Differential expression of gut protein genes and population density of Arsenophonus contributes to sex-biased transmission of Bemisia tabaci vectored Cotton leaf curl virus.

Whitefly, Bemisia tabaci (Gennadius) is an important pest of cotton causing direct damage as sap feeder and vector of Cotton leaf curl virus (CLCuV). Previous few studies suggest that female whiteflies are more efficient vector of begomovirusthan males, however the sex-biased transmission efficiency is still not clearly understood. Present studies with B. tabaci AsiaII-1 haplotype showed higher virus transmission efficiency of females compared to males. This variable begomovirus transmission efficiency has been related to previously identifiedkey factors associated with B. tabaci. The higher density of endosymbiont Arsenophonus and variable expression of some midgut proteins genes i.e. Cyclophilin, Knottin, Hsp40, Hsp70 may be possibly imparting higher vector competency to the females compared to males. The present studies suggest low abundance of Arsenophonus spp. as well as lower expressionof Cyclophilin genein males as compared to females. This is further supplemented by overexpression of Knottin, Hsp40, and Hsp70 genes in males compared to females and thus collectively all these factors might be playing a key role in low virus transmission efficiency of males. The relative density of Arsenophonus spp. and expression of midgut proteins genes in male and female whitefly first time enriches our understanding about sex-biased transmission efficiency of begomovirus.

Introduction

The cotton whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) comprises a complex of morphologically indistinguishable species that cause considerable losses to numerous crops both as pest and vector of plant viruses globally [1]. Whitefly causes damage to agricultural crops by direct sap-feeding, secreting honeydew which leads to saprophytic growth on the host plant that interferes with the photosynthetic ability of plants and as a vector of begomoviruses. Higher fecundity, more dispersal, polyphagy, development of insecticide resistance are the driving factors that have made this insect a global pest [2-4]. Whitefly infests more than 500 host plants which include fiber crops, ornamentals, vegetables, legumes, and weeds and vectors 114 plant viruses belonging to genera begomoviruses (Geminiviridae), criniviruses (Closteroviridae), torrado viruses (Secoviridae), and ipomoviruses (Potyviridae) [5]. Begomoviruses constitute the most damaging viruses which have emerged in recent decades to affect most of the fiber, ornamental and vegetable crops globally [5]. Members of the genus Begomoviruses belong to the family geminiviridae and consist of either ssDNA or dsDNA, which are exclusively transmitted by whiteflies in a circulative persistent manner [6]. Begomoviruses and vector whiteflies have co-evolved as a complex interacting system; it is still not completely understood that persistent transmission of the virus is propagative (virus replicates inside host-vector) or non-propagative (virus do not replicate inside host-vector). Persistent circulative passage of Begomoviruses inside the vector involved complex interaction of viral coat protein with host vector proteins [7-9]. Among the persistently transmitted viruses Cotton leaf curl virus (CLCuV) species are highly devastating and poses a serious threat to the fiber sector by causing Cotton leaf curl virus disease (CLCuD). CLCuD is a serious problem in African cotton growing regions, north-Indian cotton-growing states, Pakistan, Bangladesh, Philippines and China [10]. Recently CLCuV has been classified into five major species which include Cotton leaf curl Kokharan virus (CLCuKoV), Cotton leaf curl Multan virus (CLCuMuV), Cotton leaf curl Allahabad virus (CLCuAlV); Cotton leaf curl Bangalore virus (CLCuBaV) and Cotton leaf curl Gezira virus (CLCuGeV) present across different cotton growing regions of world [11]. Both virus and vector have strong molecular interactions and due to a wide host range of species complex new viral species are evolving, which pose a serious threat to cotton cultivation in many cotton growing countries. Many earlier reports have compared the differential transmission of Begomoviruses by different haplotypes of B. tabacispecies complex. The vector competence of the Asia II-1 haplotype, a predominant in north India for transmitting CLCuD is higher when compared with other haplotypes [12]. The Asia II-1 haplotype has been found to be closely associated with CLCuD incidence in the north-western region of India, while south India native population belongs to Asia-1 and recorded CLCuD incidents are very low when compared to the northwestern zone. This disease-specific geographic distribution pattern of whitefly haplotypes had prompted several questions regarding the transmission of CLCuV. Previous studies revealed the interaction of GroEL protein secreted by secondary symbionts Hamiltonella and Arsenophonus of whiteflies with viral coat protein [13]. Interrupting the functioning of GroEL had resulted in decreased virus transmission. Similarly reports have been published suggesting the role of several genes in circulative virus transmission mediated by whitefly [14-16]. It has been evidenced that females are efficient vectors in comparison to male based on variable symbiont density [17]. Even under different crops (tomato, okra, cotton, cucurbits, and chili) germplasm screening against begomovirus, the use of female B. tabaci as a vector has been documented [18]. This led us to investigate the question whether CLCuV transmitted from Asia II-1 whiteflies sex-dependent manner. However, to date only a couple of studies have been taken up on focusing on sex-biased differential transmission by whitefly. The present study reports the differential virus transmission with males and females of Asia II-1 haplotype of B. tabaci in context to endosymbiont Arsenophonus spp. and genes associated with virus transmission in whitefly. The finding of this study will advance our understanding regarding the sex-biased key players involved in CLCuV transmission.

Materials and methods

Raising of whitefly and virus cultures

The susceptible variety of cotton Gossypiumhirsutum cultivar RST9 was sown in pots in insect-proof cages for growing virus-free plants (S1 Fig). Staggered sowing of cotton was done for a continuous supply of plants for the begomovirus transmission study and whitefly culture maintenance. Non-viruliferous whitefly haplotype Asia II-1 was continuously maintained on these plants at 26 ± 1 °C, 60%RH, and 14 h light/10 h darkness under insect-proof cages (BugDorm- MegaView Science Co., Ltd., Taiwan). The virus culture of most prevalent Cotton leaf curl Multan virus-Rajasthan (CLCuMuV-Ra) (Accession no. MZ365008) was also maintained in these plants kept in insect-proof cages.

Quantification of viral load in whitefly males and females

Non-viruliferous whitefly adults (1–2 days old) were collected in a 50 ml falcon tube and subjected to 2 h starvation and then given the feeding acquisition of 48 h on virus-infected plant leaves in closed cups covered with fine muslin cloth on one side (S2 Fig). After 48 h the live whiteflies were collected with the help of an aspirator wrapped outside with aluminum foil and kept in -20°C for 5 min to reduce their activity and transferred to a 50 ml falcon. The tube was placed continuously on ice and the flies were sexed under a stereo zoom microscope (Olympus SZX7) in small batches with the help of a ‘0’ size sable hairbrush. Morphological distinction was done based on size and shape of ovipositor (S3 Fig). The males and females were transferred into separate 1.5 ml tubes with 250 μl TRI Reagent® RNA Isolation Reagent (Sigma-Aldrich, Inc.) and proceeded for RNA isolation. Each sample consisted of five biological and three technical replicates. The integrity of the RNA was determined by Biospectrometer (Eppendorf). Total RNA (1μg) was reverse transcribed into cDNA using Primescript First-strand cDNA synthesis kit (Takara). The cDNA was diluted 10 times prior to reaction setup and each qPCR reaction consisted of 1 μl cDNA, 0.1 μL of each primer (10 μM), and 5 μl of SYBR® Premix Ex TaqTM II in a total volume of 10 μl.

The differential retention of CLCuMuV-Ra by female and male whitefly was assessed using quantitative real-time PCR (qRT-PCR) by quantifying viral coat protein (CP) copies on a Light cycler System (Roche Life Sciences, Mannheim, Germany) using SYBR® Premix Ex TaqTMII (Takara) according to manufacturer’s protocol. The reaction conditions were 30 s at 94°C followed by 40 cycles consisting of 30 s at 95°C, 5s at 95°C, and 30 s at 60°C. The accompanying software LightCycler® 96 Application Software Version 1.1 was used for qPCR data normalization and quantification. The relative virus titer was inferred on the basis of relative expression level of the viral CP gene calculated using the 2-ΔΔCt method. The expression level of different genes also calculated using ΔCT method and presented in terms of means± SEM. The expression data was analyzed using Student t- test at p < 0.05. All the gene expression data in this study was normalized using β-tubulin gene of B. tabacias housekeepinggene based on our previous studies [19]. To rule out the non-specific binding/ background amplification, qRT-PCR reactions were setup using non-viruleferous and viruleferous whitefly, as well as CLCuMuV-Ra infected and non-infected cotton plants. The RT-PCR primers for the coat protein were designed using Primer 3 Software using viral sequence (Acc. # MZ36500) The details of the primers used in the study are given in Table 1.

Table 1

Details of primers used in the study.

Target gene	Primer sequence 5’-3’	Expected size (bp)
q_Cycloph_F	GACGTAGGTCAAGATCCAGAGA	133
q_Cycloph _R	GAGGAAACTGCTCGTCCTTT
q_HSP40_F	CTGTAGAAAGGATCCC	145
q_HSP40_R	AACACCGTTGCGACTTACAA
q_HSP70_F	AGTGCGGACGAACTAGCACT	117
q_HSP70_R	GCAGCCAAATGATCAAGTCA
q_Knottin_F	GGCAATTGTCTTCCTGACG	120
q_Knottin_R	TGTGCAATGTCCAGGAGTTC
qCLCuV_F	CGTCGACCTGTTGATAAACCTC	150
qCLCuV_R	GCATATTGACCA CCGGTAACAG
qArs_F	GGTGACAGCCCCGTATCTAA	181
qArs_R	TTCCCTCACGGTACTGGTTC
β-tubulin_F	CACTGGTACGTAGGAGAAGGTA	117
β-tubulin_R	ACTGAGTCCATGCCAACTTC
ds_Hsp40_F	TAATACGACTCACTATAGGGCTCAAGCGTACGAAGTCCTATC	371
ds_Hsp40_R	TAATACGACTCACTATAGGGGTGGTGATGATGGTGGTTACT
ds_Hsp70_F	TAATACGACTCACTATAGGGCTCGAAACAAGCGAGGAGATT	373
ds_Hsp70_R	TAATACGACTCACTATAGGGCGATGGAGAGCAGCATCAATT
ds _Cycloph_F	TAATACGACTCACTATAGGGCAAGAGAGACAATCCAG	468
ds _Cycloph_F	TAATACGACTCACTATAGGGCCTGAGTGGAACATATC
ds_Knottin_F	TAATACGACTCACTATAGGACGACCAAAGCTTATC	500
ds_Knottin _R	TAATACGACTCACTATAGGATCTGGTTGTGCAATG
qGroEL_F	TCGGTACGATTTCGGCTAAC	170
qGroEL_R	AATAACCGCGATCAAATTGC

Relative feeding and fluid loss assay

Fifty males and females were allowed to feed on 100 μl sucrose diet in three different replicates. For this a 50 ml falcon tube open at both ends was used as a feeding chamber. It was covered by muslin cloth at one end and with stretched parafilm at the other end. Sucrose diet solution (20%) was placed on the parafilm and covered with another layer to enclose the diet solution (S3 Fig). The feeding chamber without whiteflies was considered as control and used to estimate the diet loss in 24 h due to evaporation. The amount of diet left in all the treatments and control was quantified using Nanoject (Durmmond Scientific Inc, USA). The diet loss in control was subtracted from both the treatment and total diet consumed per whitefly adult was calculated in nl. Similarly for estimating the amount of fluid excretion from 25 male and female whitefly adults in three replicates from above experiment were released on ventilated Petri plate with water sensitive paper (TeeJet®Technologies) 50mm in diameter placed on inner side covering the whole base. After 1 h the number of blue dots were calculated on each paper disc under Stereo Zoom Microscope (SZX7, Olympus) to estimate the comparative fluid loss.

Comparative transmission and quantification of viral load in host plant

Non-viruliferous AsiaII-1 whiteflies were starved for 2 h followed by feeding acquisition of 48h on virus-infected plants. Adults were sexed as per methodology described in the previous section and 10 males and 10 females were used separately to inoculate freshly raised virus-free cotton plants at 3 or 4 true-leaf stage (3 weeks after sowing) for 48h in leaf clip cages (S1 Fig). The study was conducted with four biological replicates with three plants in each. Post-acquisition after 48 h the whiteflies were removed and further, the plants were kept whitefly free by spraying Diafenthiuron 50% WP (Syngenta India Ltd.) thoroughly on each of the virus inoculated cotton plants. The plants were kept in insect-proof cages for observation of symptoms. Total RNA was extracted using TRI Reagent® RNA Isolation Reagent (Sigma-Aldrich, Inc.) from the male and female inoculated plants after the appearance of the first viral symptoms. The quality and quantity of RNA was checked through a spectrophotometer (Eppendorf BioSpectrometer ® basic). The RNA was reverse transcribed into cDNA using PrimeScript 1st strand cDNA Synthesis Kit (Takara). The cDNA samples were diluted tenfold prior to reaction setup and the relative expression of the virus was studied using viral CP gene-specific primers. The qPCR reaction was carried out in Light cycler System (Roche life sciences, Mannheim, German) SYBR® Premix Ex TaqTMII, (Takara) according to manufacturer’s protocol with thermal cycling conditions which constitute of initial denaturation of 95 °C for the 30s followed by 40 cycles of 95 °C for 5s and 60 °C for 10s. The expression of the target gene was normalized using the histone 3 gene of cotton [20] Statistical analysis was performed by using the student’s t-test.

Relative expression of Hsp70, Hsp 40, Knottin and Cyclophilin genes and density of Arsenophonus spp. in male and females whiteflies and its impact viral load

The relative expression of Hsp70, Hsp40, Knottin and Cyclophilin was estimated in both viruliferous and non-viruliferous male and female whiteflies. For this 2–3 days old 10 whiteflies each was subjected to total RNA isolation using TriReagent® (Sigma-Aldrich) as per manufacturer’s protocol followed by DNAse treatment. The quality and quantity of RNA were checked on the Eppendorf BioSpectrometer® basic. First-strand cDNA was prepared from 1 μg of RNA using the PrimeScript™ 1st strand cDNA Synthesis Kit (Clontech Takara) as per protocol. The expression of Hsp70, Hsp40, Knottin, and Cyclophilin genes was quantified using SYBR-Green (SYBR® Premix Ex TaqTMII, Takara) and respective gene specific primers (Primer3 software) (Table 1) in qRT-PCR LightCycler® 96 System (Roche life sciences, Mannheim, Germany). The cDNA was diluted 10 times prior to reaction setup and each qPCR reaction consisted of 1 μl cDNA, 0.1 μL of each primer (10 μM), and 5 μl of SYBR® Premix Ex TaqTM II in a total volume of 10 μl. The reaction conditions were 30 s at 94°C followed by 40 cycles consisting of 10 s at 94°C, 30 s at 55°C, and 20 s at 72°C. Similarly, the density of Arsenophonus in both viruliferous and non-viruliferous males and females (sampled as per earlier mentioned protocol in this section) was quantified through the relative expression of the 23SrRNA gene of the bacterium using qRT-PCR based quantification. Each biological sample consisted of five replicates. All these qRT-PCR reactions were normalized using constitutively expressed B. tabaci -β tubulin as a housekeeping gene.

Elimination of Arsenophonus and dsRNA-mediated silencing of Hsp70, Hsp 40, Knottin, and Cyclophilin genes to study their impact on viral load in whitefly

The endosymbiont Arsenophonus spp. was eliminated using tetracycline feeding to adult whiteflies through an artificial diet-feeding approach. A 50 ml falcon tube open at both ends was used as a feeding chamber covered by muslin cloth at one end and with stretched parafilm at the other end. Sucrose diet solution (20%) infused with tetracycline (90 μg/ml) was placed on the parafilm and covered with another layer to enclose the diet solution (S3 Fig). The selection of antibiotic and its dose was inferred from our previous study which showed complete elimination of Arsenophonus from whitefly after feeding of tetracycline-infused sucrose diet for 48 h. Post 48h feeding, male and female were separated as described in earlier sections. Arsenophonus cured ten individual female and male adults were subjected to qRT-PCR detection as described in the previous section to confirm viral load in each group with each biological sample replicated five times.

In order to study the impact of selected genes on the viral load in whitefly template for dsRNA against respective genes was amplified from cDNA using gene-specific primers having T7 promoter sequence (5′-TAATACGACTCACTATAGGG-3′) at the 5′ ends of both reverse and forward primer. Amplicons were gel purified using NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel) as per the manufacturer’s protocol. The respective amplicons were used as a template for in vitro transcription using TranscriptAid T7 High Yield Transcription Kit (Fermentas) as per the kit manual. The quality and quantity of dsRNA was determined by agarose gel electrophoresis and Eppendorf BioSpectrometer ® basic, respectively.

Viruliferous adult whiteflies sampled as per earlier described protocol were given feeding access to dsRNA (400 ng/ ul of diet) against Hsp70, Hsp40, Knottin, and Cyclophilingenes incorporated in 20% sucrose diet. The dose and feeding methodology was followed as per our earlier studies [21, 22]. A similar quantity of dsRNA against green fluorescent protein gene (dsGFP) was used as control. Post 48 h of feeding accesses to dsRNA-sucrose diet mixture, male and female were separated under a stereomicroscope microscope as per methodology described in earlier sections. Each individual sex comprising of ten male and ten female whiteflies representing one biological sample replicated five times were collected in TriReagent® (Sigma-Aldrich) and subjected to RNA extraction followed by qRT-PCR analysis as per earlier described methodology. The relative fold change in viral CP gene expression was quantified in both male and female whiteflies using the delta-CT method. The gene expression was normalized withβ-tubulin as a housekeeping gene and compared with dsGFP fed whiteflies as control. Statistical analysis was performed by using the student’s t-test. For all the primers used in the study dissociation curve or melt curve analysis was performed to check the non-specific amplification as well as or primer dimer if any.

Result and discussion

Effect of whitefly sex on begomovirus transmission efficacy

The sex dependant differential variation in the retention and transmission capability of CLCuMuV-Rawas quantified using quantitative real-time PCR through the relative expression of CLCuMuV-Rain B. tabaci and its titer in cotton plant post transmission by female and male. The primer specificity was clearly indicated by the no amplification observed with these primers both in non-infected cotton plants and non-viruleferous whitefly compared infected cotton plants and viruleferous whitefly (Fig 1A and 1B).

Fig 1

Validating the specificity of Cotton leaf curl Multan virus-Rajasthan primers in A. Non-infected (NI) and Infected Gossypium hirusutum; B. Non-viruliferous (NV) and Viruliferous (V) Bemisia tabaci; Relative amount of CLCuMuV-Ra in B. tabaci, C. n = 5 males and 5 females, D. n = 20 males and 20 females; E. Relative amount of sucrose diet fed by male and female whiteflies (n = 50), the control bar represents the diet loss due to evaporation. The fluid loss assay on water sensitive paper represented by number of blue dots shows the qualitative estimation of excretion by male and females (n = 25). The expression level (A-D) was normalized with B. tabaci β-tubulin as housekeeping gene. The error bars represent the standard deviation (n = 3) and *represents significant differences (P ≤ 0.05, Student’s t-test).

The differential transmission of Begomoviruses (CLCuV) was studied in relation to male and female whiteflies. No significant difference was observed in transmission efficiency mediated by the number of whiteflies. No significant difference was observed in CLCuMuV-Ra expression in both female and male whiteflies n = 5 and n = 20, as the single whitefly tend to retain the same amount of CLCuMuV-Ra titer but when we compare the expression of CLCuMuV-Ra on sex basis, female tends to retain higher virus load (80%) compared to males (Fig 1C and 1D). Variations in male and female size may be related to the variable feeding capacity of each sex and this, in turn, may attribute to higher virus load acquired by the females. The feeding assay gave an indication of more feeding by females compared to males, however this was statistically at par with each other (Fig 1E). On an average the female and male whitefly consumed 68.06 nl and 48.73 nl of sucrose diet in 24 h, respectively. The average amount of diet lost due to evaporation in control was 7.1 μl from total of 100 μl (Fig 1E). Feeding was further validated indirectly through comparative amount of fluid excretion by males and females. The quantitative fluid loss by females was more as compared males, which is an indicative of more excretion by females possibly due to more feeding compared to males (Fig 1E). The average number of blue dots on female released water sensitive paper were 0.0097/ mm2 compared to 0.0036 dots/ mm2 in males. The intensity as well as the size of these dots was prominent in females compared to males. The current studies with feeding assays and fluid loss are indicative of more feeding and consequently more excretion in females compared to males.

Thus at the first instance difference in viral load or virus retention in B. tabaci is sex-biased with female whiteflies tend to retain statistically significant higher viral load compared to males. Followed by quantification of virus titer, the whitefly males and females released on the test plants indicated that in female fed plants vein thickening was apparent after 14 DPI (Days Post Inoculation), whereas at this time point the male fed plants show no visual symptom of CLCuMuV-Ra (Fig 2A). Furthermore, after 25 and 32 DPI downward curling and enation, respectively were observed in female inoculated test plants, however at the same time male inoculated plants showed only mild vein thickening even after one month of inoculation (Fig 2B–2D). The percent disease incidence (PDI) at the same point of time (14DPI) was also higher (37.5) in female inoculated plants compared to male inoculated plants. The appearance of symptoms in these plants was also supported by quantifying the relative expression of CLCuVcoat protein (CP) gene, which gave a qualitative estimate of relative CLCuV titer in plants inoculated by different B. tabaci sex. The viral load in the female inoculated cotton plants was significantly higher compared to males (Fig 2E) with 74.33% higher load with 20 released females compared to an equal number of males at 14 DPI. These results clearly indicate that both male and female whiteflies were able to acquire, retain and transmit CLCuV but quantitative variations in virus load among the sex could be one of the factors which make females efficient vectors compared to males. Despite equal virus acquisition time, the virus load in males was significantly lower compared to females. This may be in support of the earlier studies suggesting higher acquisition and retention ability of females due to higher feeding capacity and larger size compared to male whiteflies [23]. Sex dependent interaction of begomoviruses and it whitefly vector has been reported in earlier studies [24-26] and few studies have also shown higher vector competence of females compared to male [27].

Fig 2

A. Early vein thickening in cotton plant after inoculation with viruliferous male and female whiteflies; B. Typical curling and enation in cotton after infection with viruliferous females; C. Downward curling in cotton plant after inoculating with viruliferous females; D. Symptomless or delayed symptoms in cotton plants after infection with viruliferous male; E. Relative amount of Cotton leaf curl Multan virus-Rajasthanin host plant normalized with histone 3 as housekeeping gene for G. hirsutum. The error bars represent the standard deviation (n = 3) and *represents significant differences (P ≤ 0.05, Student’s t-test).

Relative density of endosymbiont Arsenophonus Asia II-1 B. tabaci haplotype and its implications in virus transmission

Our first-hand results indicate that females are efficient virus transmitters due to the higher virus inoculum carried by it compared to males. However, we speculated some other possible factors which might be playing a key role in variable transmission efficiency of males and females based on our previous studies [21]. Our earlier studies implicate the role of endosymbiont Arsenophonus present in whitefly in virus transmission and thus infection status of this endosymbiont in individual sex might give some clues for sex-biased virus retention in B. tabaci. Relative densities of Arsenophonus inboth viruliferous and non- viruliferous males and females quantified using qRT-PCR through the expression of the 23SrRNA gene of the bacterium revealed significantly higher expression in females compared to males. The female non-viruliferous and viruliferous whiteflies seem to harbor significantly more Arsenophonus (55.9%) and (76.1%) than non-viruliferous and viruliferous male whitefly, respectively (Fig 3A). Further, feeding of sucrose diet supplemented with tetracycline (100 μg/ ml of diet) resulted in 76.8 and 85.1% elimination of Arsenophonus in male and female whiteflies compared to control, respectively (Fig 3B) In-depth studies are required to understand the reasons for sex-biased differential density of Arsenophonus in whitefly. Furthermore, the elimination of Arsenophonus from whitefly using tetracycline showed a 74.9% reduction in viral load in females compared to control whiteflies (Fig 3C). Similarly, in the case of Arsenophonus cured males 54.3% reduction in viral load was observed compared to control males (Fig 3C).

Fig 3

Relative amount of Arsenophonus in, A. viruliferous and non-viruliferous whitefly, B. Tetracycline fed females and males; C. Relative titer of Cotton leaf curl Multan virus-Rajasthanin tetracycline fed female and male whiteflies. The expression level was normalized using B. tabaciβ-tubulin as housekeeping gene. The error bars represent the standard deviation (n = 3) and *represents significant differences among male and female whiteflies (P ≤ 0.05, Student’s t-test).

Facultative symbionts such as Arsenophonus and Hamiltonella are known to produce a GroEL chaperonin which protects the begomoviruses during its circulatory passage inside the hemolymph and plays a crucial role in vector-mediated virus transmission [7, 8]. The present study reports 58.3% higher expression of GroEL in viruleferous whiteflies compared to non-viruleferous irrespective of sex (Fig 4A). Further, the tetracycline mediated elimination of Arsenophonus also resulted in 76.7 and 68.4% downregulation in expression of GroEL in female and male whiteflies compared to control, respectively (Fig 4B and 4C). An earlier study with Asia-II-1 haplotype of B. tabaci also suggests that Arsenophonus produces GroEL protein which binds to the CLCuV particles inside the host and aids in the protective circulatory transmission of this virus to the host plant [13]. Moreover, female-biased facultative symbiont infections have been reported earlier in Bemisia tabaci and they tend to possess a higher load of a plant virus in comparison to males [28, 29]. Similarly, in the case of Arsenophonus cured males 54.3% reduction in viral load was observed compared to control males (Fig 3C). Our earlier study suggested that the Asia-II-1 haplotype of B. tabaci carries Porteira as primary endosymbiont and Arsenophonus and Cardinium as secondary endosymbionts, while this native culture lacks Hamiltonella, Wolbachia, Rickettsia, Those studies also revealed that the elimination of Arsenophonus in whitefly using tetracycline resulted in a reduction of CLCuV titer in Arsenophonus—ve whitefly, further the transmission of the virus in cotton plants was significantly reduced compared to Arsenophonus +ve whiteflies. Taking into account the role of Arsenophonus in virus transmission reported in earlier studies and the sex-biased density of this endosymbiont in whitefly, our studies indicate that the higher titer of virus in host female may be due to the higher retention of the virus with a higher level of GroEL protein produced compared to males.

Fig 4

Relative expression of GroEL protein gene in A. Non-viruliferous and Viruliferous Bemisia tabaci B. Tetraccycline fed females C. Tetracycline fed males. The expression level was normalized with β-tubulin as housekeeping gene. The error bars represent the standard deviation (n = 3) and *represents significant differences among male and female whiteflies (P ≤ 0.05, Student’s t-test).

Sex-baised expression and functional validation of midgut proteins genes involved in virus transmission

Midgut protein genes such as Cyclophilin, Knottin, Hsp40, and Hsp70 have been implicated in virus transmissionin earlier studies. The expression of these genes in non-viruliferous and viruliferous whiteflies revealed sex-biased expression across males and females. The relative expression of these genes seems to be associated with virus titer in host whitefly as revealed through the knockdown of respective genes through dsRNA feeding.

The expression of Cyclophilin in non-viruliferous male and females was statistically at par with each other (Fig 5A). However, the viruliferous female whitefly showed 57.75% significantly higher expression of Cyclophilin than the males (Fig 5A). The higher expression of this gene might be a consequence of the virus uptake in viruliferous whiteflies compared to non-viruliferous ones. In humans, the Cyclophilin gene plays a key role as modulators for virus replication [30]. It belongs to a protein family of peptidyl-prolyl cis-trans isomerase that plays a significant role in protein refolding, maturation, gene transcription, and cell signaling [31, 32]. The dsRNA mediated knockdown of Cyclophilin resulted in 73.2 and 65.7% reduction of target gene transcripts in female and male whiteflies compared to dsGFP fed control flies, respectively (Fig 5B). The dsRNA-mediated knockdown of Cyclophilin resulted in 48.3% and 19% decreased viral titer in females and male whiteflies (Fig 5C). This is indicative that Cyclophilin plays an active role in virus transmission through virus-vector interaction, which needs to be further investigated for in-depth understanding. Earlier studies have also demonstrated the role of Cyclophilin in virus transmission as the knockdown Cyclophilin in B. tabaci resulted in a 43% decrease of TYLCV transmission [14]. Our previous study also reported that the plants exposed to Cyclophilin silenced whiteflies contained lower numbers of viral transcripts compared to control [21]. Thus the previous studies establish a direct relationship of Cyclophilin with virus transmission in different organisms including insects, and the sex- biased differential expression further supports variable transmission efficiency among transmission by male and female whiteflies.

Fig 5

Relative expression of Cyclophilin in B. tabaci, A. Non-viruliferous and Viruliferous whiteflies, B. dsRNA fed female and male whiteflies; C. Relative titer of Cotton leaf curl Multan virus-Rajasthanin Cyclophilin knockdown viruliferous female and male whiteflies. The expression level was normalized with β-tubulin as housekeeping gene. Error bars represent the standard deviation (n = 3) and *represents significant differences in expression (P ≤ 0.05, Student’s t-test).

The present studies reveal the higher expression of Knottin in males compared to females in both viruliferous and non-viruliferous whitefly with non-viruliferous males exhibiting 64.84% higher expression compared to females. Similarly, viruliferous males showed 31.19% higher expressions of Knottin compared to female whitefly (Fig 6A). Feeding of dsKnottin resulted in 84.5 and 79.8% significant decrease in mRNA levels of Knottin in female and male whiteflies compared to dsGFP fed control flies, respectively (Fig 6B). Knottins are a structural family of proteins that contain small proteins rich in disulphide with a knotted appearance [33]. Previous studies demonstrate that Knottins are involved in maintaining the amount of virus associated with whitefly vectors to a level that may not be deleterious to the host [16]. Silencing of Knottin resulted in a significant increase in viral expression in viruliferous female whiteflies, while a similar but slight increase of viral load was also observed in viruliferous male whiteflies. Downregulation of Knottin resulted in 80.7% more viral load in females when compared to GFP-fed female whiteflies (Fig 6C). However, knockdown of Knottin in males showed 20.7% more viral transcripts when compared to control male flies (Fig 6C). The earlier studies have also reported an increase in virus ingestion by the whitefly or transmission efficiency by several-fold through silencing Knottin in whitefly by feeding them on dsRNA [16]. Our previous studies also suggest that dsRNA-mediated knockdown of Knottin in whiteflies resulted in 1.9 fold increase in virus titer compared to control and ultimately resulted in 2.0 fold higher transmission efficiency of virus in cotton plants by the dsRNA mediated Knottin knockdown whiteflies [21]. Thus the lower expression of Knottin in females may be another possible factor responsible for higher virus transmission efficiency compared to males.

Fig 6

Relative expression of Knottin in B. tabaci, A. Non-viruliferous and Viruliferous whiteflies, B. dsRNA fed female and male whiteflies; C. Relative titerof Cotton leaf curl Multan virus-Rajasthanin Knottin knockdown viruliferous female and male whiteflies. The expression level was normalized with β-tubulin as housekeeping gene. Error bars represent the standard deviation (n = 3) and *represents significant differences in expression (P ≤ 0.05, Student’s t-test).

In a similar context present study reveals that the relative expression of Hsp’s was higher in males as compared to females either in non-viruliferous or viruliferous whiteflies. The relative expression of Hsp40 was 82.05 and 61.61% in non-viruliferous and viruliferous males, respectively, which was significantly higher compared to females (Fig 7A). Similarly, in the case of Hsp70, the non-viruliferous and viruliferous males showed 55.19% and 58.28%, respectively higher expression than females (Fig 8A). The feeding of dsRNA against Hsp 40 resulted in 80.7 and 86.9% reduction in mRNA levels of this gene in female and male flies compared to control, respectively (Fig 7B). The corresponding figures for Hsp70 were 79.2 and 82.3% in female and male whiteflies compared to dsGFP fed control flies, respectively (Fig 8B). Heat shock proteins are universally present in most of the organisms and have been nomenclature based on their molecular weight into Hsp100, Hsp90, Hsp70, Hsp60, Hsp40, and small Hsps (size>30kDa), which is represented by the numeric prefix in the name of respective Hsp [34]. Hsp70 isoforms have also been reported to play a role in the entry of dengue virus, its replication, and biogenesis in mosquitoes [35]. Our previous studies suggest that silencing of Hsp40 and Hsp70 in whitefly affected the virus titer in whitefly and consequently increased transmission of CLCuMuV-Rain cotton [21]. The activity of both Hsp40 and Hsp70 is interdependent as Hsp40 functions as co-chaperon acting as a DnaJ dimer which stimulates the ATPase activity of Hsp70 [36, 37]. It is thus inferred from these studies that the higher expression of Hsp40 and 70 might be contributing to poor transmission efficiency of CLCuMuV-Raby males compared to female whiteflies. Further, the dsRNA-mediated silencing of Hsp70 and Hsp40 resulted in an increase in viral transcripts in viruliferous females as compared to males. Knockdown of Hsp 70 and Hsp 40 in females resulted in 89.8 and 74%, respectively more viral load compared to GFP-fed female whiteflies (Figs 7C and 8C). A similar increase of 22 and 18% were observed with dsRNA mediated knockdown of Hsp70 and Hsp40, respectively in males when compared to control. Previous studies reported that Hsp70 and Hsp40 act by minimizing the potential long-term harmful effects of the virus on the whitefly [9]. Our previous studies with bulk whitefly populations confirm and support our recent results in which silencing the expression of Hsp70 and Hsp 40 resulted in an increase in CLCuMuV-Ratiter and transmission by vector B. tabaci [21]. Sex-biased expression of Hsp70 and Hsp40 and previous studies suggest that these heat shock proteins may be acting as a negative regulator of the virus which inhibits the circulatory passage of virus within the host [15, 21].

Fig 7

Relative expression of Hsp40 in B. tabaci, A. Non-viruliferous and viruliferous whiteflies, B. dsRNA fed female and male whiteflies; C. Relative titer of Cotton leaf curl Multan virus-Rajasthanin Hsp40 knockdown viruliferous female and male whiteflies. The expression level was normalized with β-tubulin as housekeeping gene. Error bars represent the standard deviation (n = 3) and *represents significant differences in expression (P ≤ 0.05, Student’s t-test).

Fig 8

Relative expression of Hsp70 in B. tabaci, A. Non-viruliferous and Viruliferous whiteflies, B. dsRNA fed female and male whiteflies; C. Relative titer of Cotton leaf curl Multan virus-Rajasthanin Hsp70 knockdown viruliferous female and male whiteflies. The expression level was normalized with β-tubulin as housekeeping gene. Error bars represent the standard deviation (n = 3) and *represents significant differences in expression (P ≤ 0.05, Student’s t-test).

The present study first time reports the clues in sex-biased transmission efficiency of CLCuMuV-Rain a female and male Asia-II-1 haplotype of B. tabaci. Based on the results it may be inferred that there are multiple factors that play a role towards variable efficiency of the female towards the transmission of the virus. The large size of female whitefly and consequently more feeding compared to males may be attributed to more virus accumulation compared to males. For successful transmission, the virus has to pass certain barriers such as the midgut wall to reach into the hemolymph and finally to accumulate in the primary salivary gland from where it reaches into the host plant [38, 39]. Therefore variable viral movement and retention ability while following a circulatory route as perceived from viral load within the male and female whiteflies may contribute to differential transmission patterns. The more viral load retained by female whiteflies due to multiple factors studied might be leading to the passage of more viruses from hemolymph to primary salivary glands compared to males. Variance in vector competence has been speculated to impart differential capacity of the virus to cross barriers within the body of different whitefly species [38, 39]. The persistent transmission of the virus within the whitefly is also mediated by the endosymbiont partner which provides a protective barrier to the virus while its passage from hemolymph [8, 40]. Higher density or more accumulation of endosymbiont Arsenophonus in females may be a contributory factor towards higher transmission efficiency of females. The low expression of Cyclophilin and higher expression of Hsp40, Hsp70 and Knottin in males might be another factor for the low transmission efficiency of male whiteflies. Taken together, we found that in the Asia II-1 haplotype of whiteflies, midgut proteins and facultative endosymbiont Arsenophonus has a profound influence in shaping sex-biased differential virus transmission (S1 Graphical abstract). However, variable endosymbiont density or variable expression mid-gut protein genes across sex is a researchable issue and needs in-depth studies to better understand virus-vector sex interactions.

A. Maintenance of virus free plants inside insect proof cages B. Clip inoculation setup for whitefly inoculation C. Cup cages for whitefly inoculation.

(PDF)

Click here for additional data file.

Morphological distinction of male (♂) and female (♀) whiteflies based upon size and shape of ovipositor.

(PDF)

Click here for additional data file.

Artificial feeding set up for oral feeding access to whiteflies.

(PDF)

Click here for additional data file.

(TIF)

Click here for additional data file.

22 Jun 2021

PONE-D-21-14850

Is Cotton Leaf Curl Virus transmission by Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) sex-biased?

PLOS ONE

Dear Dr. Singh,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Aug 06 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Rajarshi Gaur

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that you have referenced (ie. Bewick et al. [5]) which has currently not yet been accepted for publication. Please remove this from your References and amend this to state in the body of your manuscript: (ie “Bewick et al. [Unpublished]”) as detailed online in our guide for authors

http://journals.plos.org/plosone/s/submission-guidelines#loc-reference-style

3. We note that Figure 2 and Supplementary Figures 1, 2 and 3 in your submission contain copyrighted images. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For more information, see our copyright guidelines: http://journals.plos.org/plosone/s/licenses-and-copyright.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

1. You may seek permission from the original copyright holder of Figures 2 and Supplementary Figures 1, 2 and to publish the content specifically under the CC BY 4.0 license.

We recommend that you contact the original copyright holder with the Content Permission Form (http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:

“I request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0 (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.”

Please upload the completed Content Permission Form or other proof of granted permissions as an "Other" file with your submission.

In the figure caption of the copyrighted figure, please include the following text: “Reprinted from [ref] under a CC BY license, with permission from [name of publisher], original copyright [original copyright year].”

2. If you are unable to obtain permission from the original copyright holder to publish these figures under the CC BY 4.0 license or if the copyright holder’s requirements are incompatible with the CC BY 4.0 license, please either i) remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Review Comments to the Authors:

This study by Singh et al focuses on the sex-biased transmission efficiency of Cotton Leaf Curl Virus (CLCuV) by Bemisia tabaci. The gender dependent differential variation was validated by using quantitative real-time PCR through the relative expression of CLCuV coat protein. The female whiteflies acquired and transmitted higher viral load compared to males. The authors identified that the higher density of Arsenophonus and differential expression of Cyclophilin, Knottin, Hsp40, Hsp70 of the midgut genes may possibly contribute to higher vector competency to females compared to males. This study advances our understanding to key players involved in sex biased CLCuV transmission. Overall, the study is novel and well conceptualized, however there are some points which need to be addressed before consideration to publish.

Major comments:

1. The CLCuV coat protein real-time PCR primers used for this study should be tested on non-infected whitefly as well as non-infected plant to ensure there is not any non-specific binding.

2. Line 264-266 explained Fig 3c and indicating expression levels of CLCuV coat protein, but the figure legends are indicating these are Arsenophonus levels. Please update the figure legends.

3. As reported, there is differential level of expression of the genes in male and female so the efficiency of knock down (KD) using same amounts dsRNA for both male as well as female could be different and that may affect the observations. Indeed, the transmission efficiency of KD female is reduced more compared to KD males which is in consistent with the study. Ideally, it is important to normalize the gene expression in knockdown male as well as females. In short, authors should provide data for the expression levels of Arsenophonus in tetracycline fed/control male as well as female to validate the knock down for Arsenophonus. Also, it would have been interesting to have the comparative expression levels of GroEL during acquisition or transmission to strengthen and complement the data.

4. The authors should provide data for the expression levels of Cyclophilin in dsRNA fed/control male and female to validate the authenticity of knockdowns. Similar data should be provided for Knottin, Hsp40, Hsp70 as proof of concept.

5. Fig.6c data plot should be in comparison to male versus GFP fed control. Similarly, for fig.6d data plot should be comparison to female versus GFP fed control. Please update the labels on data plots.

6. It was quite evident that the expression levels of Arsenophonus, Knottin, Hsp40, Hsp70 in viruliferous flies are higher in comparison to non- viruliferous flies irrespective of gender. But the expression levels of Cyclophilin are lower in viruliferous flies in comparison to non-viruliferous flies. The authors should address that in the manuscript.

Minor comments:

1. The male and female should be represented with different color for better representation of the graphs.

2. The authors should label Y-axis for all the data plots for consistency throughout the manuscript.

3. The statistics analysis is missing for the graphs Fig.1 c, Fig.3 d, Fig.4 a, c, d, Fig.5 a, b, c, Fig.6 d, Fig.7 c.

4. Primers in Table 1 should be cross validated as the forward and reverse primers for HSP40 cannot be identical.

5. Please provide the details (accession number or Uniprot ID) in methods section for the CLCuV coat protein sequence used for designing the primers for real-time PCR. Also, adding details of the source of Cotton Leaf Curl Rajasthan Virus would be better.

6. It is also recommended to provide additional details in methods sections for the software or tools used to analyze real time data, statistical and image analysis.

7. Line 220 please provide the full form for DOI.

Reviewer #2: Whitefly, Bemisia tabaci (Gennadius) is an important pest of cotton as vector of Cotton Leaf Curl Virus (CLCuV) and the paper showed B. tabaci AsiaII-1 haplotype showing higher virus transmission efficiency of females than males. The transmission is related to the density of endosymbiont Arsenophonus, but the expression of some midgut proteins genes i.e. Cyclophilin, Knottin, Hsp40, Hsp70 may be possibly associated with the vector competency of both sex. All the results might not give us explicit conclusions that females treated by knocked-down or antibiotics could directly show higher competency to transmit the virus.

My suggestion is that authors just focus on the role of one of endosymbionts and its midgut protein on the sex-biased transmission of whitefly. However, the title “Is Cotton Leaf Curl Virus transmission by Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) sex-biased?” does not fully explain and cover all main ideas of the manuscript, i.e. the relation the sex-biased of transmission with endosymbionts and their proteins.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: Peer Review Report PLOS.docx

Click here for additional data file.

28 Jul 2021

Editor’s comments:

1 Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming

Manuscript has been modified according to Plos one style as suggested.

2 We note that you have referenced (ie. Bewick et al. [5]) which has currently not yet been accepted for publication. Please remove this from your References and amend this to state in the body of your manuscript: (ie “Bewick et al. [Unpublished]”) as detailed online in our guide for authors

Reference has been deleted as per suggestion

3. We note that Figure 2 and Supplementary Figures 1, 2 and 3 in your submission contain copyrighted images. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution.

We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:

Figure 2 and Supplementary Figures 1, 2 and 3 have been clicked by us in our lab/ greenhouse setup. So we do not need to seek any permissions for using these figures in our manuscript.

However, S1 Fig. contains pictures of cages purchased from Bugdrom Store (Taiwan). The permission from the manufacturer has been sought to use the picture of cages in manuscript (permission under the CC BY 4.0 license has been attached)

Reviewer 1:

1. The CLCuV coat protein real-time PCR primers used for this study should be tested on non-infected whitefly as well as non-infected plant to ensure there is not any non-specific binding.

The CLCuV coat protein primers has been validated on non-viruliferous and viruliferous whiteflies and plants. Details added in Fig 1.

2. Line 264-266 explained Fig 3c and indicating expression levels of CLCuV coat protein, but the figure legends are indicating these are Arsenophonus levels. Please update the figure legends.

Done

3As reported, there is differential level of expression of the genes in male and female so the efficiency of knock down (KD) using same amounts dsRNA for both male as well as female could be different and that may affect the observations. Indeed, the transmission efficiency of KD female is reduced more compared to KD males which are in consistent with the study. Ideally, it is important to normalize the gene expression in knockdown male as well as females. In short, authors should provide data for the expression levels of Arsenophonus in tetracycline fed/control male as well as female to validate the knock down for Arsenophonus. Also, it would have been interesting to have the comparative expression levels of GroEL during acquisition or transmission to strengthen and complement the data.

We thanks reviewer for this comment. The knocked down after tetracycline feeding in female and male relative to control female and male whiteflies has been validated and added in main text along with figure and statistical data. As per suggestion comparative expression levels of GroEL during acquisition or transmission has been conducted and incorporated in Fig 4.

4. The authors should provide data for the expression levels of Cyclophilin in dsRNA fed/control male and female to validate the authenticity of knockdowns. Similar data should be provided for Knottin, Hsp40, Hsp70 as proof of concept

The relative expression Cyclophilin, Knottin, Hsp40 and Hsp70 in dsRNA fed and control male and female has been validated using RT-PCR and statistical analysis was performed by Student t-Test. The data has been added in main text body and Fig 5, 6, 7 and 8

5. Fig.6c data plot should be in comparison to male versus GFP fed control. Similarly, for fig.6d data plot should be comparison to female versus GFP fed control. Please update the labels on data plots.

Fig. 6c and 6d has been rephrased to updated to panel Fig. 7C and labels have been updated as per suggestions.

Minor Comments

1. The male and female should be represented with different color for better representation of the graphs.

Male and female has been represented by different colours in all the figures

2. The authors should label Y-axis for all the data plots for consistency throughout the manuscript.

Done

3. The statistics analysis is missing for the graphs Fig.1 c, Fig.3 d, Fig.4 a, c, d, Fig.5 a, b, c, Fig.6 d, Fig.7 c.

The data have been analysed by Student’s T test and this has been mentioned in the text

4. Primers in Table 1 should be cross validated as the forward and reverse primers for HSP40 cannot be identical.

This has been changed as suggested.

5. Please provide the details (accession number or Uniprot ID) in methods section for the CLCuV coat protein sequence used for designing the primers for real-time PCR. Also, adding details of the source of Cotton Leaf Curl Rajasthan Virus would be better.

Accessions have been mentioned in the text. Inadvertently we have written the virus name as Cotton Leaf Curl Rajasthan Virus in place of Cotton Leaf Curl Multan-Rajasthan Virus and this is the correct classification as per ICTV Code. The virus strain has been continuously maintained on cotton plants and is crosschecked time to time for its purity.

6. It is also recommended to provide additional details in methods sections for the software or tools used to analyze real time data, statistical and image analysis.

Details have been added in materials methods.

7. Line 220 please provide the full form for DOI.

The DOI has been replaced by DPI (Days Post Inoculation)

Reviewer 2

1. Whitefly, Bemisia tabaci (Gennadius) is an important pest of cotton as vector of Cotton Leaf Curl Virus (CLCuV) and the paper showed B. tabaci AsiaII-1 haplotype showing higher virus transmission efficiency of females than males. The transmission is related to the density of endosymbiont Arsenophonus, but the expression of some midgut proteins genes i.e. Cyclophilin, Knottin, Hsp40, Hsp70 may be possibly associated with the vector competency of both sex. All the results might not give us explicit conclusions that females treated by knocked-down or antibiotics could directly show higher competency to transmit the virus. My suggestion is that authors just focus on the role of one of endosymbionts and its midgut protein on the sex-biased transmission of whitefly. However, the title “Is Cotton Leaf Curl Virus transmission by Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) sex-biased?” does not fully explain and cover all main ideas of the manuscript, i.e. the relation the sex-biased of transmission with endosymbionts and their proteins.

This is a good suggestion and keeping in view the reviewers comments we have revised the title of manuscript title highlighting Arsenophonus and gut proteins.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

4 Oct 2021

PONE-D-21-14850R1Differential expression of gut protein genes and population density of Arsenophonus contributes to sex-biased transmission of Bemisia tabaci vectored Cotton leaf curl virusPLOS ONE

Dear Dr. Singh,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Nov 18 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Rajarshi Gaur

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #3: N/A

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This study by Singh et al, provides substantial evidence of correlation between sex based differential gene expression and transmission efficiency of Cotton Leaf Curl Virus (CLCuV) by Bemisia tabaci. The study was conducted using B. tabaci Asia II-1 halotype and the virus transmission efficiency of females was reported significantly higher over males. The authors have addressed majority of the comments from both the reviewers. However, I have mentioned few important concerns which should be addressed before consideration for publishing. Therefore, I would recommend acceptance with minor revision.

1- The color codes for the data plots are not consistent for example female are orange and controls are white in Fig-1 but in Fig 3B and 3C both male and female are blue, and controls became orange. Please try to maintain consistent colors throughout the manuscript.

2- Please provide the accession number if available for the coat protein sequence of the CLCuMuV-Ra which was used to design the real time primers for this study.

3- The real time PCR reaction conditions mentioned in lines 119-121 are different from lines 150-152, but both were used for the detection of coat protein either from whiteflies or from infected plants. Please justify.

4- Lines 229 and 230 please correct nl to microliters.

5- Fig1 E the fluid loss assay data is not clear as blue dots are not easy to visualize.

6- Lines 279-280 belong to Fig 3 legends to my understanding. Please correct accordingly.

7- The relative levels of Arsenophonus in non-viruliferous whiteflies are significantly higher than viruliferous whiteflies (Fig 3A) which is not corelating with the relative levels of GroEL. The relative amounts of GroEL are lower in non-viruliferous whiteflies in comparison with viruliferous whiteflies (Fig 4A) Please cross-check if there is labelling error in data plots of Fig3A or justify.

8- Line 343 the expression levels of cyclophilin in non-viruliferous males and females are not at par in Fig 5A. As Fig 5A data plots clearly indicate that females have higher levels of cyclophilin in viruliferous as well as non-viruliferous whiteflies. Please modify accordingly.

9- Fig 7B the control females have higher levels of Hsp40 than control males while Fig 7A clearly states females express lesser amounts of Hsp40. Similarly, Fig 8B the control females have slightly higher levels of Hsp70 than control males which is contradictory to data in 8A. Please correct the controls accordingly to support the data for 7A and 8A.

10- Fig 5C, 6C, 7C, 8C the control females have lower virus transmission rate than control males while Fig 1 clearly indicates female have higher transmission rate than males it is not consistent with the hypothesis throughout the manuscript. Please add corrections accordingly or provide justification.

Reviewer #3: The MS entitled "Differential expression of gut protein genes and population density of Arsenophonus contributes to sex-biased transmission of Bemisia tabaci vectored Cotton leaf curl virus" is in present form is suitable for the publication

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: review comments_.docx

Click here for additional data file.

16 Oct 2021

We are grateful to the reviewers for spending their time for the critical and valuable comments in the manuscript. We extend our heartfelt thanks to Reviewer 1 for critical analysis of the figures which has helped us to correct the inadvertent cut and copy mistakes in the Fig 3A and 7 B. We have tried to address each and every query raised by the reviewer. The point to point rebuttal has been given below:

Reviewer comment:The color codes for the data plots are not consistent for example female are orange and controls are white in Fig-1 but in Fig 3B and 3C both male and female are blue, and controls became orange. Please try to maintain consistent colors throughout the manuscript

Authors response: Colour codes of the figures have been modified as suggested.

Reviewer Comment: Please provide the accession number if available for the coat protein sequence of the CLCuMuV-Ra which was used to design the real time primers for this study.

Authors response: The accession no of CLCuMuV-Ra virus is provided in line no 98.As per suggestion this is also incorporated in lines 131and 132

Reviewer Comment: The real time PCR reaction conditions mentioned in lines 119-121 are different from lines 150-152, but both were used for the detection of coat protein either from whiteflies or from infected plants. Please justify.

Authors Response: The conditions have been made uniform. Apologies for this error, inadvertently the protocol for three step amplification, which is also commonly used in our lab was written at 119-121.

Reviewer Comment: Lines 229 and 230 please correct nl to microliters

Authors Response: The total diet consumption in male and female (n=50) whiteflies was 2.4 and 3.4 µl after subtracting the diet loss from control (Fig 1E) and the diet consumption was converted in nl/ adult. So the nl is the correct representation. The same has been explained in text section.

Reviewer Comment: Fig1 E the fluid loss assay data is not clear as blue dots are not easy to visualize

Authors Response: The images have been converted into tiff format and are clearer. Thanks to reviewer for this comments as we have missed to put the methodology for this experiment and the same has been incorporated in the manuscript under “Feeding and Fluid loss assay”

Reviewer Comment: Lines 279-280 belong to Fig 3 legends to my understanding. Please correct accordingly

Authors Response: The subtitle of the next paragraph was merged with Fig. 2 legends. It has been corrected by spacing.

Reviewer comment: The relative levels of Arsenophonus in non-viruliferous whiteflies are significantly higher than viruliferous whiteflies (Fig 3A) which is not corelating with the relative levels of GroEL. The relative amounts of GroEL are lower in non-viruliferous whiteflies in comparison with viruliferous whiteflies (Fig 4A) Please cross-check if there is labelling error in data plots of Fig3A or justify.

Authors Response: We appreciate the reviewer’s critical analysis for Fig 3 A and & 7 B as both figures were wrongly pasted from excel. In Fig 3A the cq-values were mistakenly plotted which shows huge variability across the y-axis of plots. The graphs for Fig 3A has been replotted with correct values and incorporated in the Manuscript.

Reviewer comment: Line 343 the expression levels of cyclophilin in non-viruliferous males and females are not at par in Fig 5A. As Fig 5A data plots clearly indicate that females have higher levels of cyclophilin in viruliferous as well as non-viruliferous whiteflies. Please modify accordingly.

Authors Response: Here we mean to say that the expression of cyclophilin in non-viruliferous males and females are statistically at par with each other as we these values are not significantly different as per Student’s t test. We have reformatted the line by addition ‘statistically at par with each other’

Reviewer Comment: Fig 7B the control females have higher levels of Hsp 40 than control males while Fig 7A clearly states females express lesser amounts of Hsp40

Authors Response: As mentioned earlier, the inadvertent mistake in plotting Fig. 7B, the data has been crosses checked and the correct plot has been incorporated in the manuscript. The percent knockdown 80.7 was correctly mentioned in the text earlier.

Reviewer Comment: Similarly, Fig 8B the control females have slightly higher levels of Hsp70 than control males which is contradictory to data in 8A. Please correct the controls accordingly to support the data for 7A and 8A.

Fig 5C, 6C, 7C, 8C the control females have lower virus transmission rate than control males while Fig 1 clearly indicates female have higher transmission rate than males it is not consistent with the hypothesis throughout the manuscript. Please add corrections accordingly or provide justification.

Authors Response:

We agree to the reviewer perspective but each graph of panel is as a result of one experimentation under one set of conditions. It is not possible to compare the y-axis of the every plot in each panel of the figures or even across the figures. The reason is that every graph is a result of different biological sample under different set of experimental conditions which gives variation in housekeeping gene and PCR efficiency in spite of all efforts to keep the things same throughout the experimentation process. This can also be visualized from the variation in Standard deviation across all the figures. The results were interpreted on the basis of target gene in male and female relative to its reference control normalized with housekeeping gene at that point of time or that very single qPCR reaction so the two figures in each panel represent a relative expression in two different set of qPCR reactions.

Moreover, for Fig 8B slighter variation is clearly indicated by the ±0.01 value of SD bar in female control as compared to male controls.Thus we again emphasis that these graphs are generated on the basis of multiple experiments and replicates, the comparison of Y-axis values across graphs, which show slight experimental variations in Fig 5C, 6C, 7C, 8C is not possible.

19 Oct 2021

Differential expression of gut protein genes and population density of Arsenophonus contributes to sex-biased transmission of Bemisia tabaci vectored Cotton leaf curl virus

PONE-D-21-14850R2

Dear Dr. Singh,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Rajarshi Gaur

Academic Editor

PLOS ONE

26 Oct 2021

PONE-D-21-14850R2

Differential expression of gut protein genes and population density ofArsenophonus contributes to sex-biased transmission of Bemisia tabacivectored Cotton leaf curl virus

Dear Dr. Singh:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Professor Rajarshi Gaur

Academic Editor

PLOS ONE