Literature DB >> 23336021

High efficient of females of B-type Bemisia tabaci as males in transmitting the whitefly-borne tomato yellow leaf curl virus to tomato plant with Q-PCR method confirmation.

Wen Xie1, Yan-Xia Xu, Xiao-Guo Jiao, You-Jun Zhang.   

Abstract

It has been previously reported that TYLCV can be transmitted from viruliferous males to non-viruliferous females and from viruliferous females to non-viruliferous males, but not between insects of the same sex; female whiteflies transmit TYLCV-Is with higher efficiency than males through symptoms recognition and viral DNA identification in tomato test plants (one insect per plant, with 48 h AAP and 48 h IAP). However, it remains unclear whether non-infected female and male could obtain same virus from TYLCV-infected tomato plants, and whether TYLCV-infected female and male could transmit same virus to non-viruliferous tomato plants. To address this issue, quantitative real-time PCR were applied to detect TYLCV content in adults or tomato plant. The acquisition and transmission experiments showed that both female and male can acquire and transmit the virus and no acquisition capability difference was observed between newly emerged female and male, however, female demonstrated superior transmission capability than male. Moreover, gene expressions profilings of GroEL and Hamiltonella in non-viruliferous and viruliferous female was all higher than that in male. These results further indicated that sex is an important factor affecting TYLCV transmission efficiency in B. tabaci.

Entities:  

Keywords:  B-biotype Bemisia tabaci; TYLCV; female; male; quantitative real-time PCR

Year:  2012        PMID: 23336021      PMCID: PMC3541318          DOI: 10.4161/cib.21692

Source DB:  PubMed          Journal:  Commun Integr Biol        ISSN: 1942-0889


The whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae), is a phloem-feeding insect pest that causes severe damage in both agricultural and horticultural systems worldwide. It has been previously reported that TYLCV can be transmitted between whiteflies of the B biotype in a sex-dependent manner in the absence of any other source of the virus; Meanwhile, female whiteflies transmit TYLCV-Is (the virus isolated from Israel) with higher efficiency than males (100% vs 20%) through virus-symptoms recognition and viral DNA identification in tomato test plants., However, the reason of this difference is not clear until now. Whether existed difference in the acquisition and transmission capability of TYLCV by female and male, especially the TYLCV quantities of acquisition and transmission by female and male at different period of time are not clear and necessary to carry out more experiments. To examine sex difference in the acquisition and transmission capability of TYLCV by female and male, quantitative real-time PCR described in Pan et al. (2012) were conducted to quantify the relative gene expressions of TYLCV in B. tabaci female and male or in tomato plant. For acquisition comparison of TYLCV by female and male of B. tabaci B biotype, relative gene expressions of TYLCV in B. tabaci female and male were measured using a qRT-PCR after non-viruliferous whiteflies fed on the TYLCV-infected tomato plants for 3, 6, 12, 18, and 24 h. While for transmission comparison of TYLCV from viruliferous females or males to non-viruliferous tomato plant, relative gene expressions of TYLCV in tomato leaf were measured using a qRT-PCR after viruliferous whiteflies fed on the non-viruliferous tomato plants for 7, 14, 21, and 28 day. Meanwhile, the GroEL homologue seems to bind to and protect begomoviruses from degradation in the haemolymph; disturbing the GroEL-TYLCV association leads to the degradation of the virus and to a markedly decrease in transmission efficiency of the virus., Recent research has revealed that the S-symbiont Hamiltonella is closely associated with the transmission efficiency of TYLCV by the whitefly vector. In this study, gene expressions profiling of GroEL and Hamiltonella in non-viruliferous and viruliferous whiteflies were also obtained, after non-viruliferous whiteflies fed on the TYLCV-infected tomato plants for 0, 12, and 24 h. Primer sequences used for real-time PCR analysis are shown in table 1.

Table 1. Primer sequences used for real-time PCR analysis.

Gene NamePrimer NamePrimer SequenceAmplicon SizeReferences
TYLCV
TY-F
GTCTACACGCTTACGCC
144
[3]
TY-R
GCAATCTTCGTCACCC
 
 
GroEL
Groq-F
CATTCCGCCCATTCCACC
157
[4-5]*
Groq-R
CACGTTCTGCATTGCAATAT
 
Hamiltonella 16S rDNA
Ham-F
GCATCGAGTGAGCACAGTTT
243
[7]
Ham-R
TATCCTCTCAGACCCGCTAGA
 
 
β-actin
β-actin-F
TCTTCCAGCCATCCTTCTTG
130
[7]
β-actin-R
CGGTGATTTCCTTCTGCATT
 
Tomato 25S rRNA25S-F
ATAACCGCATCAGGTCTCCA
113
[8]
25S-RCCGAAGTTACGGATCCATTT  

Designed from the full length of GroEL

Designed from the full length of GroEL The data obtained showed that no significant difference were observed in acquisition of TYLCV between newly emerged female and male of B. tabaci B biotype in each of the five AAP (acquisition access period) (Figure 1). Through our previous report, the virus acquisition and transmission capability of Q biotype was significant higher than that of the B biotype through same qPCR analysis method. In this study, further result indicated that virus transmission capability difference not only existed among biotypes, but also in sexes.

Figure 1. Acquisition of TYLCV by B. tabaci B biotype. Relative gene expressions of TYLCV in B. tabaci female and male were measured using a qRT-PCR after non- viruliferous whiteflies fed on the TYLCV-infected tomato plants for 3, 6, 12, 18, and 24 h. Three biological replicates were used and each represented 50 females or males. No differences were denoted based on two-sample unpaired t-test. All p-values at each of the five AAP are above 0.05 (0.7123, 0.6985, 0.6334, 0.4982 and 0.9882).

Figure 1. Acquisition of TYLCV by B. tabaci B biotype. Relative gene expressions of TYLCV in B. tabaci female and male were measured using a qRT-PCR after non- viruliferous whiteflies fed on the TYLCV-infected tomato plants for 3, 6, 12, 18, and 24 h. Three biological replicates were used and each represented 50 females or males. No differences were denoted based on two-sample unpaired t-test. All p-values at each of the five AAP are above 0.05 (0.7123, 0.6985, 0.6334, 0.4982 and 0.9882). Moreover, two sets of experiments were carried out for the sex-virus combinations (viruliferous female or male with non-viruliferous tomato plants, respectively, during a 48 h IAP (inoculation access period) following a 24 h AAP). The qPCR results of TYLCV in tomato leaf in each of post-inoculation time, indicated that female exhibited significantly higher tomato-transmission frequency than male (Figure 2). In the meanwhile, higher gene expression of GroEL and Hamiltonella were observed in female than that in male, no matter infected TYLCV or not (Figure 3). Higher tomato-transmission frequency in female than male might be related with the higher GroEL product in female.

Figure 2. Transmission of TYLCV from viruliferous females or males of B. tabaci B biotype to non-viruliferous tomato plant. Relative gene expressions of TYLCV in tomato leaf were measured using a qRT-PCR after viruliferous whiteflies fed on the non-viruliferous tomato plants for 7, 14, 21, and 28 day. 50 viruliferous females or males were used to infect a tomato plant with non-TYLCV, during a 48 h IAP, following a 24 h AAP in order to obtain identical virus content whiteflies. Three biological replicates were used and 50 whiteflies per plant. Significant differences were denoted based on two-sample unpaired t-test.

Figure 3. Gene expressions profiling of GroEL (A) and Hamiltonella (B) in non-viruliferous and viruliferous whiteflies. Relative gene expressions after non- viruliferous whiteflies fed on the TYLCV-infected tomato plants for 0, 12, and 24 h. Three biological replicates were used and each represented 50 females or males. Significant differences were denoted based on two-sample unpaired t-test.

Figure 2. Transmission of TYLCV from viruliferous females or males of B. tabaci B biotype to non-viruliferous tomato plant. Relative gene expressions of TYLCV in tomato leaf were measured using a qRT-PCR after viruliferous whiteflies fed on the non-viruliferous tomato plants for 7, 14, 21, and 28 day. 50 viruliferous females or males were used to infect a tomato plant with non-TYLCV, during a 48 h IAP, following a 24 h AAP in order to obtain identical virus content whiteflies. Three biological replicates were used and 50 whiteflies per plant. Significant differences were denoted based on two-sample unpaired t-test. Figure 3. Gene expressions profiling of GroEL (A) and Hamiltonella (B) in non-viruliferous and viruliferous whiteflies. Relative gene expressions after non- viruliferous whiteflies fed on the TYLCV-infected tomato plants for 0, 12, and 24 h. Three biological replicates were used and each represented 50 females or males. Significant differences were denoted based on two-sample unpaired t-test. Evidently, the results of this study and previous report of female whiteflies transmit TYLCV-Is with higher efficiency than males through symptoms recognition and viral DNA identification in tomato test plants, indicate that sex bias in transmission TYLCV of B.tabaci were obvious, especially female show higher capacity in obtain virus from matting and transmitting virus to healthy tomato plants., To our knowledge, this is the first report of sex acting as an important factor for TYLCV transmission in B.tabaci. Sex bias in gene expression is being analyzed and documented in this insect species recently (unpublished data), which may provide more information aimed to explain this phenomenon.
  6 in total

Review 1.  Whiteflies: vectors, and victims (?), of geminiviruses.

Authors:  H Czosnek; M Ghanim; S Morin; G Rubinstein; V Fridman; M Zeidan
Journal:  Adv Virus Res       Date:  2001       Impact factor: 9.937

2.  A GroEL homologue from endosymbiotic bacteria of the whitefly Bemisia tabaci is implicated in the circulative transmission of tomato yellow leaf curl virus.

Authors:  S Morin; M Ghanim; M Zeidan; H Czosnek; M Verbeek; J F van den Heuvel
Journal:  Virology       Date:  1999-03-30       Impact factor: 3.616

3.  The GroEL protein of the whitefly Bemisia tabaci interacts with the coat protein of transmissible and nontransmissible begomoviruses in the yeast two-hybrid system.

Authors:  S Morin; M Ghanim; I Sobol; H Czosnek
Journal:  Virology       Date:  2000-10-25       Impact factor: 3.616

4.  The transmission efficiency of tomato yellow leaf curl virus by the whitefly Bemisia tabaci is correlated with the presence of a specific symbiotic bacterium species.

Authors:  Yuval Gottlieb; Einat Zchori-Fein; Netta Mozes-Daube; Svetlana Kontsedalov; Marisa Skaljac; Marina Brumin; Iris Sobol; Henryk Czosnek; Fabrice Vavre; Frédéric Fleury; Murad Ghanim
Journal:  J Virol       Date:  2010-07-14       Impact factor: 5.103

5.  Real-time PCR for the quantitation of Tomato yellow leaf curl Sardinia virus in tomato plants and in Bemisia tabaci.

Authors:  Giovanna Mason; Piero Caciagli; Gian Paolo Accotto; Emanuela Noris
Journal:  J Virol Methods       Date:  2007-11-05       Impact factor: 2.014

6.  Rapid spread of tomato yellow leaf curl virus in China is aided differentially by two invasive whiteflies.

Authors:  Huipeng Pan; Dong Chu; Wenqian Yan; Qi Su; Baiming Liu; Shaoli Wang; Qingjun Wu; Wen Xie; Xiaoguo Jiao; Rumei Li; Nina Yang; Xin Yang; Baoyun Xu; Judith K Brown; Xuguo Zhou; Youjun Zhang
Journal:  PLoS One       Date:  2012-04-13       Impact factor: 3.240

  6 in total
  4 in total

1.  A new record of Asia II 5 genetic group of Bemisia tabaci (Gennadius) in the major potato growing areas of India and its relationship with tomato leaf curl New Delhi virus infecting potato.

Authors:  Kailash C Naga; Sundaresha Siddappa; Ravinder Kumar; Rahul K Tiwari; S Subhash; Gaurav Verma; Tanuja Buckseth; Aarti Bairwa; Sanjeev Sharma; Subhash Katare; R M Srivastava; G M Bansode; Anirban Sarkar; J K Patel
Journal:  3 Biotech       Date:  2021-08-31       Impact factor: 2.893

2.  Transmission of Tomato Yellow Leaf Curl Virus by Bemisia tabaci as Affected by Whitefly Sex and Biotype.

Authors:  Wenxi Ning; Xiaobin Shi; Baiming Liu; Huipeng Pan; Wanting Wei; Yang Zeng; Xinpei Sun; Wen Xie; Shaoli Wang; Qingjun Wu; Jiaxu Cheng; Zhengke Peng; Youjun Zhang
Journal:  Sci Rep       Date:  2015-05-29       Impact factor: 4.379

3.  Differential expression of gut protein genes and population density of Arsenophonus contributes to sex-biased transmission of Bemisia tabaci vectored Cotton leaf curl virus.

Authors:  Ikbalpreet Singh; Ramandeep Kaur; Ashok Kumar; Satnam Singh; Abhishek Sharma
Journal:  PLoS One       Date:  2021-11-29       Impact factor: 3.240

4.  Transcriptomic dissection of sexual differences in Bemisia tabaci, an invasive agricultural pest worldwide.

Authors:  Wen Xie; Litao Guo; Xiaoguo Jiao; Nina Yang; Xin Yang; Qingjun Wu; Shaoli Wang; Xuguo Zhou; Youjun Zhang
Journal:  Sci Rep       Date:  2014-02-14       Impact factor: 4.379

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.