Literature DB >> 31949196

Higher Ramie mosaic virus transmission efficiency by females than by males of Bemisia tabaci MED.

Jing Peng1,2, Gang Xie2, Songbai Zhang2, Limin Zheng2, Yang Gao2, Zhuo Zhang2, Luyun Luo2, Pin Su2, Dongwei Wang2, Yong Liu2, Liangying Dai3, Deyong Zhang4,5.   

Abstract

Begomoviruses can modify their transmission vector, Bemisia tabaci, to benefit their spread, although this may not always be the case. Here, the new begomovirus Ramie mosaic virus (RaMoV) and its vector B. tabaci MED, which is dominant in China and many regions of the world, were used as a model to examine direct and indirect interaction and virus transmission by B. tabaci MED of different sexes. No significant direct or indirect effects of RaMoV were observed in B. tabaci MED females, although RaMoV could shorten the life span of B. tabaci MED females by up to 4 days. A test of RaMoV transmission by different sexes of B. tabaci MED showed that there was higher virus transmission efficiency by females than males. Overall, RaMoV is transmitted by B. tabaci MED in a sex-dependent manner, and further research is needed to uncover the mechanism of the difference in RaMoV transmission by different sexes of B. tabaci.

Entities:  

Mesh:

Year:  2020        PMID: 31949196      PMCID: PMC6965624          DOI: 10.1038/s41598-019-57343-5

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Approximately 80% of epidemic plant viruses in the field are transmitted by insect vectors from plant to plant and spread to distantly located regions in this way[1]. The whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) is a species complex with a worldwide distribution, and at least 35 cryptic species are widely recognized based on the evidences of molecular phylogenetic data and reciprocity between genetic groups[2]. Of these cryptic species, two invasive species, Mediterranean (MED) and Middle East-Asia Minor 1 (MEAM1), severely harm plants by direct feeding and by indirect transmitting plant viruses[3]. Plant viruses are not passively transmitted by their vectors; instead, they can produce direct and indirect effects on the vectors to modify their behaviour, life span and fitness to benefit their own transmission. Tomato yellow leaf curl virus (TYLCV) could directly mediate the behaviours of its vector, whitefly, including settling, probing and feeding, to enhance its transmission efficiency[4,5]. In the case of a plant virus indirectly affecting its vector, the fecundity, longevity and population density of whiteflies increased when feeding on Tomato yellow leaf curl virus (TYLCV)-infected tobacco plants[6-9]. In addition to the direct and indirect mutual relationships of plant viruses and their vectors, plant virus transmission efficiency by whitefly is relatively different depending on sex. Compared with males of B. tabaci MEAM1, females possessed higher TYLCV transmission efficiency on tomato plants[10]. A similar sex-based difference in transmission efficiency was also found in B. tabaci MED[11]. The capacity of vectors to acquire, retain, and transmit plant viruses is critical information for inferring plant virus epidemiology[12]. Although the characteristics of acquisition, retention and transmission of several plant viruses in the genus Begomovirus by B. tabaci have been well documented[11,13-15], the detailed characteristics of the begomoviruses transmitted by B. tabaci still require additional study to understand the outbreaks of Begomovirus in the world. Ramie mosaic virus (RaMoV) is a new bipartite begomovirus that was documented from infected Boehmeria leiophylla[16,17]. Plant viruses in the genus Begomovirus are important pathogens in the tropical and sub-tropical regions of the world, are exclusively transmitted by whitefly in a persistent-circulative mode[18] and severely damage a wide range of economic crops, such as tomato, pepper and tobacco[19]. It is rational to deduce that RaMoV would be a potential threat to important crops. In recent years, B. tabaci MED has progressively become a dominant species in China[20-23]; thus, in this study, direct and indirect effects were examined using the RaMoV and B. tabaci MED model. In addition, the acquisition, retention and transmission of RaMoV by the different sexes of B. tabaci MED was compared. The results would scientifically evaluate the potential epidemiology of RaMoV in the field.

Result

Symptoms of RaMoV-infected tobacco plants

To determine the indirect effects of RaMoV on B. tabaci MED, RaMoV-infected tobacco plants were produced. Tobacco plants with 6 true leaves were inoculated with RaMoV in the 3rd leaf by Agrobacterium tumefaciens containing an infectious clone of RaMoV. At 10 dpi, compared with healthy tobacco plants, RaMoV-infected tobacco plants were severely stunted and lacked apical dominance. The new leaves of RaMoV-infected tobacco plants manifested shrivelling and mosaic symptoms (Fig. 1).
Figure 1

Symptoms of RaMoV-infected (VP) tobacco plants (10 dpi).

Symptoms of RaMoV-infected (VP) tobacco plants (10 dpi).

Direct and indirect effects of RaMoV on longevity and fecundity of B. tabaci MED

To determine the direct effects of RaMoV on females of B. tabaci MED, viruliferous and non-viruliferous females of B. tabaci MED fed on healthy cucumber plants, which are not natural hosts of RaMoV. As shown in Fig. 2, although the life span of the viruliferous females of B. tabaci MED was 4 d shorter than that of the non-viruliferous females of B. tabaci MED (31–35 d), the difference was not significant (F1,80 = 0.503, P = 0.480). Figure 2 also revealed that no significant difference (F1,80 = 0.533, P = 0.467) in the fecundity of females of B. tabaci MED was associated with RaMoV (Fig. 2A).
Figure 2

Direct and indirect effects of RaMoV on longevity and fecundity of B. tabaci MED. (A) Direct effects on B. tabaci MED by RaMoV; HQ: non-viruliferous B. tabaci MED; VQ: viruliferous B. tabaci MED; (B) Indirect effects on B. tabaci MED by RaMoV; HT: healthy tobacco; GVY: tobacco inoculated with Agrobacterium tumefaciens without RaMoV plasmid; VT: RaMoV-infected tobacco.

Direct and indirect effects of RaMoV on longevity and fecundity of B. tabaci MED. (A) Direct effects on B. tabaci MED by RaMoV; HQ: non-viruliferous B. tabaci MED; VQ: viruliferous B. tabaci MED; (B) Indirect effects on B. tabaci MED by RaMoV; HT: healthy tobacco; GVY: tobacco inoculated with Agrobacterium tumefaciens without RaMoV plasmid; VT: RaMoV-infected tobacco. The indirect impacts on fecundity and longevity of females of B. tabaci by RaMoV were examined via three treatments with non-viruliferous females of B. tabaci MED on healthy tobacco plants, RaMoV-infected tobacco plants and tobacco plants inoculated with A. tumefaciens without the RaMoV plasmid. As Fig. 2 shows, the mean number of eggs (F2,96 = 0.012, P = 0.988) and the longevity (F2,96 = 0.672, P = 0.513) of B. tabaci MED females were not significantly different among the three treatments (Fig. 2B).

Acquisition of RaMoV DNA by different sexes of B. tabaci MED

The RaMoV acquisition capability of different sexes of B. tabaci MED was compared. RaMoV DNA attained maximal viral loads in both females and males of B. tabaci MED at 48 h AAP (Ffemale 5,12 = 78.817, P = 0.002) (Fmale 5,12 = 419.587, P < 0.001) and decreased after 48 h. During the whole AAP in which B. tabaci acquired RaMoV, the females acquired more virus than the males; the difference was not significant in the 6–48 h AAPs (P > 0.05) and was significant at 72 h AAP (P < 0.05) (F1,4 = 9.259, P = 0.038) (Fig. 3).
Figure 3

Acquisition of RaMoV DNA by B. tabaci MED gender.

Acquisition of RaMoV DNA by B. tabaci MED gender.

Retention of RaMoV DNA by different sexes of B. tabaci MED

As B. tabaci MED loads maximal RaMoV DNA at 48 h AAP on RaMoV-infected tobacco, the female and male populations of B. tabaci MED fed on RaMoV-infected tobacco for 48 h were then transferred to healthy cucumber plants. At day 0, the relative amount of RaMoV DNA retained in females was greater than in males of B. tabaci. The RaMoV DNA amount plunged from day 0 to day 6 (Ffemale 6,14 = 16.380, P < 0.001) (Fmale 6,14 = 8.030, P = 0.001) and equilibrated from day 9 to day 18 in both sexes of B. tabaci. The retained RaMoV DNA in females was always higher than that in males of B. tabaci, and the difference was significant from day 12 to day 15 (F12day 1,4 = 11.868, P = 0.026) (F15day 1,4 = 11.700, P = 0.027) (Fig. 4).
Figure 4

Retention of RaMoV DNA by different sexes of B. tabaci MED.

Retention of RaMoV DNA by different sexes of B. tabaci MED.

Transmission of RaMoV DNA by different sexes of B. tabaci MED

The transmission efficiency of RaMoV by different sexes of B. tabaci MED was determined, and RaMoV-infected tobacco was verified by conventional PCR. As shown in Fig. 5A, the transmission efficiency of RaMoV by females was higher than by males of B. tabaci MED. The transmission efficiency of RaMoV by one female could reach 66.67% when fed on tobacco for 7 d and 75% for 14 d, while that by two females could reach 100% for both 7 d and 14 d. However, lower than 40% transmission efficiency of RaMoV to tobacco by one male of B. tabaci was observed for 7 d or 14 d.
Figure 5

Transmission of RaMoV by DNA by different sexes of B. tabaci MED. (A) Transmission efficiency of RaMoV by different sexes of B. tabaci; (B) Relative amount of RaMoV DNA in tobacco leaves transmitted by different sexes of B. tabaci.

Transmission of RaMoV by DNA by different sexes of B. tabaci MED. (A) Transmission efficiency of RaMoV by different sexes of B. tabaci; (B) Relative amount of RaMoV DNA in tobacco leaves transmitted by different sexes of B. tabaci. The relative amount of RaMoV DNA accumulation in tobacco leaves inoculated by B. tabaci of different sexes was estimated. As shown in Fig. 5B, virus DNA accumulation in tobacco leaves infested by females of B. tabaci MED was much higher than by males. The highest difference was up to 33.25-fold virus DNA accumulation in tobacco leaves exposed to two females compared to two males of B. tabaci MED at 7 d. However, the virus DNA accumulation in the tobacco leaves was not significantly different among the four treatments (one male, two males, one female, two females) after 7 d (F3,26 = 0.984, P = 0.416) and 14 d (F3,26 = 1.400, P = 0.262).

Discussion

It is well known that plant viruses have co-evolved with their transmission vectors and benefited via enhanced virus transmission[4,24]. Nevertheless, distinct effects of certain plant viruses on their vectors exist, and such interactions are ambiguous[25]. This study revealed, using a new bipartite begomovirus, RaMoV, and its vector, B. tabaci MED, as a model, that there is no significant direct or indirect effect of RaMoV on females of B. tabaci MED (Fig. 2). This result is reminiscent of another bipartite begomovirus, Tomato mottle virus (ToMoV), which also had no significant effect on the fertility and longevity of its whitefly vector[26]. However, the begomovirus Tomato yellow leaf curl china virus (TYLCCNV) could significantly decrease the fertility and longevity of females of B. tabaci[6]. The direct and indirect effects of RaMoV and its vector, females of B. tabaci MED, together with a previous study, reconfirmed the disparate interactions of plant viruses and their vectors. Our data show that both females and males of B. tabaci are able to acquire, retain and transmit RaMoV, and the ability of females to acquire and retain the RaMoV DNA was significantly higher than that of males (Figs. 3, 4). This indicates that females could transmit more RaMoV DNA to host plants than males of B. tabaci MED, and the transmission efficiency results (Fig. 5) also verified this tendency. This result was consistent with those achieved for other begomoviruses and their vectors: that B. tabaci transmits begomovirus in a sex-dependent manner, and higher transmission efficiency achieved by females[11,27,28]. Females acquired and retained much more RaMoV DNA than males of B. tabaci MED, which was possibly dependent on the feeding capacity of females being higher than that of males of B. tabaci[4]; however, the relationship between B. tabaci feeding behaviour and its virus acquisition ability still needs to be confirmed. In conclusion, this study showed that a new begomovirus, RaMoV, has no significant direct or indirect effect on its vector, B. tabaci MED, that RaMoV transmitted by B. tabaci MED in a sex-dependent manner, and that higher transmission efficiency is shown by females. Further research is needed to uncover the mechanism of the difference in transmission of RaMoV by B. tabaci of different sexes.

Material and Methods

Insects, plants and RaMoV clone

Tobacco (Nicotiana tabacum cv. Samsun NN) and cucumber (Cucumis sativus L. cv. ChangChunMiChi) were grown in a potting mix in 1.5 L pots (one plant/pot) at 26 ± 2 °C under a 16 h light/8 h dark day cycle. The tobacco plants at the 6–8 true-leaf stage was inoculated with virus by A. tumefaciens GV3101 containing a RaMoV plasmid, which was constructed and stored in our laboratory. The B. tabaci MED population was maintained in whitefly-proof screen cages at 26 ± 2 °C with a 16 h light/8 h dark day cycle. The purity of the MED population was monitored by CAPS (cleavage amplified polymorphic sequence) of mtCOI (mitochondrial cytochrome oxidase I genes) with the restriction endonuclease VspI[29].

Fecundity and longevity of whiteflies

The direct effects of RaMoV on the fecundity and longevity of females of B. tabaci were examined by clip-caging viruliferous or non-viruliferous insects with leaves of healthy cucumber. Viruliferous insects were generated from new-born female adults fed on the leaves of RaMoV-infected tobacco for 48 h by clip-caging and then transferred to leaves of healthy cucumber. Non-viruliferous insects were generated on healthy tobacco of the same growth stage. A set of 40 female B. tabaci individuals in each experimental group was used. The indirect impacts of RaMoV on the fecundity and longevity of female B. tabaci MED were examined by clip-caging newly emerged non-viruliferous B. tabaci from healthy cucumber plants with healthy tobacco, RaMoV-infected tobacco or Agrobacterium-infected tobacco. The clip-cages were attached to the third to sixth leaf of each tobacco plant. Each newly emerged non-viruliferous B. tabaci MED adult female was clip-caged to ovipositor on tobacco for five days (one clip-cage per tobacco plant) until death. The eggs deposited on cucumber/tobacco leaves were counted and marked with an insect needle under a stereomicroscope (Leica, DFC450, Leica Microsystes, Germany). The adults and the clip-cages were then moved to new leaves. Every female was checked every 5 days until death, and their longevity was calculated to determine the effects of RaMoV for each replicate.

Acquisition, retention and transmission of RaMoV by different sexes of B. tabaci MED

To test the acquisition of RaMoV by different sexes of B. tabaci MED, approximately 300 newly emerged (0–24 h) non-viruliferous female or male adult individuals were taken from their respective cultures and transferred to feed on RaMoV-infected tobacco plants enclosed in a clip-cage. To ensure that the insects remained healthy, the transfer process of insects from leaf to leaf was performed gently. Following adult transfer, we randomly collected 20 adults from the leaves of the two plants at the end of 6 designated acquisition access periods (AAPs; 6 h, 12 h, 24 h, 36 h, 48 h, 72 h). The collected adults were stored at −20 °C and later assayed individually for detectable RaMoV DNA by qPCR. To evaluate the retention of RaMoV by B. tabaci MED on the basis of sex, approximately 300 newly emerged (0–24 h) non-viruliferous female or male adults were transferred to feed on two RaMoV-infected tobacco plants enclosed in an insect-proof cage for 48 h AAP to obtain 100% viruliferous B. tabaci MED. Then, the viruliferous adult female or male B. tabaci MED were collected and released to feed on a healthy cucumber plant, a non-host of RaMoV. After the initial release, a group of 20 live adults were collected at 0, 3, 6, 9, 12 and 15 d. The insect samples collected were stored at −20 °C, and later, RaMoV DNA was detected by qPCR. To estimate the transmission of RaMoV to tobacco plants by B. tabaci MED on the basis of sex, viruliferous adults generated as above were collected and inoculated in groups of 1 and 2 on the second leaf from the bottom of an uninfected tobacco plant at the three-true-leaf stage using a clip-cage for a 48 h inoculation access period. After 7 d and 14 d, the tobacco plants in each of the treatments were examined for virus infection by RaMoV symptoms and conventional PCR, and the RaMoV DNA accumulation in tobacco leaves was quantified by qPCR.

Viral DNA detection in B. tabaci and tobacco

Total genomic DNA of B. tabaci and tobacco was extracted by the CTAB method[30]. For specific detection of RaMoV in B. tabaci and tobacco, the specific primer (CP-F: 5′-TATCGCAAGCCCAAGATG-3′ and CP-R, 5′-3′: GACCTCCAGTAACAGTTGACG) of the partial CP gene fragment of RaMoV (774 bp) (GenBank No. NC_010791.1) was used to conduct conventional PCR. The reaction mixture (20 µL) contained 10 × PCR buffer (no Mg2+) 2 µL, MgCl2 (50 mM) 0.8 µL, dNTPs (10 mM) 0.2 µL, primers (10 mM) 0.2 uL each, enzyme mix (1000 U) 0.5 µL, RNA inhibitor 0.1 µL, ddH2O 16 µL. The following cycling conditions were used: initial denaturation at 94 °C for 2 min; 35 cycles of 94 °C for 30 s, 55 °C for 1.5 min, and 72 °C for 1.5 min; and a final extension step at 72 °C for 10 min. The PCR products were sequenced to ensure the accuracy of the insertion sequence. For quantification of RaMoV DNA in insects and tobacco, qPCR was conducted as in a previous study[13] with minor modifications. The specific primers (qPCR-F: GGTTCTGCGTAAAGTCCG and qPCR-R: TTGACCTCCAGTAACAGTTGAC) for the partial CP gene fragment of RaMoV (200 bp) (GenBank No. NC_010791.1) were used. qPCR reactions were carried out in a 96-well optical plate in an Analytik Jena AG PCR instrument, and the accompanying software was used for qPCR data normalization and quantification. Amplifications for RaMoV were performed with 2 × TransStar Green qPCR Super Mix UDG (Trans Gene Biotech (Beijing), Co., Ltd). For each sample, three replicates were performed for each of the three biologically independent experiments. The relative gene expression of the RaMoV CP gene was calculated using the 2−△△Ct method[31]. β-actin from B. tabaci[13] and EF-1a[32] from tobacco were used as reference genes to normalize the gene expression level.

Data analysis

Statistical analyses were performed with SPSS (version 22.0; SPSS Inc., Chicago, IL, USA). Means were compared by the least significant difference (LSD) test at P = 0.05.
  3 in total

1.  A new record of Asia II 5 genetic group of Bemisia tabaci (Gennadius) in the major potato growing areas of India and its relationship with tomato leaf curl New Delhi virus infecting potato.

Authors:  Kailash C Naga; Sundaresha Siddappa; Ravinder Kumar; Rahul K Tiwari; S Subhash; Gaurav Verma; Tanuja Buckseth; Aarti Bairwa; Sanjeev Sharma; Subhash Katare; R M Srivastava; G M Bansode; Anirban Sarkar; J K Patel
Journal:  3 Biotech       Date:  2021-08-31       Impact factor: 2.893

2.  Differential Transmission of Old and New World Begomoviruses by Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) Cryptic Species of Bemisia tabaci.

Authors:  Saurabh Gautam; Habibu Mugerwa; James W Buck; Bhabesh Dutta; Tim Coolong; Scott Adkins; Rajagopalbabu Srinivasan
Journal:  Viruses       Date:  2022-05-20       Impact factor: 5.818

3.  Differential expression of gut protein genes and population density of Arsenophonus contributes to sex-biased transmission of Bemisia tabaci vectored Cotton leaf curl virus.

Authors:  Ikbalpreet Singh; Ramandeep Kaur; Ashok Kumar; Satnam Singh; Abhishek Sharma
Journal:  PLoS One       Date:  2021-11-29       Impact factor: 3.240

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.