Sequencing of the Complete Mitochondrial Genome of Pingus sinensis (Spirurina: Quimperiidae): Gene Arrangements and Phylogenetic Implications.

Despite several decades of intensive research on spirurine nematodes, molecular data on some of the main lineages are still absent, which makes taxonomic classification insufficiently resolved. In the present study, we sequenced the first complete mitogenome for the family Quimperiidae, belonging to P. sinensis (Spirurina: Quimperiidae), a parasite living in the intestines of snakehead (Ophiocephalus argus). The circular mitogenome is 13,874 bp long, and it contains the standard nematode gene set: 22 transfer RNAs, 2 ribosomal RNAs and 12 protein-coding genes. There are also two long non-coding regions (NCR), in addition to only 8 other intergenic regions, ranging in size from 1 to 58 bp. To investigate its phylogenetic position and study the relationships among other available Spirurina, we performed the phylogenetic analysis using Bayesian inference and maximum likelihood approaches by concatenating the nucleotide sequences of all 36 genes on a dataset containing all available mitogenomes of the suborder Spirurina from NCBI and compared with gene order phylogenies using the MLGO program. Both supported the closer relationship of Ascaridoidea to Seuratoidea than to Spiruroidea. Pingus formed a sister-group with the Cucullanus genus. The results provide a new insights into the relationships within Spirurina.

1. Introduction

Nematoda, also known as roundworms, is one of the largest phyla in the animal kingdom. They are pseudocoelomic animals, mostly with small, cylindrical bodies. Nematodes are among the most common, abundant and ecologically diverse animal groups. Free-living species inhabit almost every environment, and they are extremely abundant in soils and aquatic sediments, both freshwater and marine [1,2]. The phylogeny of nematodes depends on a limited number of morphological and ecolog-ical characteristics, which can be determined before using molecular data. Due to the extreme speciosity of this phylum, the poor resolution conferred by morphologic characters resulted in incongruent classification systems [3]. Thus, the identification and phylogeny of nematodes are more suitable used with molecular data. However, since 18S rRNA genetic marker has insufficient resolution for such a large phylum, further studies must employ markers with much higher resolution power. [4]. Complete mitogenomes are much better suited for the taxonomic identification and phylogenetic studies of nematodes than morphology or traditionally used molecular markers because of much higher resolution power [5,6,7,8].

Mitochondrial gene order, i.e., the order in which genes are arranged on the mitochondrial genome, is sometimes used for phylogenetic reconstruction [9,10] and confirmation of findings based on mitochondrial DNA sequences [11]. As a result, mitogenomic data have often proven capable of clarifying phylogenetic relationships where other types of data offered a poor resolution, or where there was discordance between morphological features and genetic data, Furthermore, in many metazoans, the mitogenome accumulates mutations rate faster than the nuclear genome, which makes mitogenome a reliable source of phylogenetic data for distinguishing closely related taxa [12,13]. While mitogenomic data also have limitations for evolutionary studies [14,15], mitochondrial phylogenomics and comparative mitogenomics (e.g., gene order) have often been used as a useful tool for clarifying phylogenetic relationships in a large number of diverse animal groups with their ancient evolutionary origin [16,17,18,19]. Further comparative analyses of major nematode clades poorly represented in terms of mitogenomes are needed to fully explore the mitogenomic gene order evolution.

Spirurina, the representative suborder of gastrointestinal or tissues parasites of all clades of vertebrates, contains infraorders Ascaridomorpha, Gnathostomatomorpha, Oxyuridomorpha, Rhigonematomorpha, Spiruromorpha and Dracunculoidea as incertae sedi in the recent classification system based on molecular data [3]. Although the Spirurina clade is stably supported by the SSU rRNA data [20,21], the phylogenetic relationships for Spirurina based on mitogenomes remain inconclusive, largely due to the lack of sequences from several key lineages, which confuses the relationships within the clade and with other clades [22]. P. sinensis (Spirurina: Quimperiidae) is a roundworm parasitizing the intestine and caecum of fishes of the genus Channa. Although its morphological characteristics are unambiguous, molecular data is still absent, so its molecular phylogeny remains unstudied. As there are currently no complete mitogenomes available for the family Quimperiidae (Chromadorea: Spirurina: Seuratoidea), this study aims to sequence and characterize the complete mitogenome of the Quimperiidae species P. sinensis. As there are currently no molecular records at all for this species, these data shall also facilitate the identification of this species for future studies. Another objective was to conduct comparative analyses with all available Spirurina mitogenomes to study the relationships of the Spirurina. In addition, we also conducted comparative analyses of gene orders among the Spirurina, with the goal of inferring the evolutionary history of gene orders. The study first reveals phylogenetic position of family Quimperiidae and advances our understanding of the relationships within Spirurina.

2. Materials and Methods

2.1. Specimen Collection

Parasitic nematodes were acquired post mortem from the intestine of snakehead (Channa argus) samples caught by fishermen in the Lake Xiannv in Xinyu city, Jiangxi Province (24°29′14″–30°04′41″ N; 113°34′36″–118°28′58″ E), China, on 5 August 2020 and rinsed several times with physiological saline to wash out tissue particles of the host. The parasite was identified morphologically under a stereomicroscope and a light microscope according to the morphological features described by Moravec [23]. To further confirm the identity using molecular data, we relied on the 18S gene, which is recognized as a suitable molecular tool for the identification of nematodes [24]. The gene was amplified using self-designed primers. The sequence exhibited a 97.42% similarity with Paraseuratum sp. (Spirurina: Quimperiidae) (GenBank: KP275686). The samples were stored in 99% ethanol and 4 °C.

2.2. DNA Extraction and Amplification

The DNA extraction from a single specimen using a TIANamp Genomic DNA Kit (Tiangen Biotech, Beijing, China), following the manufacturer’s recommended protocol, and stored at −20 °C. Primers were designed to match generally conserved regions of target genes and used to amplify short fragments of cox1, rrnL, nad5, rrnS, nad1, cytb and nad4 genes. Specific primers were designed based on conserved regions and used to amplify the remaining mitogenome sequence in several PCR reactions (Table 1). The total volume for PCR was 20 μL: 1 μL rTaq polymerase (250U, Takara), 10 μL 2 × PCR buffer (Mg2+, dNTP plus, Takara, Dalian, China), 0.6 μL of each primer, 7.4 μL ddH2O and 1 μL of DNA template. The PCR amplification involved in an initial denaturation at 94 °C for 2 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min/kb; a final extension at 72 °C for 10 min was then accomplished. The PCR products were sequenced bi-directionally at Sangon Company (Shanghai, China) using the primer-walking strategy.

Table 1

Primers used to amplify and sequence the mitochondrial genome of P. sinensis.

FragmentNo.	Gene orRegion	PrimerName	Sequence (5′-3′)	Length(bp)
F1	COX1	C1F1	ATTGGGGGGTTTGGTAATTG	506
		C1R1	TAAACTTCAGGGTGGCCAAA
F2	COX1-16S	C1F2	TGGCAGGAGCTATTACTATG	2452
		C1R2	CATAAGCCGAAGACTTCATTC
F3	16S	C1F3	ATGGCAGTCTTAGCGTGAGG	404
		C1R3	TCTATCTCGCGATGAATTAAAC
F4	16S-ND5	C1F4	CAGGAAATCATGCTAGATAG	1328
		C1R4	CTACCAAAGCAGAAAATCTAGC
F5	ND5	C1F5	GAAGGTGGTTGCCTAAGGCGA	234
		C1R5	GAGATAAAGTTCTCAAAGCAAC
F6	ND5-12S	C1F6	TGGAGAACTTGTGTTGGTG	2068
		C1R6	GTTTAACAAATCTTAATTCTG
F7	12S	C1F7	TGTTCCAGAATAATCGGCTA	511
		C1R7	CAATTGATGGATGATTTGTACC
F8	12S-ND1	C1F8	TGTGGATCTAGATTAGAG	802
		C1R8	GACAAACCAGGTACTAAC
F9	ND1	C1F9	ACGTTTGGGTCCTAATAAGG	482
		C1R9	CTGAAAAATCAAAAGGCGCC
F10	ND1-CYTB	C1F10	GTGTTGCTTATGAGATTGC	2902
		C1R10	CCAATAACCCCCAAGGTAAC
F11	CYTB	C1F11	GGCTCAAATGAGGTTTTGGGC	412
		C1R11	ATATCACTCAGGAACAATATGG
F12	CYTB-ND4	C1F12	GTTTTGTTGAGGCCCTTTAG	1967
		C1R12	CCTAAAAGAACTACCCAAAAC
F13	ND4	C1F13	GCTCATGTTGAAGCACCTAC	206
		C1R13	GAAGAATAAGCAGCCAAAG
F14	ND4-COX1	C1F14	GTTTTGGGTAGTTCTTTTAGG	1481
		C1R14	GTACCACAACCCAAATCAAC

2.3. Genome Assembly

After quality-proofing of the obtained fragments, the complete mitogenomic sequence of P. sinensis was assembled manually and aligned comparing with mitogenomes of related species by DNAstar v7.1 software [25] in accordance with the methodology outlined by Zou et al. [26] and Zhang et al. [27,28,29]. Briefly, raw mitogenomic sequences were imported into the MITOS web server to conclude the near boundaries of genes. The precise positions of protein-coding genes (PCGs) were inferred by searching for ORFs (employing the genetic code 5, invertebrate mitochondrial) and further corroborated via a comparison with homologs in Geneious [30]. All tRNAs were identified using ARWEN [31], DOGMA [32] and putative secondary structures were predicted using MITOS [33]. The genome annotation, reported in a Word (Microsoft Office) document, was input into PhyloSuite software [34] to parse and abstract the data, as well as generate GenBank submission files and organization tables for the mitogenome. Codon usage and relative synonymous codon usage (RSCU) for twelve protein-encoding genes (PCGs) of P. sinensis and Cucullanus robustus (Cucullanidae; the only complete mitogenome from the superfamily Seuratoidea currently available in the GenBank) were computed and the RSCU figure drawn using PhyloSuite. Tandem repeats in the non-coding region (NCRs) were identified by Tandem Repeats Finder [35], and the secondary structures of tRNAs were predicted by MITOS. PAL2NAL web tool [36] was used to calculate non-synonymous (dN)/synonymous (dS) mutation rates for twelve PCGs of P. sinensis and C. robustus. Rearrangement events and pairwise comparisons of gene orders of twelve spirurine nematodes were studied with CREx web tool [37] using the breakpoint comparison measurement. Bright colors represent similar genomes and dark colors represent dissimilar gene orders.

2.4. Phylogenetic and Gene Order Analyses

For the phylogeny, all available mitogenomes belonging to the suborder Spirurina were downloaded from the GenBank, and left only one mitogenome per species. Furthermore, two Dorylaimia (Nematoda: Enoplea) species, Romanomermis culicivorax and Trichuris muris, were used as outgroups. PhyloSuite was used to abstract the sequences of 36 genes (12 PCGs, 2 rRNAs and 22 tRNAs). All GenBank files were rearranged to start with the cox1 gene using the Reorder function in the same program, and the program was also used to generate the comparative mitogenomic architecture table for P. sinensis and C. robustus. All subsequent phylogenetic analysis steps were also conducted using PhyloSuite and its plug-in programs. Genes were aligned using MAFFT [38]: the normal alignment mode was appropriate for the rRNAs or tRNAs, and the codon alignment mode was appropriate for the 12 PCGs. Subsequently, a single alignment was generated by concatenating the manually optimized alignments using PhyloSuite. Based on the Akaike information criterion, GTR+G model was selected by PartitionFinder2 [39] as the best-suited evolutionary model. Two different algorithms: maximum likelihood (ML) and Bayesian inference (BI) were used to accomplish phylogenetic analyses. Bayesian inference was performed with default settings in MrBayes 3.2.6 [40] and accompanied with 1 × 106 metropolis-coupled MCMC generations. The best-fit partitioning strategy and models for partitions for IQ-TREE [41] were inferred using the inbuilt functions of IQ-TREE and followed by phylogenetic reconstruction with 50,000 ultrafast replicates [42]. Gene orders were visualized and annotated by iTOL [43] with the help of PhyloSuite. A phylogenetic tree was reconstructed using the MLGO program [44] on the basis of the gene order dataset, with 1000 bootstrap replicates [45].

3. Results

3.1. Genome Organization and Nucleotide Composition

The circular mitogenome of P. sinensis was 13,874 bp in length (Figure 1). The annotated mitogenome has been submitted to GenBank with accession number MW971502. The mitogenome encoded 36 genes: 12 PCGs (nad1-6, nad4L, cox1-3, atp6 and cytb), 22 tRNA genes (one tRNA for each amino acid, apart from leucine and serine, each of which was encoded by two tRNA genes) and 2 rRNA genes (s-rRNA and l-rRNA). All genes are transcribed from the same DNA strand. The absence of the atp8 gene in accordance with the general features of nematode mitogenomes with the exception of Trichinella spiralis, in which the atp8 gene was found [46]. In comparison to other nematodes [47,48], the base composition of the total mitogenome for P. sinensis was biased toward T and G (A + T content of 68.7%; 46.9% T; 22.4% G; 21.8% A; 8.9% C) rather than A and T, but the strand bias is consistent with other nematodes with a negative GC-skew and positive AT-skew. In conclusion, the nucleotides of metazoan mitogenomes are not randomly distributed, and this nucleotide bias is often linked with unequal usage of synonymous codons [49].

Figure 1

Mitochondrial map of Pingus sinensis. The genes are denoted by the color blocks. PCGs are orange, rRNAs are yellow and tRNAs are green. The tRNAs are labelled according to the IUPACIUB single-letter amino acid code, with numerals distinguishing each of the two leucine- and serine-encoding tRNA genes (L1 and L2 for CUN and UUR, respectively; S1 and S2 for AGN and UCN, respectively), and intergenic regions are grey.

3.2. Protein-Coding Genes and Codon Usage

The twelve PCGs ranged in size from 234 bp (nad4L) to 1584 bp (nad5). Among the 12 PCGs, seven (nad1, nad2, nad3, nad6, cytb, cox1 and cox3) used TTG as the start codon, whereas four (nad4, nad4L, nad5, atp6) used ATT, and GTG was used only by the cox2 gene. TAA was the most commonly used termination codon (nad3, nad4, nad4L, nad5, nad6, cox3, atp6, cytb); three genes (cox1, cox2, nad1) used TAG, and the incomplete termination codon T-- was inferred only for the nad2 gene (Table 2). Same as C. robustus, the PCGs of the P. sinensis mitogenome are biased toward using amino acids encoded by T-, G- and A-rich codons. Codon usage, RSCU and codon family proportion (relevant to the amino acid usage) of P. sinensis and C. robustus are presented in Figure 2. Leucine (17.17%), phenylalanine (14.93%) and serine (10.22%) were the most frequent amino acids in the PCGs of P. sinensis, whereas arginine (0.97%), glutamine (1.33%) and histidine (1.5%) were relatively insufficient. The codons TTT (Phenylalanine, 14.3%) and TTG (Leucine, 8.6%) usage were most frequent, while the CGA codon for arginine was scarce (Additional file 1: Table S1). Therefore, codons ending in A or T were predominant, which consistent with the high A + T content of the third coding position of all PCGs in P. sinensis (Figure 2). The ratios of dN/dS for all twelve PCGs of P. sinensis against C. robustus ranged from 0.002 to 0.034 (Figure 3). All the PCGs were under negative (purifying) selection (ω < 1) pressure, indicating the existence of functional constraints affecting the evolution of these genes. Functional constraints on nad3, cytb, nad1 and nad6 genes were the most relaxed, whereas cox2 gene was evolving under the strongest purifying selection pressure (Figure 3).

Table 2

The genome organization of P. sinensis.

	Position				Codon
Gene	From	To	Size	Intergenic Nucleotides	Start	Stop	Anticodon
trnP	1	57	57				TGG
cox1	58	1623	1566		TTG	TAG
trnC	1623	1678	56	−1			GCA
trnM	1679	1740	62				CAT
trnD	1742	1798	57	1			GTC
trnG	1799	1853	55				TCC
cox2	1854	2540	687		GTG	TAG
trnH	2539	2593	55	−2			GTG
rrnL	2594	3538	945
nad3	3551	3877	327	12	TTG	TAA
nad5	3877	5460	1584	−1	ATT	TAA
trnN	5459	5510	52	−2			GTT
nad6	5511	5939	429		TTG	TAA
nad4L	5944	6177	234	4	ATT	TAA
trnW	6177	6232	56	−1			TCA
trnA	6233	6288	56				TGC
trnE	6288	6342	55	−1			TTC
rrnS	6343	7024	682
trnS2	7025	7078	54				TGA
NCR1	7079	7362	284
trnY	7363	7420	58				TAC
nad1	7419	8291	873	−2	TTG	TAG
atp6	8294	8890	597	2	ATT	TAA
trnK	8949	9010	62	58			TTT
trnL2	9018	9073	56	7			TAA
trnS1	9071	9128	58	−3			TCT
nad2	9129	9960	832		TTG	T
trnI	9961	10016	56				GAT
trnR	10027	10080	54	10			ACG
trnQ	10081	10134	54				TTG
trnF	10135	10191	57				GAA
cytb	10183	11292	1110	−9	TTG	TAA
trnL1	11293	11350	58				TAG
cox3	11351	12118	768		TTG	TAA
trnT	12119	12174	56				TGT
nad4	12190	13404	1215	15	ATT	TAA
trnV	13404	13457	54	−1			TAC
NCR2	13458	13874	417

Figure 2

Relative Synonymous Codon Usage (RSCU) of P. sinensis and C. robustus. Values on the top of the bars refer to amino acid usage.

Figure 3

Ratios of non-synonymous (dN)/synonymous (dS) nucleotide substitutions calculated from all 12 PCGs of P. sinensis and C. robustus mitogenomes.

3.3. Transfer RNA and Ribosomal RNA Genes

The small and large subunits of rrn (rrnS and rrnL) of P. sinensis were 682 bp and 945 bp in size, with 65.6% and 72.6% AT contents, respectively (Additional file 2: Table S2). All 22 commonly found tRNAs were identified in the mitogenome of P. sinensis, ranging from 52 bp (trnN (gtt)) to 62 bp (trnM (cat) and trnK (ttt)) in size, adding up to 1238 bp in length, with an average A + T content of 69.7% (Table 2). All 22 tRNA genes do not exhibit the standard cloverleaf secondary structure. The inferred structures of 20 of the twenty-two tRNA genes (except for two trnS genes) in P. sinensis consist of an amino-acyl stem of seven nucleotide pairs (ntp), a DHU-stem of 4 ntp with a 3–7 nt loop, an anticodon stem of 5 ntp with a loop, and a unique characteristic in that the TΨC arm and variable loop are replaced by a ‘TV replacement loop’ of 6–14 bases. The trnS possesses a secondary structure including a DHU replacement loop of 4 bases, a 5 bp TΨC arm, a TΨC loop of 4 bases and a variable loop of 3–4 bases. Noncanonical tRNA structure are common in nematodes, and secondary structures predicted for the transcripts of these genes are similar to those reported from a variety of other nematode mitogenomes [47,48,50,51,52,53,54], excluding T. spiralis in which some tRNAs have the canonical cloverleaf structures [40].

3.4. Non-Coding Regions

There were 8 short intergenic regions ranging from 1 to 58 bp in size, adding up to a total of 393 bp. In addition, there were also two long non-coding regions (>100 bp): NCR1 (between trnS2 and trnY) and NCR2 (between trnV and trnP). They were 284 bp and 417 bp long, with 61.3% and 60.4% AT content, respectively (Additional file 2: Table S2). Tandem repeats are inferred to result from strand slippage during replication [55], and they have been identified in large NCRs of nematodes, including CR1-CR6 in Caenorhabditis elegans and the dinucleotide repeat region in Ascaris suum [52]. However, the two NCRs of P. sinensis were absence of consecutive sequences of A and T, and we did not identify any tandem repeats.

3.5. Phylogeny

Phylogenetic relationships of P. sinensis with related nematodes of the Spirurina were presumed using ML and BI methods. The dataset comprised 36 concatenated genes (12 PCGs, 2 rRNAs and 22 tRNAs). Both methods, BI and ML, produced an identical topology, and most of the nodes exhibited high bootstrap resampling (ML) and posterior probability (BI) values. Additional file 3: Figure S1 shows the combined strict accordance phylogenetic tree produced from the two phylogenetic methods. As some superfamilies were represented by a single species in our study, this topology should be comprehended with some caution. Tree topology suggests the existence of two major clades: one clade includes the superfamilies Physalopteroidea, Thelazioidea, Spiruroidea and Filarioidea; another clade consists of the superfamilies Oxyuroidea, Camallanoidea, Dracunculoidea, Rhigonematoidea, Heterakoidea, Seuratoidea, Gnathostomatoidea and Ascaridoidea. The second clade was further sub-divided into two clades, Oxyuroidea and (Camallanoidea + (Dracunculoidea + (Rhigonematoidea + (Heterakoidea + (Seuratoidea + (Gnathostomatoidea + (Ascaridoidea))))))), and a monophyletic clade comprising (Physalopteridae + (Thelazioidea + (Gongylonematidae + (Setariidae + (Onchocercidae))))). Most clades were robustly supported. This relationship is in agreement with phylogenies inferred by Černotíková et al. [56] and Zou et al. [5]. However, our results appear to reject the hypothesis that Oxyuroidea represented the earliest branch of this clade [3,20], our results in agreement with a previous study [57].

The topology obtained in our phylogenetic analysis supports a sister relationship between Seuratoidea and Ascaridoidea, while strongly rejecting the Ascaridoidea-Spiruroidea affinity [47,50]. Meanwhile, the sister relationship also is supported between the Camallanoidea and Dracunculoidea. Ascarididae and Anisakidae were resolved as paraphyletic, along with the particularly problematic phylogeny of the Ortleppascaris genus, which appears to exhibit a closer relationship with the family Anisakidae than Ascarididae. Intriguingly, the Ophidascaris genus is closer to the family Ascarididae than Anisakidae. In our study, in addition, Gnathostomatoidea formed a sister clade with (Seuratoidea + Ascaridoidea), which is also incongruent with Zou et al. [5]. And the sister group relationship between the Quimperiidae family and Cucullanidae family was revealed, mitochondrial gene order and transformational pathway analysis provided additional supporting evidence for the close relationship between these two families in this study (Additional file 4: Figure S2).

3.6. GO Analysis

For a better comparison of gene orders among the Spirurina, Phylosuite was used to extract and visualize all available sequences from the NCBI. The gene order of P. sinensis is very similar to that of C. robustus, with only one transposition event: a position change of trnN; three TDRL operations are required to Gnathostoma doloresi; a single transposition event and two TDRL operations are required to Ophidascaris baylisi (Additional file 5: Figure S3). Such gene arrangements are interpreted to be important for molecular systematics and phylogenetic reconstruction because of the rarity of mitochondrial gene arrangement events [58]. Meanwhile, the mitochondrial gene orders of P. sinensis and C. robustus show that Seuratoidea species do not shows a synapomorphic gene order, and indicate that gene order within this group may be evolving at uneven rates.

In order to evaluate the phylogenetic power of gene order, we reconstructed a phylogeny using gene orders (MLGO algorithm), and compared it with the phylogeny inferred using mitogenomic sequences. The monophyly of (Physalopteroidea + (Spiruroidea + (Thelazioidea + (Filarioidea)))) was supported both by the gene order and mitogenomic sequences. Paraphyly of Camallanoidea and Oxyuroidea was also supported by both topologies, as was the sister-group relationship of Pingus and Cucullanus genera. There were also some differences: Onchocerca flexuosa, Chandlerella quiscali, Litomosoides sigmodontis and Ruizia karukerae, which have gene arrangements that do not conform to the gene orders of their closest relatives and topologies. Disregarding the tRNA genes, there were only 9 types of gene orders; this has been believed as additional evidence of their close relationship [6] (Additional file 6: Figure S4), tRNA genes possess small size which probably result in translocations accumulate more quickly. [59]. Hence, designating tRNA genes as hypermobile and excluding them from gene order phylogenies is a feasibile option when dealing with different rearrangement rates [60].

4. Discussion

In conclusion, our analysis reveals the phylogenetic position of family Quimperiidae and provides an insight into the phylogenetic relationships of Spirurina, although the availability of molecular data remains limited. We have sequenced and characterized the complete mitogenome of the fish-parasitizing spirurine nematode P. sinensis, which includes the standard 22 rRNA genes, 2 rRNA genes and 12 PCGs. There are no highly repetitive regions in the NCR. Using concatenated nucleotide sequences of all 36 genes, the phylogenetic analyses were conducted using Bayesian inference and maximum likelihood methods, providing insight into the relationships within the Spirurina. Meanwhile, gene order can be used with discretion as a source of phylogenetic data in nematodes. The monophyly of (Physalopteroidea + (Spiruroidea + (Thelazioidea + (Filarioidea)))) and paraphyly of Camallanoidea and Oxyuroidea are supported both by the gene order and mitogenomic sequences, as was the sister-group relationship of Pingus and Cucullanus genera. However, gene orders are inclined to produce artefactual relationships and should be accompanied with utmost caution for phylogenetic reconstruction in Nematoda. Further studies should centre around adding mitogenomes of other inadequately represented taxa for purpose of advancing understanding of the evolution and variation of nematode trophic ecologies and infer their evolutionary relationships with higher resolution.