Rapid molecular diagnosis of Parechovirus infection using the reverse transcription loop-mediated isothermal amplification technique.

OBJECTIVES: Human parechovirus (HPeV), especially HPeV A3 (HPeV3), causes sepsis-like diseases and sudden infant death syndrome in neonates and young infants. Development of rapid and easier diagnostic laboratory tests for HPeVs is desired.
METHODS: Original inner primers, outer primers, and loop-primers were designed on the 5' untranslated region of HPeV3. HPeV3 ribonucleic acids (RNAs), other viral RNAs, and clinical stool samples were used to confirm whether the designed primers would allow the detection of HPeV3 with the reverse transcription loop-mediated isothermal amplification (RT-LAMP) technique.
RESULTS: Three combinations of primers were created and it was confirmed that all primer sets allowed the detection of HPeV3 RNAs. The primer sets had cross-reactivity with HPeV type 1 (HPeV1), but all sets showed negative results when applied to coxsackievirus, echovirus, enterovirus, norovirus, and adenovirus genomes. Four of six stool samples, obtained from newborn and infant patients with sepsis-like symptoms, showed positive results with our RT-LAMP technique.
CONCLUSIONS: This manuscript is the first description of an RT-LAMP for the diagnosis of HPeVs, allowing a faster, easier, and cheaper diagnosis. This technique is clinically useful for newborns and infants who have sepsis-like symptoms.

Introduction

Human parechovirus (HPeV) is increasingly being recognized as a potentially severe viral infection in neonates and young infants [1-3]. HPeVs usually cause the “common cold” (i.e., respiratory or gastrointestinal illness similar to rhinovirus, enterovirus, and coronavirus) [1-3]. However, HPeVs have been implicated in cases of neonatal sepsis-like diseases, encephalitis, sudden infant death syndrome, and myocarditis [1-3]. HPeVs belong to the family Picornaviridae and are divided into 19 genotypes [1].

Human parechovirus A3 (HPeV3) is the most clinically important genotype among HPeVs because of its association with severe disease in newborns and young infants [1, 3]. HPeV3-infected infants can present with a sepsis-like symptom, often with central nervous system involvement, which is difficult to differentiate clinically from bacterial sepsis [1, 3]. They may present with fever, tachycardia, and erythema [1]. Abdominal distension and navel protrusion are also seen in these patients [1]. Characteristic laboratory findings are cytopenia and elevated lactate dehydrogenase and ferritin levels, which suggest hemophagocytic lymphohistiocytosis [1]. Seizures or significant neurological impairment sometimes occur [1]. Severe HPeV3 infection in infants is also associated with a risk of long-term complications [1].

The application of molecular diagnostic methods enables the early recognition of HPeV infections. Early recognition is important because it may reduce the use of antibiotics and shorten the duration of hospital admissions for patients with mild to moderate disease. Early diagnosis is also likely to lead to appropriate investigations and follow-up for potential complications in infants who are severely affected. In some research institutes, HPeVs are detected by using nested polymerase chain reaction (PCR) and direct sequencing of amplified PCR products [1-3]. Real-time PCR is also widely used. However, it would be useful if there was a faster, easier, and cheaper diagnostic test for HPeVs.

We developed an easy and faster molecular diagnostic method to detect HPeV by using the reverse transcription loop-mediated isothermal amplification (RT-LAMP) technique. Using the RT-LAMP technique presented in this study, it was possible to diagnose HPeV in 2 h in small steps.

Materials and methods

Design of the RT-LAMP primers

The sequence of HPeV3 (GenBank: AB084913.1) was downloaded from the National Center for Biotechnology Information (Bethesda, MD, USA). Based on the highly conserved 5′ untranslated region (UTR) sequence of HPeV3, inner primers (i.e., FIP and BIP), outer primers (i.e., F3 and B3), and loop-primers (loop-F and loop-R) were originally designed on the 5′ UTR of HPeV3 by using PrimerExplorer V5 (Eiken Chemical Co., Ltd., Taito-ku, Tokyo, Japan).

RT-LAMP assay

HPeV3 viral ribonucleic acid (RNA), used as a positive control, was kindly provided by the Health and Food Safety Department at Ishikawa Prefectural Institute of Public Health and Environmental Science (Kanazawa, Ishikawa, Japan). For the detection of viral RNA by LAMP assay, the Loopamp RNA Amplification Kit (Eiken Chemical Co., Ltd., Taito-ku, Tokyo, Japan) was used following the manufacturer’s protocol. Viral RNA was incubated with enzymes, buffers, dNTPs, and primers at 63°C for 1 h. Then, the enzymes were deactivated at 80°C for 5 min. The products obtained by RT-LAMP were visually detected. The RT-LAMP products were confirmed by direct sequencing using other originally designed primers (S1 Table).

Direct sequencing of HPeV gene amplified with nested PCR and RT-LAMP

Complementary DNA (cDNA) was synthesized using Superscript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). Stool samples were first screened with nested PCR targeting the partial 5′ UTR of HPeVs. The samples that tested positive were assayed using nested PCR targeting the VP1 region for genotyping [2, 3]. Amplified DNA was directly sequenced using the BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA) in both directions. Each genotype was determined by comparing the nucleotide sequence with the available HPeV sequences from GenBank using the Genetyx program (GENETYX, Shibuya-ku, Tokyo, Japan). For RT-LAMP products, as for nested PCR, the amplified DNA was directly sequenced using the BigDye Terminator cycle sequencing kit (Thermo Fisher Scientific, Waltham, MA, USA) in both directions by using primers for sequencing (S1 Table).

Sensitivity and specificity analysis of HPeV RT-LAMP

Virus-infected cells (Vero/E6 cells supplied from the National Institute of Infectious Diseases in Japan (https://www.niid.go.jp/niid/ja/)) were cultured and two more HPeV3 were harvested, one HPeV1, one adenovirus serotype 1, one coxsackievirus B5, one echovirus 11, one enterovirus D68, and one enterovirus A71. The samples were collected through a medically prescribed test and completely de-identified before the samples were accessed.

Additionally, the stools of one patient with adenovirus gastroenteritis and three patients with norovirus gastroenteritis were collected after obtaining written informed consent from the parents. Adenovirus DNA and norovirus RNA were extracted from these stools. The patients were diagnosed by rapid diagnostic tests.

All samples (applied viral nucleic acid amount is 62–296 ng/sample) were tested for HPeVs by using RT-LAMP.

RT-LAMP analysis using clinical samples

The stools of six anonymous febrile infants were obtained at the time of the suspicion of HPeV infection, after obtaining written informed consent from the parents. Stool samples of 75 to 150 mg were diluted with 200 μL of distilled water and vortexed strongly for 5 min. The samples were then centrifuged at 20,000g for 5 min at 4°C. For the extraction of viral RNA, 150 μL of the supernatants were applied. Viral RNA was extracted from supernatants by using the QIAmp Viral RNA Mini Kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. Extracted viral RNA was stored at −80°C until amplification using RT-LAMP and nested PCR detection.

Ethics

This study was approved by the institutional review board of the Graduate School of Medical Sciences at Kanazawa University (Kanazawa, Japan; protocol number: 2014-072(1686)). This study was conducted according to the Declaration of Helsinki. All experiments were performed according to relevant guidelines and regulations (including informed consent from all participants and parents).

Results

1. Development of RT-LAMP method for HPeVs

The 5′ UTR is 700 bp in length. While designing primers using the whole 5′ UTR region via PrimerExplorer V5 (Eiken Chemical Co., Ltd., Taito-ku, Tokyo, Japan), no appropriate combinations of primers were found. Next, by designing primers using a part of the 5′ UTR region 5′ UTR (e.g., 1–400, 11–410, 21–340, …, 301–700 (i.e., the last 5′ UTR), a total of 42 primer combinations (i.e., FIP, BIP, F3, and B3) were found. The results showed eight candidate combinations (S2 Table). For example, using the 61–460 sequence of the 5′UTR, 87 F1 sequences, 90 F2 sequences, …, and 115 BIP sequences were found as candidate combinations. However, there was only one optimal combination for the F1, F2 to BIP LAMP method. When the primer was created using the 5′UTR 71–470, two optimal combinations were found. In this way, the primer combination was comprehensively searched while shifting the 400 bp sequence by 10 bp.

From these 42 combinations, 3 combinations (Set A, B , and C ) were most frequently duplicated (12 times), but the other five primer combinations were extracted only once or twice (Fig 1A and Table 1).

Fig 1

Development of the RT-LAMP method for HPeVs.

(a) The HPeV3 genome and scheme of the combinations of the primers for HPeVs. Three primer sets for RT-LAMP were designed on the 5′ UTR of HPeV3. (b) Results of RT-LAMP using the three primer sets. Tubes containing HPeV3 RNAs show a bright fluorescence, compared with tubes with distilled water. DW, distilled water; HPeV, human parechovirus; HPeV3, human parechovirus A3; RT-LAMP, reverse transcription-loop-mediated isothermal amplification; UTR, untranslated region.

Table 1

Primer information for RT-LAMP of HpeVs.

Set	Name	Sequence (5’→3’)
A	F3	GATGGCGTGCCATAACTCT
	FIP	GGTTCCCACACGTCATCAGACA-GATACCACGCTTGTGGACC
	B3	GAACCAATCCCAAAGGGTCT
	BIP	CAGTTTGCTGCAAAGCATCCCA-CTTGGCTTTTGGCCCCAG
	loop-F	AGGATGGCTGTGTGAGCATAA
	loop-R	CTGCCAGCGGATCTACATCT
B	F3	GATGGCGTGCCATAACTCT
	FIP	GGTTCCCACACGTCATCAGACA-TGTGGACCTTATGCTCACAC
	B3	CCAATCCCAAAGGGTCTGTT
	BIP	CAGTTTGCTGCAAAGCATCCCA-CTTGGCTTTTGGCCCCAG
	loop-F	TTACAAACTTACTAGAGGATG
	loop-R	CTGCCAGCGGATCTACATCT
C	F3	GATACCACGCTTGTGGACC
	FIP	AACAGGTTCCCACACGTCATCA-ATGCTCACACAGCCATCC
	B3	GAACCAATCCCAAAGGGTCT
	BIP	CAGTTTGCTGCAAAGCATCCCA-CTTGGCTTTTGGCCCCAG
	loop-F	ACATCTTACAAACTTACTAG
	loop-R	CTGCCAGCGGATCTACATCT

F1/B1c: Arial, F2/B2c: Italic, F3/B3c: Bold, loop-F/R: Times New Roman.

When HPeV3 viral RNAs were used for RT-LAMP, Sets A , B and C showed positive results. However, after testing multiple times, these sets had unstable or unreproducible rates (positive rate, %; (i.e., number of positive samples/number of tested samples)), as follows: Set A , 33.3% (6/18); Set B , 44.4% (8/18), and Set C , 86.0% (6/7).

Therefore, two more primers were added: loop-F and loop-R, to increase the sensitivity of the RT-LAMP method. Loop-R was automatically designed by using PrimerExplorer V5 (Eiken Chemical Co., Ltd.), but loop-F was manually designed because PrimerExplorer V5 could not answer the loop-F candidate (Fig 1A and Table 1). As a result, we could detect HPeV3 by using primer Set A (Set A + loop-F/R), Set B (Set B + loop-F/R), and Set C (Set C + loop-F/R) (Fig 1B). The RT-LAMP products that included the target sequence and the reverse complementary sequence were confirmed by direct sequencing.

2. Minimum reaction time and amount of viral RNAs

The RT-LAMP was tested by changing the reaction times to 20 min, 30 min, 40 min, up to 110 min. The RT-LAMP method was also tested by applying 1.18 × 102 ng, 1.18 × 10 ng, 1.18 ng, up to 1.18 × 10−5 ng of total viral RNAs. Results are shown in the S3 Table. When more than 1.18 × 10−1 ng of the total viral RNAs was applied, positive results were visible at 20 min in Set A and Set B. Set C showed optically positive results at 30 min. However, when less than 1.18 × 10−1 ng of the total viral RNAs was applied, the reaction became unstable. Only Set C showed positive results at 50 min for all amounts of viral RNAs. Therefore, we confirmed that our RT-LAMP technique could detect at least 118 pg of the total viral RNAs in stool samples and could show positive results in 30 min.

The reaction temperature was also investigated, using 59°C, 61°C, 63°C, 65°C, and 67°C. The most appropriate and stable temperature was 63°C (S4 Table).

3. Specificity of the RT-LAMP method

RT-LAMP was conducted using samples of which the etiology was already known (two more HPeV3, one HPeV1, one coxsackievirus B5, one echovirus 11, one enterovirus D68, one enterovirus A71, three noroviruses, two adenoviruses. HPeV3 and HPeV1 showed positive results in our RT-LAMP assay. However, all other samples were negative (Fig 2 and S5 Table).

Fig 2

Results of RT-LAMP using different viral genomes.

Tubes containing HPeV1 and HPeV3 show positive results, whereas the other tubes show negative results. HPeV1, human parechovirus type 1; HPeV3, human parechovirus type 3; Neg, negative; Pos, positive; RT-LAMP, reverse transcription loop-mediated isothermal amplification.

4. RT-LAMP analysis using clinical samples

The stools of six anonymous febrile infants were obtained at the time of suspected HPeV infection. From these stools, viral RNAs were extracted. The concentration of viral RNA solutions was 84.8 ± 25.2 μg/mL (expressed as the mean ± standard deviation).

Two microliters of viral RNA solution, containing 169.7 ± 50.4 ng of viral RNAs, was applied, for the RT-LAMP experiments. The LAMP products were visible in the stool samples of four patients (Patients #3–#6) and the positive control (Fig 3). Nevertheless, no RT-LAMP products were visible in the negative control and the samples of Patients #1 and #2. RT-LAMP experiments were conducted using both Sets A, B, and C, and all showed the same results (S1 Fig).

Fig 3

Representative picture of the results of RT-LAMP by using clinical samples.

The stool samples of two patients (Patient #1 and Patient #2) show negative results. The stool samples of four patients (Patients #3–#6) show positive results for RT-LAMP. This figure is from primer Set A. The results of nested PCR for HPeV3 corresponded completely to the results of RT-LAMP. HPeV3, human parechovirus A3; Neg, negative; PCR, polymerase chain reaction; Pos, positive; RT-LAMP, reverse transcription loop-mediated isothermal amplification.

In the six stools, we simultaneously tried to detect HPeVs genomes by using the nested PCR technique. HPeV3 were detected in four samples and were not detected HPeVs in two samples. This finding corresponded to the RT-LAMP results. An important finding was that the results were known in 2 h after collecting stool samples when using the RT-LAMP technique, but in 2 days when using the nested PCR technique. In addition, all RT-LAMP products were confirmed by direct sequencing.

Discussion

This study is the first to describe the detection of HPeVs by using the RT-LAMP method.

To diagnose HPeV infection, the PCR method is available. This method requires several steps, which take time to accomplish. This disadvantage of PCR tests is problematic for newborns and infants whose physical condition varies hourly. The real-time PCR method is also widely used for the current HPeV3 detection. However, the real-time PCR test requires specialized expertise and is available at limited clinical laboratories. Additionally, it is costly. Therefore, we believe that a faster, easier, and cheaper diagnostic system to detect HPeVs may be clinically useful for these patients.

The LAMP reaction, an alternative nucleic acid amplification method developed by Notomi et al. [4], is based on strand displacement by DNA polymerase under isothermal conditions in which the temperature range is 60°C–65°C [4-7]. The LAMP assay is very specific, compared with other molecular detection methods, because four primers are necessary that recognize six specific regions of the target gene for amplification [4-7]. The method generates a large amount of amplification products in positive samples (109− to 1010−fold in 15–60 min), thereby allowing assessment of these products with the naked eye and fluorescent dye [4-7]. Another advantage of the LAMP method is that amplification occurs at one temperature; therefore, it does not require a thermal cycler [4-7]. The RT-LAMP assay, which is carried out with an RT step and a LAMP reaction in a single tube, is a simple, highly specific, rapid, and cost-effective method [6, 7]. The RT-LAMP method needs only a few operating steps, which is also advantageous in preventing contamination, and thus being safe for technicians.

In this study, we have developed an RT-LAMP assay for HPeV detection by designing specific primers, based on the 5′ UTR region of the HPeV3 viral gene. We compared in silico the primer alignment to the 5′ UTR region of other types of HPeVs by using the Basic Local Alignment Search Tool (National Center for Biotechnology Information, Bethesda, MD, USA). As a result, our primers showed some homology in HPeV1, HPeV4, HPeV5, HPeV8, HPeV14, HPeV 17, and HPeV18. Therefore, our RT-LAMP assay may have cross-reactivity to the other HPeVs, except for HPeV3. We indeed confirmed that HPeV1 was also detected in our primer sets.

Aside from HPeV3, HPeV infections are common around the world and have been identified on every inhabited continent [2]. However, an accurate prevalence rate is unknown and varies, depending on the age of the individuals included in the study population and the sampling sites chosen [2]. HPeV A1 (HPeV1) is the most prevalent genotype and most commonly causes gastrointestinal and respiratory diseases [1, 2]. The symptoms are usually mild, although HPeV1 sometimes causes respiratory disease in young children, which initially presents as coryza, accompanied by cough and dyspnea. Occasional HPeV1 cases present with necrotizing enterocolitis, encephalitis, and Reye’s syndrome [1, 2]. HPeV1 outbreaks sometimes occur in nursery schools and neonatal intensive care units [1, 2]. The frequency of HPeV1 infection is not uncommon but unknown because clinicians cannot diagnose HPeV infection, including HPeV1 and HPeV3, as easily as with a rapid diagnosis kit (i.e., influenza virus). Clinicians may diagnose a patient as having “some kind of viral infection.” In some more severe cases, a research institute can help to diagnose the infection.

Therefore, we believe that our RT-LAMP method withstands criticism because the most important purpose is the detection of HPeVs, regardless of the genotype of HPeVs as a screening. However, further experiments are necessary to design HPeV type-specific primers and develop the appropriate LAMP conditions.

We completely detected HPeV3 from clinical stool samples. These patients were all 1-month-old babies and showed sepsis-like symptoms. These patients were successfully diagnosed as having HPeV infection, in 2 h. Meanwhile, if the nested PCR technique had been used, it would have taken 2 days before the results were known. This delay in determining a diagnosis can be critical for infants and newborns. Our RT-LAMP technique may solve this problem.

Additionally, HPeV3 infection is usually asymptomatic or manifests as a faint common cold in older children and adults. HPeV3 is known to cause myalgia/myositis in patients of all ages and is recognized as an important pathogen for all ages [1]. Our RT-LAMP method may also be useful for myalgia/myositis in all ages.

In our experiment, we clarified that 50–100 μg/mL of total viral RNAs can be collected from 75 mg to 150 mg of stool. It was also confirmed that 100 pg to 500 ng of total viral RNAs were sufficient to conduct our RT-LAMP technique and obtain accurate results. Usually, 2–5 μL of viral RNA solutions was used; hence, 100–200 ng of total viral RNA. Thus, 75–150 mg of stool is sufficient for our LAMP method.

On account of the limited number of cases, we were unable to determine (1) the sensitivity and specificity of each primer set and (2) the usefulness of RT-LAMP, if applied to serum, urine, and cerebrospinal fluids samples. (3) the limit of detection determined using Probit analysis. To confirm these limitations, a large prospective study is necessary. Additionally, although we believe our LAMP method is useful for screening, it is necessary to examine whether real-time PCR or the LAMP method is faster and cheaper.

In conclusion, by using our RT-LAMP technique for HPeVs, an HPeV infection can be diagnosed faster, easier, and at low costs. It is clinically useful for all patients with gastrointestinal and respiratory diseases, myalgia/myositis, encephalitis, etc., especially for newborns and infants who have sepsis-like symptoms.

The results of RT-LAMP using different primer sets.

The RT-LAMP experiments were conducted using Sets A, B, and C. All sets show the same results. Neg, negative; Pos, positive; RT-LAMP, reverse transcription loop-mediated isothermal amplification.

(TIF)

Click here for additional data file.

Primer information for direct sequencing.

(PDF)

Click here for additional data file.

List of candidates of the combinations of primers.

(PDF)

Click here for additional data file.

Results of the RT-LAMP for different RNA amounts and reaction times.

(PDF)

Click here for additional data file.

Result of the RT-LAMP changing reaction temperature.

(PDF)

Click here for additional data file.

Results of the RT-LAMP for different viruses.

(PDF)

Click here for additional data file.

5 Aug 2021

PONE-D-21-06788

Rapid molecular diagnosis of Parechovirus infection using the reverse transcription loop-mediated isothermal amplification technique

PLOS ONE

Dear Dr. Yokoyama,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Sep 18 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Ahmed S. Abdel-Moneim, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for including your ethics statement:  "This study was approved by the institutional review board of Graduate School of Medical Sciences at Kanazawa University [Kanazawa, Japan; protocol number: 2014-072(1686)]. This study was conducted according to the Declaration of Helsinki. All experiments were performed in accordance with relevant guidelines and regulations (including informed consent from all participants and parents). We obtained informed consent from the parents when we collected the stools of anonymous febrile infants.".

Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed).

Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

For additional information about PLOS ONE ethical requirements for human subjects research, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-human-subjects-research.

3. Please provide the data or graph for the temperature optimization experiment (line 174-175) as a supplementary file.

4. Please provide: the name(s) and source(s) of the cultured cells used for virus-infection, as well as a brief description of viral infection methods. If the samples were from a clinical source, please state whether the samples were:

(1) from an established biobank (if so please provide the name and a link)

(2) specifically collected for this study or not

(3) whether the samples were collected through a medically prescribed test

(4) whether the samples were completely de-identified before researchers accessed the samples

4. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

5. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Short tittle : I suggest to change to “Parechovirus infection diagnosis by RT-LAMP”

Key word: The keywords may be useful to found this work when searched by other researchers. I think that more researchers search by RT-LAMP and not “reverse transcription loop-mediated isothermal amplification”, so I suggest to use this option, but I I leave it to the authors’ consideration.

General : Authors should revise the language and sequence of the text. The authors use many repetitions like .. “Early”, “Early” in sequential sentences, or “HPeV3”…” HPeV3”… “HPeV3”

Abstract :

Authors claim “However, bedside rapid diagnostic laboratory tests for HPeVs, including HPeV3, do not exist.”. I’m not sure that a RT-LAMP can be considered as a “bedside test”, it requires knowledge and time, often not far from an RT-qPCR, and there are several for the diagnosis of these viruses. In fact, RT-LAMP takes 60 minutes, being feasible doing a qPCR in this time using direct PCR.

Abstract Conclusion “This report is the first showing that HPeVs can be detected with RT-LAMP”, This is not a conclusion of this study, theoretically any RNA sequence can be detected by this technique. This sentence should be correct to “This manuscript is the first describing a RT-LAMP for HPeVs diagnosis, allowing a faster, easily and cheaper diagnosis.”

Results : “We created three combinations of primers and confirmed that all primer sets allowed detection of HPeV3 RNAs in only 60 minutes.” This statement can generate some confusions for the readers. 60 minutes could be the duration of any PCR depending specially in the size of amplicon (generally smaller than 200 bp) and the enzymes used, so this sentence do not make sense because posteriorly the authors refer 2 hours (line 68). I understand that 1hour correspond to the PCR time and 2 hours to all the process, but this two times could appear confusing. Remove the statement of the Abstract because the time of PCR is presented in the protocol.

Line 63. Why the authors just refer the nested PCR (more laborious)? Many fast qPCR techniques are described: 10.1128/JCM.01982-12, 10.1128/JCM.00277-08, https://doi.org/10.1016/j.jcv.2016.09.009, https://doi.org/10.1007/s11033-019-05151-5 and many others.

Line 72. Why the authors just used one sequence to design primers. They have previous knowledge of full conservation of the region used?

Line 80. Many times the authors present the sentences with a romantism that is not normally used in scientific papers. Please change the sentence to “HPeV3 viral ribonucleic acid (RNA), used as positive control, was kindly provided by the Health and Food Safety Department at Ishikawa Prefectural Institute of Public Health and Environmental Science (Kanazawa, Ishikawa, Japan).”

Line 83. Present all the Providers as (Company, City, Country)

Line 85 . Use dNTPs instead “deoxyribose nucleoside triphosphates”

Line 85. The methods should not be presented “as a brief”. The objective of material and methods is to allow the full repeatability by other researchers. Please present all the conditions, quantities and other important information.

Line 91 “reverse RT”? What is the R in RT?. The sentence can appear simply as “Complementary DNA (cDNA) was synthesized using Superscript II Reverse Transcriptase…”

Line 93 . I’ve never seen the term “test-positive samples”. Please use, samples tested positive

Line 99. Uniformize all the brands that you use, including minuscles/maiscules. Some times appear “BigDye Terminator cycle sequencing kit”, other “BigDye Terminator Cycle Sequencing Kit”

Line 106/107- Noro / Adeno are not official diminutive for viruses, please remove these references. If you want, you can use HuNoV and HAdV

Line 112 – How the authors measured 50-100ul of stool? It were they consistent with watery diarrhea?

114- Centrifugation should be all stated in G, not rpm, alternatively refer the brand and model of machine.

Line 114 – Present “150 μL”

In all the manuscript, and for example in the line 129, the authors write the manuscript in the first singular person that is not the indicated to scientific papers. “When we attempted to find”… “we could not find” … “Therefore, while shifting … we comprehensively extracted”.

By this reason, I recommend the revision of all the manuscript because it is very difficult to read.

Reviewer #2: The manuscript titled “Rapid molecular diagnosis of Parechovirus infection using reverse transcription loop-mediated isothermal amplification technique” reports a visual isothermal technique for portable detection of parechovirus infection. Overall, I believe the manuscript would be of interest to the community, but I have a number of comments that should be addressed before I can recommend it for publication.

-The phrasing should be improved, as it is difficult to understand what is being stated in a few places.

-There is no limit of detection determined. The authors should address why it was not determined using Probit analysis (their results are presence/absence). They should address this and state this would be future work in the Discussion section.

-The authors also should address why no direct comparison to one step real time RT-PCR was performed, as this would have been the closest assay rival to the RT-LAMP assay they have developed.

-What was the approximate load of viral nucleic acid loaded in reactions for the selectivity work?

-Also, virus names should not be italicized/capitalized when referring to viruses in the manner they are used in the publication; this should only be done when broadly referring to a family, genus, or species.

-Which strains/subtypes of adenovirus and norovirus were used for the selectivity testing.

-Lines 133-138: I am not sure what the authors are referring to here.

-The table listing primers is a little unclear and could be a little better organized with a legend explaining what is being presented.

-The authors list viral nucleic acid in terms of ng/pg. However, in real application genome copies or pfu/ml (or TCID50/ml) is much more useful. What levels of virus do these values approximately translate to? Please state in the manuscript.

-Lines 257-260: This is a bit of an exaggeration, as many viruses can cause illness and this assay only answers if it is one type of virus.

Reviewer #3: The article entitled « Rapid molecular diagnosis of Parechovirus infection using the reverse transcription loop-mediated isothermal amplification technique» is well written and the results are clearly presented. However, some modifications of the manuscript and figures should be done. The authors created three combinations of primers to detect HPeVs using RT-LAMP experiments. They conclude that HPeV infection can be used for the faster diagnosis with less cost.

the paper is accepted for publication.

Reviewer #4: The current study by Yokoyama is nicely written and describes the development of RT-LAMP assay for the HePV. The paper should be accepted for publication in its current form. A minor suggestion is that authors should try to improve the tests to enable it for the detection of different genotypes separately.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

2 Nov 2021

Emily Chenette,

Editor-in-Chief

PLOS ONE

Dear Professor Emily Chenette:

Thank you for your valuable review. We also wish to thank the reviewers who reviewed our manuscript and provide such valuable suggestions. Here are our responses to the comments from the reviewers.

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

We carefully revised our manuscript and confirm that it meets PLOS ONE’s style requirements.

2. Thank you for including your ethics statement: "This study was approved by the institutional review board of Graduate School of Medical Sciences at Kanazawa University [Kanazawa, Japan; protocol number: 2014-072(1686)]. This study was conducted according to the Declaration of Helsinki. All experiments were performed in accordance with relevant guidelines and regulations (including informed consent from all participants and parents). We obtained informed consent from the parents when we collected the stools of anonymous febrile infants..”

Please provide additional details regarding participant consent. In the ethics statement in the Methods and online submission information, please ensure that you have specified what type you obtained (for instance, written or verbal, and if verbal, how it was documented and witnessed).

Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

For additional information about PLOS ONE ethical requirements for human subjects research, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-human-subjects-research.

We obtained written informed consent and added this information to the Materials and Methods section (Line 118).

3. Please provide the data or graph for the temperature optimization experiment (line 174–175) as a supplementary file.

Thank you for pointing this out. We added the temperature optimization data (Line 185, S4 Table).

4. Please provide: the name(s) and source(s) of the cultured cells used for virus-infection, as well as a brief description of viral infection methods. If the samples were from a clinical source, please state whether the samples were:

(1) from an established biobank (if so please provide the name and a link)

(2) specifically collected for this study or not

(3) whether the samples were collected through a medically prescribed test

(4) whether the samples were completely de-identified before researchers accessed the samples

The cultured cells are Vero/E6 cells, and the source of the cells is the National Institute of Infectious Diseases in Japan (https://www.niid.go.jp/niid/ja/). The samples were collected through a medically prescribed test and completely de-identified before we accessed the samples. This information was added to the Materials and Methods section (Line 104–107).

5. We note that the grant information you provided in the “Funding Information” and “Financial Disclosure” sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the “Funding Information” section.

We revised the funding information as follows:

This project was supported by the Morinaga Foundation for Health & Nutrition (http://www.disclo-koeki.org/02a/00327/index.html). The funders had no role in the conceptualization, analysis, interpretation, or decision to publish this manuscript.

6. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

Thank you for your suggestion. The sequence confirmation of the LAMP products and the homology confirmation of the primers have been removed from the phrase “data not shown” because they are not the core parts of our study. Also, the temperature optimization data was added as S4 Table. Please let us know if you need more supplementary data. We will submit it additionally.

Reviewers' comments:

Reviewer #1:

Short title: I suggest to change to “Parechovirus infection diagnosis by RT-LAMP”

Keyword: The keywords may be useful to found this work when searched by other researchers. I think that more researchers search by RT-LAMP and not “reverse transcription loop-mediated isothermal amplification,” so I suggest to use this option, but I leave it to the authors’ consideration.

Thank you for your suggestion. We also found that “RT-LAMP” was more appropriate, so we changed the title as per your suggestion.

General: Authors should revise the language and sequence of the text. The authors use many repetitions like. “Early,” “Early” in sequential sentences, or “HPeV3”…” HPeV3”… “HPeV3”

Regarding the issues you pointed out, the manuscript was proofread by a native English speaker.

Abstract:

Authors claim “However, bedside rapid diagnostic laboratory tests for HPeVs, including HPeV3, do not exist..” I’m not sure that a RT-LAMP can be considered as a “bedside test,” it requires knowledge and time, often not far from an RT-qPCR, and there are several for the diagnosis of these viruses. In fact, RT-LAMP takes 60 minutes, being feasible doing a qPCR in this time using direct PCR.

Thank you for your suggestion. Since our laboratory does not have a qPCR device, we reasoned that the LAMP method, which can detect using only a heat block, would be easier. However, after our discussion, we agree with the reviewer’s opinion. Thus, we changed the sentence to “development of rapid and easier diagnostic laboratory tests for HPeVs is desired” (Line 22).

Abstract Conclusion “This report is the first showing that HPeVs can be detected with RT-LAMP,” This is not a conclusion of this study, theoretically any RNA sequence can be detected by this technique. This sentence should be correct to “This manuscript is the first describing a RT-LAMP for HPeVs diagnosis, allowing a faster, easily and cheaper diagnosis.”

Following your suggestion, the text has been changed (Line 36–38).

Results: “We created three combinations of primers and confirmed that all primer sets allowed detection of HPeV3 RNAs in only 60 minutes.” This statement can generate some confusions for the readers. 60 minutes could be the duration of any PCR depending specially in the size of amplicon (generally smaller than 200 bp) and the enzymes used, so this sentence do not make sense because posteriorly the authors refer 2 hours (line 68). I understand that 1hour correspond to the PCR time and 2 hours to all the process, but this two times could appear confusing. Remove the statement of the Abstract because the time of PCR is presented in the protocol.

As you pointed out, we have deleted “in only 60 minutes” (Line 30).

Line 63. Why the authors just refer the nested PCR (more laborious)? Many fast qPCR techniques are described: 10.1128/JCM.01982-12, 10.1128/JCM.00277-08, https://doi.org/10.1016/j.jcv.2016.09.009, https://doi.org/10.1007/s11033-019-05151-5 and many others.

Because we do not have a real-time PCR machine in our lab, we decided to establish the LAMP method instead of real-time PCR. However, it is difficult to mention that we do not have a real-time PCR machine in the lab.

The second reason is that nested PCR was not originally created to only detect HPeV3 but was established to detect several viruses based on conventional PCR and sequence analysis of amplification products.

The third reason, which overlaps with the first reason, is that we do not have the funds to run qPCR.

Thus, we added the sentences in Line 63 as follows: “The real-time PCR is also widely used. However, it would be useful if there was a faster, easier, and cheaper diagnostic test for HPeVs.”

In the discussion, the following sentences were added:

Line 227: The real-time PCR method is widely used for the current HPeV3 detection.

Line 230: faster, easier, and cheaper

Line 290: In addition, although we believe the LAMP method is useful for screening, it is necessary to confirm whether real-time PCR or the LAMP method is faster and cheaper.

Line 72. Why the authors just used one sequence to design primers. They have previous knowledge of full conservation of the region used?

We also confirmed the sequences of other HPeV3 (for example, GenBank: AJ889918). However, it is already known that this sequence (strain A308-99: AB084913.1) is the most common and almost conserved gene sequence of HPeV3 detected in Japan, so in this study, we used this sequence.

Line 80. Many times the authors present the sentences with a romanticism that is not normally used in scientific papers. Please change the sentence to “HPeV3 viral ribonucleic acid (RNA), used as positive control, was kindly provided by the Health and Food Safety Department at Ishikawa Prefectural Institute of Public Health and Environmental Science (Kanazawa, Ishikawa, Japan).”

As per your suggestion, the text has been changed (Line 80).

Line 83. Present all the Providers as (Company, City, Country)

Thank you for your advice. We added all Providers as (Company, City, Country). We also reconfirmed all Providers.

Line 85.se dNTPs instead “deoxyribose nucleoside triphosphates”

Following your suggestion, the text has been changed (Line 85).

Line 85. The methods should not be presented “as a brief.” The objective of material and methods is to allow the full repeatability by other researchers. Please present all the conditions, quantities and other important information.

It was customarily described as a preposition, so we deleted it.

Line 91 “reverse RT”? What is the R in RT? The sentence can appear simply as “Complementary DNA (cDNA) was synthesized using Superscript II Reverse Transcriptase…”

Thank you very much. This is a simple mistake. We wanted to write “reverse transcriptase” instead of “reverse RT.” The description has been changed as you pointed out.

Line 93.’ve never seen the term “test-positive samples.” Please use, samples tested positive

As per your suggestion, the text has been changed (Line 93).

Line 99. Uniformize all the brands that you use, including minuscles/maiscules. Sometimes appear “BigDye Terminator cycle sequencing kit,” other “BigDye Terminator Cycle Sequencing Kit”

The description has been changed to “BigDye™ Terminator v3.1 Cycle Sequencing Kit.”

Line 106/107- Noro / Adeno are not official diminutive for viruses, please remove these references. If you want, you can use HuNoV and HAdV.

As you suggested, we unified it without using abbreviations. We also modified Figure 2.

Line 112–How the authors measured 50–100ul of stool? It were they consistent with watery diarrhea?

A sample of stool was placed into an Eppendorf tube and lightly centrifuged before measuring its volume. However, when we weighed it, we found that 50–100 μL of the stool we used was equivalent to 75–150 mg, so we changed the description accordingly.

114- Centrifugation should be all stated in G, not rpm, alternatively refer the brand and model of machine.

For the centrifuge we used, 15,000 rpm is equivalent to 20,000g, so we changed the description accordingly.

Line 114–Present “150 μL”

As you suggested, the text has been changed (Line 120).

In all the manuscript, and for example in the line 129, the authors write the manuscript in the first singular person that is not the indicated to scientific papers. “When we attempted to find”… “we could not find” … “Therefore, while shifting … we comprehensively extracted.”

The manuscript was proofread by a native English speaker.

By this reason, I recommend the revision of all the manuscript because it is very difficult to read.

Thank you for these suggestions; we feel that the quality of the revised manuscript is better than the initial version. Thank you for your efforts to produce a better quality treatise. We would be grateful if you could proofread the manuscript once again.

Reviewer #2: The manuscript titled “Rapid molecular diagnosis of Parechovirus infection using reverse transcription loop-mediated isothermal amplification technique” reports a visual isothermal technique for portable detection of Parechovirus infection. Overall, I believe the manuscript would be of interest to the community, but I have a number of comments that should be addressed before I can recommend it for publication.

-The phrasing should be improved, as it is difficult to understand what is being stated in a few places.

We requested a native speaker to proofread the English text once again and confirmed that it was difficult to read.

-There is no limit of detection determined. The authors should address why it was not determined using Probit analysis (their results are presence/absence). They should address this and state this would be future work in the Discussion section.

Thank you for your suggestion. In this study, the analysis was performed using a limited number of cases, so the detection limit was not examined. Therefore, the issue you pointed out is the limitation of this research. We added the sentence “(3) the limit of detection determined using Probit analysis” to Line 288.

-The authors also should address why no direct comparison to one step real-time RT-PCR was performed, as this would have been the closest assay rival to the RT-LAMP assay they have developed.

This suggestion was also made by reviewer #1. Because we do not have a real-time PCR machine in our lab, we decided to establish the LAMP method instead of real-time PCR. However, it is difficult to mention that we do not have a real-time PCR machine in our lab.

Therefore, we added the sentences in Line 63 as follows: “The real-time PCR is also widely used. However, it would be useful if there was a faster, easier, and cheaper diagnostic test for HPeVs.”

In the discussion, the following sentences were added:

Line 227: The real-time PCR method is widely used for the current HPeV3 detection.

Line 230: faster, easier, and cheaper

Line 290: In addition, although we believe the LAMP method is useful for screening, it is necessary to confirm whether real-time PCR or the LAMP method is faster and cheaper.

-What was the approximate load of viral nucleic acid loaded in reactions for the selectivity work?

The amount of viral nucleic acid is listed in the S5 Table. However, for the sake of clarity, we added “applied viral nucleic acid amount is 62–296 ng/sample” to the method section (Line 113).

-Also, virus names should not be italicized/capitalized when referring to viruses in the manner they are used in the publication; this should only be done when broadly referring to a family, genus, or species.

As you pointed out, the italicized virus name has been changed to the official nomenclature.

-Which strains/subtypes of adenovirus and norovirus were used for the selectivity testing.

As for the adenovirus and norovirus samples, we did not confirm the strain/subtypes because the samples rapidly tested positive in the patient’s feces.

“The patients were diagnosed by rapid diagnostic tests.” (Line 111)

In addition, the adenovirus that was distributed is known to be serotype1; therefore, we described it as such (Line 106).

-Lines 133–138: I am not sure what the authors are referring to here.

We have revised these sentences to make them easier to understand.

-The table listing primers is a little unclear and could be a little better organized with a legend explaining what is being presented.

The table has been amended so that the primer information is easy to view for each set.

-The authors list viral nucleic acid in terms of ng/pg. However, in real application genome copies or pfu/ml (or TCID50/ml) is much more useful. What levels of virus do these values approximately translate to? Please state in the manuscript.

“pfu/mL” measures the amount of virus activity. However, our purpose is the amount of virus detected in fecal specimens. In our assay, the viral RNA is extracted directly from the stool (the stool was directly dissolved, and the capsid of the virus was destroyed), so we believe that the virus dies at that point. Thus, the amount of virus activity is not measured. Genome copy is difficult to measure because we cannot perform real-time PCR and do not have a positive control with a known concentration of virus.

-Lines 257–260: This is a bit of an exaggeration, as many viruses can cause illness and this assay only answers if it is one type of virus.

As you pointed out, we found that this sentence was overstated, and we deleted it.

Reviewer #3: The article entitled « Rapid molecular diagnosis of Parechovirus infection using the reverse transcription loop-mediated isothermal amplification technique» is well written and the results are clearly presented. However, some modifications of the manuscript and figures should be done. The authors created three combinations of primers to detect HPeVs using RT-LAMP experiments. They conclude that HPeV infection can be used for the faster diagnosis with less cost. the paper is accepted for publication.

Thank you for your review. On the basis of the suggestions from other reviewers, we modified the manuscript and figures. We are proud that the paper has better quality, but we would appreciate it if you could point out any questions.

Reviewer #4: The current study by Yokoyama is nicely written and describes the development of RT-LAMP assay for the HePV. The paper should be accepted for publication in its current form. A minor suggestion is that authors should try to improve the tests to enable it for the detection of different genotypes separately.

Thank you for your advice. In our study, it was not possible to detect different genotypes separately. This is the limitation of this research. Therefore, in the manuscript (Line 268–270), we described “further experiments are necessary to design HPeV type-specific primers and develop the appropriate LAMP condition.”

We hope that many researchers will be interested in our research and that there will be colleagues who consider working in collaboration with us to establish a rapid diagnostic method for each genotype.

Many thanks.

Sincerely yours,

Tadafumi Yokoyama, M.D., Ph.D.

Department of Pediatrics, Kanazawa University

Submitted filename: Response to reviewers.doc

Click here for additional data file.

9 Nov 2021

Rapid molecular diagnosis of Parechovirus infection using the reverse transcription loop-mediated isothermal amplification technique

PONE-D-21-06788R1

Dear Dr. Yokoyama,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Ahmed S. Abdel-Moneim, Ph.D.

Academic Editor

PLOS ONE

17 Nov 2021

PONE-D-21-06788R1

Rapid molecular diagnosis of Parechovirus infection using the reverse transcription loop-mediated isothermal amplification technique

Dear Dr. Yokoyama:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Prof. Ahmed S. Abdel-Moneim

Academic Editor

PLOS ONE