Xiaolong Li1, Yujie Wen1, Liyuan Sheng2, Rui Guo3, Yanli Zhang4, Longquan Shao4. 1. Foshan Stomatological Hospital, School of Medicine, Foshan University, Foshan, PR China. 2. Shenzhen Institute, Peking University, Shenzhen, China. 3. Department of Biomedical Engineering, Jinan University, Guangzhou, China. 4. Stomatological Hospital, Southern Medical University, Guangzhou, China.
Abstract
Angiogenesis plays an important role in tissue development and repair, and how to regulate angiogenesis effectively is a widely studied problem in the biomedical field. In recent years, the role of autophagy in vascular endothelial cells has attracted extensive attention. Icariin (ICA) is a traditional Chinese medicine that has been proven to have outstanding protective effects on the vascular system and to regulate cellular autophagy effectively. However, at present, it has not been reported whether ICA can affect the angiogenic ability of endothelial cells by affecting autophagy. In this study, we aimed to investigate whether ICA affects the angiogenesis capacity of EA.hy926 human vascular endothelial cells through autophagy and explain the underlying potential mechanisms. First, we determined that ICA at appropriate concentrations has the ability to promote cell migration and angiogenesis using wound healing assays and tube formation assays. Then, at the molecular level, we observed the upregulation of VEGFA, VEGFR2, ANGI, ANGII, and Tie2 mRNA and detected the upregulation of TGFβ1 protein by Western blotting. We also demonstrated that angiogenic concentrations of ICA can effectively activate autophagy. The autophagy inhibitor 3-MA significantly suppressed TGFβ1 expression and tube formation in EA.hy926 cells. Overall, we hope that our studies might help to further understand the effect of ICA on vascular endothelial cells and provide a theoretical basis for future angiogenic applications of ICA.
Angiogenesis plays an important role in tissue development and repair, and how to regulate angiogenesis effectively is a widely studied problem in the biomedical field. In recent years, the role of autophagy in vascular endothelial cells has attracted extensive attention. Icariin (ICA) is a traditional Chinese medicine that has been proven to have outstanding protective effects on the vascular system and to regulate cellular autophagy effectively. However, at present, it has not been reported whether ICA can affect the angiogenic ability of endothelial cells by affecting autophagy. In this study, we aimed to investigate whether ICA affects the angiogenesis capacity of EA.hy926 human vascular endothelial cells through autophagy and explain the underlying potential mechanisms. First, we determined that ICA at appropriate concentrations has the ability to promote cell migration and angiogenesis using wound healing assays and tube formation assays. Then, at the molecular level, we observed the upregulation of VEGFA, VEGFR2, ANGI, ANGII, and Tie2 mRNA and detected the upregulation of TGFβ1 protein by Western blotting. We also demonstrated that angiogenic concentrations of ICA can effectively activate autophagy. The autophagy inhibitor 3-MA significantly suppressed TGFβ1 expression and tube formation in EA.hy926 cells. Overall, we hope that our studies might help to further understand the effect of ICA on vascular endothelial cells and provide a theoretical basis for future angiogenic applications of ICA.
Icariin (ICA) is a natural flavonoid herb extracted from the traditional Chinese medicine Epimedium (Figure 1(a)). Flavonoids have attracted much attention because of their natural low toxicity and extensive pharmacological activities. ICA has also been reported to have good potential in regulating cardiovascular and cerebrovascular blood flow and promoting hematopoiesis, immunity, and bone metabolism [1]. It has a significant protective effect on the vascular endothelium under conditions associated with oxidative stress, such as atherosclerosis [2]. And perform protective effect on endothelial cells against cytotoxic effect of drugs like Methotrexate [3] However, at present, research on the angiogenic effect of ICA is in the preliminary stage, and some studies even conflict with each other [4]. The exact effects of ICA on endothelial angiogenesis and the detailed underlying mechanisms require further study.
Figure 1.
(a) Chemical structure of ICA; (b) Cell viability of EA.hy926 after treatment of 2.5, 5 and 10 μM of ICA for 6, 24 and 48 h
(a) Chemical structure of ICA; (b) Cell viability of EA.hy926 after treatment of 2.5, 5 and 10 μM of ICA for 6, 24 and 48 hAutophagy plays an important role in cell metabolism. Not only does it control organelle renewal but it also mediates the ingestion and digestion of macromolecules, providing intermediate metabolites necessary for catabolism and anabolism. A lack of autophagy may lead to adverse cellular outcomes, such as apoptosis [5]. The function of vascular endothelial cells also requires autophagy [6]. Studies have shown that autophagy can promote angiogenesis of endothelial cells. Increased autophagy levels have been found in cancer vessels and ocular fundus neovascularization. Enhanced autophagy in tumor tissues can promote endothelial cell migration and proliferation, accelerating tumor metastasis [7]. In tissue engineering studies, activation of autophagy was also observed in newly formed vessels and bone [8,9]. AMPK-mediated stress responses can trigger autophagy to promote VEGF-mediated angiogenesis [10], and in another study, autophagy inhibition impaired the Notch intracellular domain [11], suggesting that autophagy can regulate important signaling pathways associated with angiogenesis.It has been reported that ICA can regulate cell autophagy to participate in cellular processes. There is evidence illustrating that ICA can alleviate overactivation of autophagy under pathological conditions such as cancer [12] and osteoarthritis [13]. On the other hand, ICA can also promote osteogenic differentiation of bone marrow stromal cells by activating autophagy, thus preventing bone loss in OVX mice [14]. It can also improve brain function decline in aging rats by triggering the AMPK/mTOR/ULK1 pathway to enhance neuronal autophagy [15]. This different effect of ICA on autophagy may be due to the differences in drug concentration and/or heterogeneity of the target tissues. However, we can still conclude that ICA can effectively affect autophagy, which might further regulate cellular functions. However, how ICA regulates autophagy in vascular endothelial cells and affects angiogenesis remains unclear.In this study, we aimed to assess the angiogenic effect of icariin on vascular endothelial cells and explain the underlying mechanisms. Promoted angiogenesis and autophagy activation were observed in endothelial cells after icariin treatment. The angiogenesis-related growth factor TGFβ1 was significantly decreased when autophagy was inhibited. Therefore, our speculation is that ICA can promote angiogenesis through autophagy activation-induced TGFβ1 increase. We hope our work can provide a reference for the therapeutic study of icariin and facilitate future studies of proangiogenic traditional Chinese medicines.
Materials and methods
Cell culture and treatment
Human vascular endothelial cells, EA.hy926, purchased from the Chinese Academy of Sciences Cell Bank, were cultured in endothelial growth medium-2 (EGM-2; Lonza) containing 10% fetal bovine serum in a 5% CO2 humidified incubator with. Passages were performed when the density of cells reached approximately 90%. To examine the impact and mechanisms of ICA in EA.hy926 cells, the cells were treated with ICA (different concentrations according to the experimental design) when the density reached 80%. The autophagy inhibitor 3-MA (10 μM, MCE, HY-19312) was added to the 3-MA+ICA group 2 h in advance.
Cell proliferation and viability
EA.hy926 cells were seeded into 96-well plates and incubated at 37°C for 24 h. Cell viability was tested using MTT at 6 h, 24 h, and 48 h after treatment with 1, 2.5, 5, 10, 50, and 100 μM ICA. For the test, EA.hy926 cells were cultured with fetal bovine serum-free culture medium and diluted MTT for 4 h, the supernatant was replaced by DMSO, and then the plate was shaken for 10 min. The absorbance (OD) at 492 nm was measured by an enzyme-linked immunoassay. All experiments had six replicates, and three independent experiments were conducted.
Migration assay
The effect of ICA on EA.hy926 cell migration was evaluated with wound healing assays. A total of 2.5 × 105 cells were cultured in 12-well plates after 24 h until they were fully confluent. Then, a 200 μL pipette tip was used to create scratches on the cell layers, and the fluid was replaced with serum-free culture medium with ICA and/or 3-MA. The recovered area of the scratches was evaluated after 0, 6, 12, 24 and 36 h.
Tube formation assay
EA.hy926 cells were seeded into 6-well plates at 4 × 105 cells per well for 24 h. ICA and/or 3-MA were added to each well for 24 h pretreatment. The 96-well plates were coated with 100 μL of BD Matrigel and cultured at 37°C incubator for 30 min, as described in the product instructions. The pretreated EA.hy926 cells (3 × 104 cells/well) were resuspended in serum-free culture medium and then plated onto the congealed gel. Photographs were taken at 0, 6 and 24 h using an inverted-phase contrast microscope. Tube-like structures were analyzed with ImageJ software and Angiogenesis Analyze plugin [16].
Western blot analysis
After exposure to different concentrations of ICA (2.5, 5 and 10 μM) for 0, 1, 3, 6, 12 and 24 h, RIPA lysis buffer was used to extract total protein from EA.hy926 cells and the concentration was measured by the BCA kit. 10 μg of each protein samples were separated by SDS‐PAGE and transferred to PVDF membrane. After blocking with blocking buffer for 30 min, the membranes were incubated with antibodies overnight at 4°C. Incubation with their corresponding secondary antibodies was performed. The bands quantitative analysis was conducted using ImageJ software. GAPDH was chosen as internal standard.
Quantitative polymerase chain reaction
Total RNA isolation kit (Vazyme, RC112-01) was used to obtain RNA, and cDNA was reverse transcript with 1 μg RNA (Vazyme, R333-01). The SYBR green system (Accurate Biology, AG11701) was used to conduct qPCR. Amplification of cDNA samples at 95°C for 1 min and 40 cycles of 5 s at 95°C and 30 s at 60°C. Table 1 shows the primers we used. The results were normalized as GAPDH and calculated by 2−ΔΔCT.
Table 1.
The primer sequences used for quantitative real-time PCR
Gene
Forward primer sequence (5ʹ-3ʹ)
Reverse primer sequence (5ʹ-3ʹ)
VEGFA
CTTCTGGGCTGTTCTCGCTTCG
CTCCTCTTCCTTCTCTTCTTCCTCCTC
VEGFR2
CTGGCTACTTCTTGTCATCATCCTACG
TGGCATCATAAGGCAGTCGTTCAC
ANGI
CGCTGCCATTCTGACTCACATAGG
CGTACTCTCACGACAGTTGCCATC
ANGII
CAGAACCAGACGGCTGTGATGATAG
AGTGTTCCAAGAGCTGAAGTTCAAGTC
Tie2
TGCTTGGACCCTTAGTGACATTCTTC
TCTTGCCTTGAACCTTGTAACGGATAG
GAPDH
AATGGGCAGCCGTTAGGAAA
GCGCCCAATACGACCAAATC
The primer sequences used for quantitative real-time PCR
Immunofluorescence
EA.hy926 cells (2 × 104/well) were seeded onto round coverslips before being placed into 24-well plates. After 24 h, ICA (10 μM) and/or 3-MA was added to the well for 6 h. Then, the cells were fixed at 4°C overnight using 4% paraformaldehyde. After being treated with 0.1% Triton X-100 for 10 min, the cells were then blocked with 5% BSA (Solarbio, SW3015) at 37°C for 1 h. Then, a rabbit antibody against LC3B (Abcam, ab48394) was incubated with the cells at 4°C overnight. For the following day, the coverslips were washed with PBS three times for 10 min each time, and then goat anti-rabbit antibody was employed to immerse them for 1 h at 37°C. Subsequently, DAPI was used to stain the slips for 5 min. The results were photographed and analyzed with an automatic fluorescence microscope (OLYMPUS BX63).
Statistical analysis
All numerical data are presented as the mean and standard deviation. Comparisons between two groups were conducted by independent samples t‐tests. One-way ANOVA was used to analyze differences among more than 2 groups. All statistical analyses were performed using SPSS 20.0 software. Statistical significance was established at *0.01 ≤ P < 0.05, 0.001 ≤ P < 0.01 and P < 0.001.
Results
As a traditional Chinese medicine, ICA has vascular protection effects. In this paper, we verified its angiogenesis and explored the underlying mechanisms. We hypothesized that ICA promotes angiogenesis by activating autophagy to trigger an increase in TGFβ1 levels. To assess the angiogenesis promoting effect of ICA, we firstly selected the appropriate concentration of ICA through MTT assays for the following study. 2.5, 5 and 10 μM of ICA showed significant promoting effect on cell migration. Tube formation assays indicated that EA.hy926 angiogenetic capacity was promoted in 5 and 10 μM group. The expression of typical angiogenic genes was detected by qPCR, and the results suggested the up-regulation of these indicators in ICA-treated groups. Then, activated autophagy was observed in ICA-exposed EA.hy926 cells. After using of autophagy inhibitor 3-MA, the decrease of TGFβ1 and inhibited angiogenesis were observed.
Effect of icariin on EA.hy926 cell viability
According to recent studies and our MTT results (Figure 1(b)), 2.5, 5 and 10 μM ICA presented no toxicity to EA.hy926 cells at 6, 24 and 48 h after treatment. ICA (2.5 μM) slightly increased cell viability after 48 h of treatment. Cell viability in the 50 and 100 μM groups significantly decreased. Therefore, 2.5, 5 and 10 μM ICA concentration were chosen to treat EA.hy926 cells for subsequent studies.
Icariin promotes EA.hy926 cell migratin
To test the effect of ICA on EA.hy926 cell migration ability, in vitro wound healing assays was then performed (Figure 2). After the scratches were created for 12 h, we observed that the closure areas of the ICA groups were all larger than those of the control groups. At 24 h, the closure area of all the ICA-treated groups was above 40% (P < 0.001), while that of the control group was significantly lower (18.26%). At 36 h, the recovered area of the untreated groups was 33.49%, while in groups 2.5 and 5 μM, the areas reached 78.78% and 79.17%, respectively. In addition, the recovered area of the 10 μM group was even higher than those of the two lower concentration groups and reached 83.55% (P < 0.001). The results of wound healing assays indicated that ICA promoted the wound recovery of EA.hy926 cells. These results indicated that ICA can markedly promote EA.hy926 cell migration.
Figure 2.
Effects of ICA on EA.hy926 migration. (a)After treatment with 2.5, 5 and 10 μM of ICA for 12, 24 and 36 h, the migration ability was determined by the wound healing assays. The wound closure area was measured and (b)quantified
Effects of ICA on EA.hy926 migration. (a)After treatment with 2.5, 5 and 10 μM of ICA for 12, 24 and 36 h, the migration ability was determined by the wound healing assays. The wound closure area was measured and (b)quantified
Icariin promote tube formation by EA.hy926 cells
In subsequent research, we used tube formation assays to determine whether ICA affects the angiogenesis capacity of EA.hy926 cells. We investigated whether EA.hy926 cells were pretreated with different concentrations of ICA (2.5, 5 and 10 μM) for 24 h, and then the cells were collected and seeded onto Matrigel. After 24 h, the tubular networks in the 5 and 10 μM groups were significantly larger than those in the control groups (Figure 3(a)). The meshes, branching point and tube length were markedly higher in these two groups (Figure 3(b-e)), suggesting that pretreatment with 5 and 10 μM ICA significantly promoted the angiogenesis capacity of EA.hy926 cells.
Figure 3.
Effects of ICA on promoting angiogenesis of EA.hy926. (a)After treated by 2.5, 5 and 10 μM of ICA, the angiogenetic ability was detected by tube formation assays at 24 h. (b) Node number, (c)master segments length (d)meshed area and (e) Tube length were measured in each group. The expression levels of VEGFA, VEGFR2, ANGI, ANGII and Tie2 of group (f)2.5 μM, (g)5 μM and (h)10 μM were determined by qPCR
Effects of ICA on promoting angiogenesis of EA.hy926. (a)After treated by 2.5, 5 and 10 μM of ICA, the angiogenetic ability was detected by tube formation assays at 24 h. (b) Node number, (c)master segments length (d)meshed area and (e) Tube length were measured in each group. The expression levels of VEGFA, VEGFR2, ANGI, ANGII and Tie2 of group (f)2.5 μM, (g)5 μM and (h)10 μM were determined by qPCR
After observing the morphologic angiogenic effect, we sought evidence of angiogenesis at the molecular level. As shown in (Figure 3(g)), the mRNA expression levels of VEGFA and VEGFR2 were significantly increased by 10 μM ICA after 6 h. The ANGI level also rose at 6, 12 and 24 h. ANGII expression seemed to be more sensitive and increased after 3 h but was restored to the untreated level at 24 h. However, the level of the ANGI/ANGII receptor Tie 2 did not change significantly. The upregulation of angiogenic genes was also observed in the 2.5 μM and 5 μM groups but was not as significant as that in the 10 μM group (Figure 3(f-g)). Followingly, we detected the changes of VEGFA, VEGFR2 and ANG at the protein level. As shown in (Figure 4), the protein expression of VEGFA in 2.5 μM group increased in 1 h, 3 h and 6 h after treatment. In 5 μM and 10 μM group, the increase lasted for 12 and 24 h. What’s more, the p-VEGFR2/VEGFR2 ratio was also enhanced after 5 and 10 μM ICA treatment. Similarly, VEGFR2 and ANG protein level rose at 6, 12 and 24 h in both 5 and 10 μM ICA exposure group and 6 h in 2.5 μM group. The above results indicated that ICA can trigger increases in VEGFA/VEGFR2, and ANG expression in EA.hy926 cells, suggesting ICA can significantly promote angiogenesis-related markers expression.
Figure 4.
ICA promotes protein expression of angiogenetic indicators. The relative protein expression level of ANG, VEGFA, VEGFR2 and p-VEGFR2/VEGFR2 of group (a)2.5 μM, (b)5 μM and (c)10 μM were measured by Western blotting and quantitation
ICA promotes protein expression of angiogenetic indicators. The relative protein expression level of ANG, VEGFA, VEGFR2 and p-VEGFR2/VEGFR2 of group (a)2.5 μM, (b)5 μM and (c)10 μM were measured by Western blotting and quantitation
Icariin activates autophagy in EA.hy926 cells
The potential mechanism underlying the observed angiogenic effect of ICA was then explored by examining the activation of autophagy. After treating EA.hy926 cells with ICA for different times, Western blotting showed that 2.5 μM ICA had no significant effect on the p62 level but could induce LC3BII expression after 3 h (P < 0.001). Beclin levels in the 2.5 μM group also increased at 24 h (P < 0.01)(Figure 5(a)). For cells treated with 5 μM ICA (Figure 5(b)), p62 expression was slightly increased at 1, 3 and 6 h, but then returned to the level of the control group at 12 and 24 h. The level of LC3BII in the 5 μM group increased at all the tested timepoints, and the level of Beclin was increased at 1 h. As shown in Figure 5c, 10 μM ICA triggered the upregulation of LC3BII and Beclin at all 5 time points (P < 0.01). The expression level of p62 increased after 6 h of treatment, and this change lasted for 24 h. We selected a concentration of 10 μM ICA for further studies. After exposure to 10 μM ICA for 6 h, immunofluorescence also indicated that the level of LC3 B II was increased (Figure 6). The above evidence suggests that ICA can activate autophagy in EA.hy926 cells.
Figure 5.
ICA activate autophagy in EA.hy926 cells. The relative expression levels of LC3B, Beclin and p62 of group (a)2.5 μM, (b)5 μM and (c)10 μM were measured by Western blotting and quantitation
Figure 6.
ICA induce LC3B expression in EA.hy926 cells. After treated by 2.5, 5 and 10 μM of ICA for 6 h, the level of LC3B was detected by immunofluorescence
ICA activate autophagy in EA.hy926 cells. The relative expression levels of LC3B, Beclin and p62 of group (a)2.5 μM, (b)5 μM and (c)10 μM were measured by Western blotting and quantitationICA induce LC3B expression in EA.hy926 cells. After treated by 2.5, 5 and 10 μM of ICA for 6 h, the level of LC3B was detected by immunofluorescence
Autophagy regulates icariin-induced tube formation via TGFβ1
In subsequent studies, we aimed to explore the connection between autophagy activation and angiogenesis promoted by ICA. The expression of angiogenesis-related growth factor TGFβ1 was detected using Western blot analysis. Relative to that in the control group, the TGFβ1 level was remarkably increased in the 10 μM ICA group at all examined time points, especially at 3 and 6 h (P < 0.001)(Figure 7(a)).
Figure 7.
ICA induce TGFβ1 up-regulation through autophagy activation. (a)After treatment with 10 μM of ICA for 1, 3, 6, 12 and 24 h, TGFβ1 level was determined using Western blotting and quantitation. (b)After co-incubation with autophagy inhibitor 3-MA for 6 h, the expression of LC3, Beclin, p62 and TGFβ1 were measured by Western blotting and quantitation
ICA induce TGFβ1 up-regulation through autophagy activation. (a)After treatment with 10 μM of ICA for 1, 3, 6, 12 and 24 h, TGFβ1 level was determined using Western blotting and quantitation. (b)After co-incubation with autophagy inhibitor 3-MA for 6 h, the expression of LC3, Beclin, p62 and TGFβ1 were measured by Western blotting and quantitationThe autophagy inhibitor 3-MA was then applied to ICA-treated EA.hy926 cells. The results of Western blot showed that the LC3BII and Beclin levels of the 3-MA group were reduced, suggesting that our autophagy intervention was effective. As shown in Figure 7b, the TGFβ1 level in the 3-MA group was suppressed compared to that in the control group (P < 0.01). Relative to those in the 3-MA group, LC3BII, Beclin, p62 and TGFβ1 levels were all higher in the 3 MA+ICA group. These results indicate that ICA can alleviate 3-MA-induced autophagy inhibition and TGFβ1 downregulation. Next, we explored the effect of autophagy inhibition on EA.hy926 cell migration and tube formation ability. In wound healing assays, we found that at 24 h after the scratches were created, the wound closure area in the 3-MA+ICA group was 21.13%, which was larger than that in the 3-MA(5.37%) group. When it reached 36 h, the average wound closure area in the 3-MA group (11.27%) was significantly smaller than that in the control group (30.03%), suggesting that the inhibition of autophagy would suppress the migration of EA.hy926 cells. However, the closure area of the 3-MA+ICA group (26.25%) was larger than that of the 3-MA group, which indicated that the ICA treatment alleviated 3-MA induced migration inhibition (Figure 8a(c)). In tube formation assays, similar results were observed. The tube networks in the 3-MA-treated group were visibly smaller than those in the control group (Figure 8(b)). In the 3-MA+ICA group, the mean master segment length(714.67), branching point (31.00), meshes area (17,993.33) and tube length(87,801.33) were all significantly higher than those in 3-MA group (master segment length: 288.67, node number: 21.67, meshes area: 5536.67; tube length: 65,970.67) (Figure 8(d-g)). The tube formation assays suggested that the application of 10 μM ICA alleviated the 3-MA induced angiogenetic inhibition.
Figure 8.
Autophagy inhibitor obstructed ICA-treated EA.hy926 migration and tube formation. EA.hy926 cells were treated by 10 μM and/or 3-MA, the cell migration was measured by (a)wound healing assays and (c)quantified. Angiogenetic ability was detected using (b)tube formation assays and (d) master segments length, (e)node number (f)meshed area and (g) tube length were quantified
Autophagy inhibitor obstructed ICA-treated EA.hy926 migration and tube formation. EA.hy926 cells were treated by 10 μM and/or 3-MA, the cell migration was measured by (a)wound healing assays and (c)quantified. Angiogenetic ability was detected using (b)tube formation assays and (d) master segments length, (e)node number (f)meshed area and (g) tube length were quantified
Discussion
Angiogenesis is a vital process for development, reproduction, and tissue repair. Endothelial cells (ECs) play the most important role in angiogenesis through their involvement in the expansion of the existing vascular network through a series of germination, migration, proliferation, vascular anastomosis, and pruning processes [17]. Therefore, promoting angiogenesis is a hotspot in bioengineering studies, such as studies of wound healing and osteogenesis, and ECs are the most important target cells [18]. In traditional Chinese medicine (TCM) theory, many herbs or herbal compounds are believed to have the capacity to promote ‘invigorating pulses’ and ‘nourishing blood’ [19]. An increasing number of studies have proven the angiogenesis-promoting effect of these TCMs on ECs with morphological or molecular evidence [19]. Flavonoids are naturally sourced substances. They are polyphenols that have a variety of biological activities and have curative and pharmacological effects on the cardiovascular system [20-22]. Belonging to the flavonoid family, epimedium has been used as medicine for more than 2,000 years and is believed to strengthen muscles and bones, tonify the liver and kidney, and invigorate qi and blood [23]. In our study, we proved the effect of ICA, the main active ingredient in epimedium, on vascular endothelial cells and explored the underlying mechanism.First, we demonstrated how ICA affects EC proliferation. MTT results showed that 2.5 μM ICA slightly promoted cell viability after 48 h of treatment, and concentrations of 5 and 10 μM did not affect cell proliferation. However, when the concentration reached 50 μM, ICA showed cytotoxic effects. Consistent with our results, in existing studies, 5 and 10 μM ICA was reported to activate protective effects on ECs [23,24]. How exactly a high concentration of ICA affects ECs is worthy of further exploration. However, in the future application of icariin, its concentration-dependent bidirectional effect should be given more attention. Here, in our studies, we chose 2.5, 5 and 10 μM for the following studies.After incubation with ICA, the tube formation and cell migration of every group were tested. The morphological results indicated that 5 and 10 μM ICA can significantly promote tube formation and cell migration of ECs. The angiogenic motivating effect of 2.5 μM ICA was not evident, but migration was accelerated. Consistently, the qPCR results also indicated that the most effective promotion of angiogenesis occurred in the 10 μM group. Then, we detected the expression levels of VEGF and ANG by qPCR and Western blotting, and similar results were observed. VEGF is an EC-specific mitogen and potent angiogenic factor that can regulate vascular permeability and promote endothelial cell proliferation [25]. VEGFA is the most important member of the VEGF family and plays a vital role in angiogenesis and the maintenance of vascular stability [26]. VEGFR2 is a receptor of VEGF, and after activation, VEGFR2 will be phosphorylated. Activation of the VEGF signaling pathway can regulate focal adhesion turnover and actin reorganization, inducing EC migration and angiogenesis [27]. In our results, up-regulation of VEGFA and VEGFR2 were detected in both genetic and protein level, and the p-VEGFR2/VEGFR2 ratio was also increased, suggesting thjat the VEGF pathway was triggered by ICA. ANGI and ANGII belong to the angiopoietin family and are specific ligands of Tie2. The activation of Tie2 can mediate vascular assembly and maturation [28]. ANGI is the main activator of Tie2, and ANGII is highly enriched in the vasculature in many tumors and can combine with angiogenic growth factors such as VEGF or bFGF to induce tumor angiogenesis [29]. The VEGF/VEGFR and ANG/Tie pathways are classic indicators of angiogenesis [30]. Our results showed that these two pathways were significantly activated in the 5 and 10 μM groups, and over time, the effect of the 10 μM group lasted longer. It can be concluded that 10 μM ICA exerted an outstanding angiogenesis promotion effect.Autophagy is a vital process that fulfills cellular metabolic needs and renews organelles [31]. An increasing number of studies have demonstrated that moderate autophagy is essential for angiogenesis in physiological and pathological processes [32]. It has been reported that rapamycin-mediated autophagy enhancement can increase the proliferation, migration and tube formation of heat-denatured HUVECs [33]. In another in vitro study, high levels of LC3 and Beclin were detected during the neovascularization of tissue-engineered bone [34]. A number of Chinese herbs or compounds have been shown to have the ability to regulate autophagy [35-38], and ICA is one of them. It can activate autophagy in chondrocytes, preventing cell apoptosis and alleviating osteoarthritis [39]. In vivo research showed that ICA can promote osteogenic differentiation of bone marrow stem cells in ovariectomized mice, thus alleviating osteoporosis [40]. In aging SD rats, Nissl body staining and neuronal function can be improved by ICA through the induction of autophagy [41]. LC3 is the most widely acknowledged marker of autophagy. During the process of autophagy, cytoplasmic LC3 (LC3-I) enzymatically removes a small fragment of polypeptide and converts to LC3-II and attaches to autophagosomes [42]. In our study, we observed significant enhancement of LC3-II, suggesting that ICA can promote the production of autophagosomes in EA.hy926 cells. Beclin also plays a central role in autophagy by acting as a core subunit of the PI3K complex, which is involved in the initiation and maturation of autophagosomes [43]. In another study of osteoarthritis chondrocytes, ICA was believed to activate autophagy through activation of the PI3K/AKT/mTOR signaling pathway [13,39]. We observed the upregulation of Beclin; however, whether ICA promotes autophagy in EA.hy926 cells through activation of the PI3K-related signaling pathway still needs further research. In addition, the level of the autophagy junction protein p62 was also increased in EA.hy926 cells treated with 5 and 10 μM ICA. p62 is a substrate for selective autophagy and is used as a cargo protein to selectively degrade ubiquitinated proteins [44]. It is degraded by lysosomal enzymes after fusion of autophagosomes and lysosomes [45,46], as shown in our results. The p62 level increased in the 5 μM group at 1, 3 and 6 h, but there were no differences compared to the control groups at 12 and 24 h. Similarly, at 24 h, the p62 level in the 10 μM groups also decreased compared to the peak level at 6 h (P < 0.01). Therefore, we speculated that this initial increase followed by a decrease in p62 was caused by the overgeneration of autophagosomes soon after the activation of autophagy; these autophagosomes could not be degraded in a short period of time but could be eliminated over a longer period of time. In our future research, we will further investigate whether promoting autophagic flux can accelerate the degradation of ICA-mediated autophagosomes and achieve a more obvious angiogenic effect. However, overall, we can conclude that ICA promoted the occurrence of autophagy in our study. Based on the degree and duration of the increase, autophagy activation was more obvious in the 10 μM group, which is consistent with the variation trend of the tube formation indexes in our qPCR results. Therefore, in subsequent research, we aimed to explore whether there is a link between autophagy and angiogenesis.TGFβ1 participates in multiple physiological and pathological processes, including angiogenesis; it can bind with the TGFβ receptor and activate Smad2/3-, PI3K/AKT-, and JNK1/2-related signaling pathways, inducing VEGF production to promote vessel formation [47]. Many studies have confirmed that there is a connection between TGFβ1 and autophagy. A recent study found that the inhibition of autophagy can downregulate TGFβ levels and alleviate renal fibrosis injury caused by ureteral blockade [19]. However, whether autophagy can affect TGFβ1 levels in ICA-induced angiogenesis remains unclear. Here, we found that 10 μM ICA markedly induced TGFβ1 upregulation, and this elevation was suppressed by the autophagy inhibitor 3-MA. Furthermore, we found that treatment with 3-MA can restrain ICA-induced tube formation and migration of EA.hy926 cells. Therefore, we concluded that ICA-induced autophagy activation can promote EC angiogenesis through the elevation of TGFβ1. Since there are also many cases reporting that TGFβ1 can promote autophagy, whether there is positive feedback between autophagy and TGFβ1 in ICA-mediated angiogenesis warrants further study.
Conclusion
In summary, the present study suggests that ICA has a prominent angiogenesis-promoting effect and revealed the underlying mechanisms. Our data showed that ICA can activate autophagy, inducing TGFβ1 upregulation to promote angiogenesis in EA.hy926 human vascular endothelial cells. We believe ICA has promising clinical prospects in applications such as wound healing and tissue repair.
Authors: Chloe J Peach; Viviane W Mignone; Maria Augusta Arruda; Diana C Alcobia; Stephen J Hill; Laura E Kilpatrick; Jeanette Woolard Journal: Int J Mol Sci Date: 2018-04-23 Impact factor: 5.923