HELP = High-energy low-protein. Values are means ± SEM, *P < 0.05

Lipogenic genes are activated in the liver of chickens fed HELP diet. A histological sections stained with oil-red, n = 3; B liver concentration of TG, n = 6; C the plasma corticosterone level, n = 6; D mRNA expression of SREBP1, FASN and SCD with qPCR, n = 6; E protein content of SREBP1 and SCD with western blot, n = 6. CON = Control; HELP = High-energy low-protein. Values are means ± SEM, *P < 0.05

HELP diet increases hepatic GR expression and decreases global RNA m6A methylation

GR was significantly increased (P < 0.05), at both mRNA (Fig. 2A) and protein (Fig. 2B) levels, in the liver of chickens fed HELP diet. Meanwhile, HELP diet significantly decreased (P < 0.05) mRNA m6A levels (Fig. 2C) in the liver. Hepatic TG contents were negatively correlated to global m6A levels (r2 = − 0.7404, P < 0.01, Fig. 2D). No significant alterations were detected for the expression of RNA methyltransferases (METTL3 and METTL14) or the reader proteins (YTHDF1 and YTHDF3) (Figs. 2E, 3A-B, F-G), and no correlation found between hepatic TG contents and METTL3, METTL14, YTHDF1 and YTHDF3 protein content in liver (Fig. 3C-D, H, J). However, RNA demethylase FTO (Figs. 2E, 3A-B) was significantly increased (P < 0.05), and the reader protein YTHDF2 (Figs. 2E, 3F-G) was significantly decreased (P < 0.05) in the liver of chickens fed HELP diet. Moreover, hepatic TG contents are positively correlated to FTO protein content (r2 = 0.5916, P < 0.05, Fig. 3E) and negatively correlated to hepatic YTHDF2 protein content (r2 = − 0.856, P < 0.01, Fig. 3I) in FLS hens.
Fig. 2

HELP diet increases hepatic GR expression and decreases global RNA m6A methylation. A and B protein content and mRNA expression of GR with western blot and qPCR, n = 6; C global RNA m6A level in the liver was detected by dot-blot, n = 6; D correlation analysis was performed between TG concertation and m6A modification; E mRNA expression of the RNA methyltransferases METTL3 and METTL14, the m6A demethylase FTO, and the reader proteins YTHDF1 and YTHDF3 were detected with qPCR, n = 6. CON = Control; HELP = High-energy low-protein. Values are means ± SEM, *P < 0.05

Fig. 3

HELP diet increases hepatic FTO and YTHDF2 protein content. A and B protein content of METTL3, METTL14, and FTO in the liver were detected by western blot, n = 6; C-E correlation analysis was performed between TG concertation and METTL3, METTL14, FTO, n = 6; F and G protein content of YTHDF1, YTHDF2 and YTHDF3 in the liver were detected by western blot, n = 6; H-J correlation analysis was performed between TG concertation and YTHDF1–3, n = 6. CON = Control; HELP = High-energy low-protein. Values are means ± SEM, *P < 0.05

HELP diet increases hepatic GR expression and decreases global RNA m6A methylation. A and B protein content and mRNA expression of GR with western blot and qPCR, n = 6; C global RNA m6A level in the liver was detected by dot-blot, n = 6; D correlation analysis was performed between TG concertation and m6A modification; E mRNA expression of the RNA methyltransferases METTL3 and METTL14, the m6A demethylase FTO, and the reader proteins YTHDF1 and YTHDF3 were detected with qPCR, n = 6. CON = Control; HELP = High-energy low-protein. Values are means ± SEM, *P < 0.05 HELP diet increases hepatic FTO and YTHDF2 protein content. A and B protein content of METTL3, METTL14, and FTO in the liver were detected by western blot, n = 6; C-E correlation analysis was performed between TG concertation and METTL3, METTL14, FTO, n = 6; F and G protein content of YTHDF1, YTHDF2 and YTHDF3 in the liver were detected by western blot, n = 6; H-J correlation analysis was performed between TG concertation and YTHDF1–3, n = 6. CON = Control; HELP = High-energy low-protein. Values are means ± SEM, *P < 0.05

Levels of m6A on specific sites of lipogenic mRNAs are decreased in the liver of HELP diet-fed chickens

Specific m6A sites on 3’UTR of SREBP1, SCD and FASN mRNAs were selected for site-specific m6A quantification by SELECT method. Cycle threshold numbers were significantly increased (P < 0.05) at potential m6A site (X site, Fig. 4A, C and E), but not at the negative control site (N site, Fig. 3B, D and F), indicating decreased m6A modification on specific site of lipogenic mRNA 3’UTRs in the liver of HELP diet-fed chickens.
Fig. 4

3’UTR of lipogenic mRNAs is m6A hypermethylated in the liver of HELP diet-fed chickens. A and B detection of m6A modification in SREBP1 3’UTR using SELECT, n = 6. X site was predicted by SRAMP and N site (non-modification site) was negative control. C and D detection of m6A modification in SCD 3’UTR using SELECT, n = 6. X site was predicted by SRAMP and N site (non-modification site) was negative control. E and F detection of m6A modification in FASN 3’UTR using SELECT, n = 6. X site was predicted by SRAMP and N site (non-modification site) was negative control. CON = Control; HELP = High-energy low-protein. Values are means ± SEM, *P < 0.05

3’UTR of lipogenic mRNAs is m6A hypermethylated in the liver of HELP diet-fed chickens. A and B detection of m6A modification in SREBP1 3’UTR using SELECT, n = 6. X site was predicted by SRAMP and N site (non-modification site) was negative control. C and D detection of m6A modification in SCD 3’UTR using SELECT, n = 6. X site was predicted by SRAMP and N site (non-modification site) was negative control. E and F detection of m6A modification in FASN 3’UTR using SELECT, n = 6. X site was predicted by SRAMP and N site (non-modification site) was negative control. CON = Control; HELP = High-energy low-protein. Values are means ± SEM, *P < 0.05

GR binding to the promoter of FTO and YTHDF2 genes is modulated in the liver of HELP diet-fed chickens

ChIP-PCR analysis revealed changes of GR binding on the promoter of FTO and YTHDF2 genes. Fragments containing putative GREs on the promoter of FTO (Fig. 5A), YTHDF2 (Fig. 5B) and YTHDF1 (Fig. 5C) were amplified after chromatin immunoprecipitation with GR antibody. GR binding to the fragment of FTO gene promoter (Fig. 5A) was significantly increased (P < 0.05), while that to the fragment 1 of YTHDF2 gene promoter (Fig. 5B) was significantly decreased (P < 0.05), in the liver of HELP diet-fed chickens. In contrast, GR binding to the fragment 2 of YTHDF2 or YTHDF1 gene promoter was not affected.
Fig. 5

GR binding to the promoter of FTO and YTHDF2 genes is modulated in the liver of HELP diet-fed chickens. A schematic representation of GR transcription factor binding promoter of FTO (up) and ChIP-PCR assay was used to measure the binding of GR on FTO promoter in the liver of HELP diet-fed chickens (down, n = 3). B schematic representation of GR transcription factor binding promoter of YTHDF2 (up) and ChIP-PCR assay was used to measure the binding of GR on YTHDF2 promoter in the liver (down, n = 3). C schematic representation of GR transcription factor binding promoter of YTHDF1 (up) and ChIP-PCR assay was used to measure the binding of GR on YTHDF1 promoter in the liver (down, n = 3). CON = Control; HELP = High-energy low-protein. Values are means ± SEM, *P < 0.05

GR binding to the promoter of FTO and YTHDF2 genes is modulated in the liver of HELP diet-fed chickens. A schematic representation of GR transcription factor binding promoter of FTO (up) and ChIP-PCR assay was used to measure the binding of GR on FTO promoter in the liver of HELP diet-fed chickens (down, n = 3). B schematic representation of GR transcription factor binding promoter of YTHDF2 (up) and ChIP-PCR assay was used to measure the binding of GR on YTHDF2 promoter in the liver (down, n = 3). C schematic representation of GR transcription factor binding promoter of YTHDF1 (up) and ChIP-PCR assay was used to measure the binding of GR on YTHDF1 promoter in the liver (down, n = 3). CON = Control; HELP = High-energy low-protein. Values are means ± SEM, *P < 0.05

Discussion

Accumulating evidences indicate that FTO-dependent RNA demethylation and nonalcoholic fatty liver disease are closely intertwined [32, 33]. FTO-dependent demethylation of m6A leads to an increase in lipogenic expression in hepatocytes through m6A modification [34, 35]. Previously, we used chronic administration of corticosterone (CORT) to establish an in vivo FLS model in the juvenile chickens, and to induce excessive lipid accumulation in primary chicken hepatocytes in vitro with combined treatment of oleic acid and dexamethasone (OA/DEX) [17]. In both in vivo and in vitro models, we found that GR-mediated transactivation of FTO and m6A demethylation contribute to lipogenic gene activation. Interestingly, HELP diet-induced FLS is also associated with global m6A demethylation and the activation of lipogenic genes in the liver of laying hens. It may not be totally unexpected, because all these fatty liver models, no matter how they are induced, share the same hormonal and biochemical status of elevated CORT and lipid concentration in the blood. The major mechanism by which m6A exerts its effects is recruiting m6A-binding proteins [36]. m6A can be recognized by proteins that contain a YTH (YT521B homology) domain [37] or alternatively by eukaryotic initiation factor 3 (eIF3) [38, 39]. The functions of m6A-binding proteins are context-dependent, which means that different m6A-binding proteins bind m6A on different regions of mRNA to exert different functions in gene regulation [40]. Among three m6A-binding proteins determined in the present study, YTHDF2 was down-regulated at both mRNA and protein levels, indicating YTHDF2-mediated gene regulation. YTHDF2 binds transcripts carrying m6A in 3’UTR to induce mRNA degradation partially through recruiting the CCR4-NOT deadenylase complex [41]. YTHDF2 was reported to selectively recognize m6A sites in FASN mRNA, leading to increased FASN mRNA decay and decreased FASN protein content in HepG2 cell lines [42]. Previously, we conducted a m6A-seq analysis to elaborate the epitranscriptomic modification of m6A in the liver of CORT-induced FLS chickens [17]. From this published database, we selected some CORT-responsive m6A peaks in 3’UTR of the lipogenic transcripts, and identified specific HELP-responsive m6A sites on 3’UTR of lipogenic mRNAs, including SREBP1, SCD and FASN, with SELECT analysis. It is possible that the down-regulation of YTHDF2 impairs m6A-dependent lipogenic mRNA degradation, which leads to augmented lipogenesis and excessive lipid accumulation in the liver of FLS hens. The molecular mechanism by which HELP-diet induces hepatic up-regulation of YTHDF2 in the chicken is unknown. YTHDF2 is negatively regulated by miR-145/miR-495/miR-493-3p at post-transcriptional level in hepatocellular carcinoma cells and prostate cancer cells [43-45]. Moreover, YTHDF2 can be SUMOylated in vivo and in vitro at the site of K571, which significantly increases its binding affinity with m6A-modified mRNAs [46]. HIF-2α is reported to transrepress YTHDF2 in hepatocellular carcinoma cells [47]. Based on the observation that YTHDF2 is down-regulated at both mRNA and protein level, we come up with a hypothesis that GR may directly transactivate YTHDF2. Silicon analysis using JASPAR online database identifies 2 putative GR binding sites for YTHDF2. These binding sites were then functionally validated using ChIP-PCR. Indeed, GR binding to YTHDF2 gene promoter is decreased in the liver of hens fed HELP diet. It remains a mystery how GR binding to the promoter of FTO and YTHDF2 genes is distinctively regulated, leading to FTO up-regulation and YTHDF2 down-regulation in HELP diet-induced FLS. Some unidentified co-factors must come into play to coordinate the down-stream effectors of GR action. In this study, GR was upregulated at both mRNA and protein levels in the liver of hens fed HELP diet. The altered GR binding to the promoter of FTO and YTHDF2 genes indicate HELP diet-induced modulation in GR activation. GR can be activated via both ligand-dependent [48] and ligand-independent manners [49]. Previously, we reported CORT-dependent GR activation in the liver of CORT-treated chickens [16, 50]. In this study, chickens are not treated with CORT and the plasma CORT level was not determined. Therefore, we cannot draw a conclusion whether the altered GR expression and binding is dependent on CORT. Nevertheless, GR can be activated by cellular stressors through p38 MAPK-mediated phosphorylation of Ser134, which is a hormone-independent phosphorylation site on the human GR [51]. GR can also be activated by various stimuli in the absence of glucocorticoid ligands, such as elevated temperature, excessive inflammation, and cancer [52-54]. Therefore, both ligand-dependent and ligand-independent pathways are possible in HELP diet-induced alteration in hepatic GR activation.

Conclusions

The present results have shown that GR-mediated transcriptional regulation of FTO and YTHDF2 contributes to lipogenic gene activation by site-specific demethylation in HELP diet-induced chicken FLS. These findings add YTHDF2-mediated m6A modification as a new component of GR signaling in the regulation of fat metabolism in the liver and shed new light on developing effective therapeutic strategies in the prevention and treatment of HELP diet-induced chicken FLS.
  54 in total

1.  Causes of disease in two commercial flocks of laying hens.

Authors:  T M Grimes
Journal:  Aust Vet J       Date:  1975-07       Impact factor: 1.281

2.  MicroRNA-145 Modulates N6-Methyladenosine Levels by Targeting the 3'-Untranslated mRNA Region of the N6-Methyladenosine Binding YTH Domain Family 2 Protein.

Authors:  Zhe Yang; Jiong Li; Guoxing Feng; Shan Gao; Yuan Wang; Shuqin Zhang; Yunxia Liu; Lihong Ye; Yueguo Li; Xiaodong Zhang
Journal:  J Biol Chem       Date:  2017-01-19       Impact factor: 5.157

3.  The unliganded glucocorticoid receptor positively regulates the tumor suppressor gene BRCA1 through GABP beta.

Authors:  Heather D Ritter; Lilia Antonova; Christopher R Mueller
Journal:  Mol Cancer Res       Date:  2012-02-10       Impact factor: 5.852

4.  Fatty liver hemorrhagic syndrome in the backyard chicken: a retrospective histopathologic case series.

Authors:  K A Trott; F Giannitti; G Rimoldi; A Hill; L Woods; B Barr; M Anderson; A Mete
Journal:  Vet Pathol       Date:  2013-10-03       Impact factor: 2.221

5.  Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase.

Authors:  Xiao-Li Ping; Bao-Fa Sun; Lu Wang; Wen Xiao; Xin Yang; Wen-Jia Wang; Samir Adhikari; Yue Shi; Ying Lv; Yu-Sheng Chen; Xu Zhao; Ang Li; Ying Yang; Ujwal Dahal; Xiao-Min Lou; Xi Liu; Jun Huang; Wei-Ping Yuan; Xiao-Fan Zhu; Tao Cheng; Yong-Liang Zhao; Xinquan Wang; Jannie M Rendtlew Danielsen; Feng Liu; Yun-Gui Yang
Journal:  Cell Res       Date:  2014-01-10       Impact factor: 25.617

6.  Downregulation of N6-methyladenosine binding YTHDF2 protein mediated by miR-493-3p suppresses prostate cancer by elevating N6-methyladenosine levels.

Authors:  Jiangfeng Li; Shuai Meng; Mingjie Xu; Song Wang; Liujia He; Xin Xu; Xiao Wang; Liping Xie
Journal:  Oncotarget       Date:  2017-12-18

7.  JASPAR 2020: update of the open-access database of transcription factor binding profiles.

Authors:  Oriol Fornes; Jaime A Castro-Mondragon; Aziz Khan; Robin van der Lee; Xi Zhang; Phillip A Richmond; Bhavi P Modi; Solenne Correard; Marius Gheorghe; Damir Baranašić; Walter Santana-Garcia; Ge Tan; Jeanne Chèneby; Benoit Ballester; François Parcy; Albin Sandelin; Boris Lenhard; Wyeth W Wasserman; Anthony Mathelier
Journal:  Nucleic Acids Res       Date:  2020-01-08       Impact factor: 16.971

Review 8.  Molecular Mechanisms of Glucocorticoid-Induced Insulin Resistance.

Authors:  Carine Beaupere; Alexandrine Liboz; Bruno Fève; Bertrand Blondeau; Ghislaine Guillemain
Journal:  Int J Mol Sci       Date:  2021-01-09       Impact factor: 5.923

9.  SUMOylation of YTHDF2 promotes mRNA degradation and cancer progression by increasing its binding affinity with m6A-modified mRNAs.

Authors:  Guofang Hou; Xian Zhao; Lian Li; Qianqian Yang; Xiaojia Liu; Caihu Huang; Runhui Lu; Ran Chen; Yanli Wang; Bin Jiang; Jianxiu Yu
Journal:  Nucleic Acids Res       Date:  2021-03-18       Impact factor: 16.971

10.  Activation of the KDM5A/miRNA-495/YTHDF2/m6A-MOB3B axis facilitates prostate cancer progression.

Authors:  Chen Du; Caihong Lv; Yue Feng; Siwen Yu
Journal:  J Exp Clin Cancer Res       Date:  2020-10-21
View more
  1 in total

1.  Glucocorticoid Regulates the Synthesis of Porcine Muscle Protein through m6A Modified Amino Acid Transporter SLC7A7.

Authors:  Wei-Jing Xu; Kai Guo; Jia-Li Shi; Chang-Tong Guo; Jia-Le Xu; Rong Zheng; Si-Wen Jiang; Jin Chai
Journal:  Int J Mol Sci       Date:  2022-01-10       Impact factor: 5.923

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.