Long term conservation of DNA at ambient temperature. Implications for DNA data storage.

DNA conservation is central to many applications. This leads to an ever-increasing number of samples which are more and more difficult and costly to store or transport. A way to alleviate this problem is to develop procedures for storing samples at room temperature while maintaining their stability. A variety of commercial systems have been proposed but they fail to completely protect DNA from deleterious factors, mainly water. On the other side, Imagene company has developed a procedure for long-term conservation of biospecimen at room temperature based on the confinement of the samples under an anhydrous and anoxic atmosphere maintained inside hermetic capsules. The procedure has been validated by us and others for purified RNA, and for DNA in buffy coat or white blood cells lysates, but a precise determination of purified DNA stability is still lacking. We used the Arrhenius law to determine the DNA degradation rate at room temperature. We found that extrapolation to 25°C gave a degradation rate constant equivalent to about 1 cut/century/100 000 nucleotides, a stability several orders of magnitude larger than the current commercialized processes. Such a stability is fundamental for many applications such as the preservation of very large DNA molecules (particularly interesting in the context of genome sequencing) or oligonucleotides for DNA data storage. Capsules are also well suited for this latter application because of their high capacity. One can calculate that the 64 zettabytes of data produced in 2020 could be stored, standalone, for centuries, in about 20 kg of capsules.

Introduction

Conservation of DNA, purified, in biospecimens or synthetic is a prerequisite to many applications, from biobanking, biodiversity preservation or molecular diagnostics to digital data storage (for reviews, see for instance [1-3]). This generates an ever-increasing number of samples which are more and more difficult and costly to store or transport. For reviews, see [4-6].

A way to alleviate, at least partially, this problem, is to develop procedures for storing samples at room temperature, allowing a standalone storage without energy costs. But, of course, this implies that DNA integrity must be maintained at room temperature which can be achieved by keeping DNA away from environmental degradation factors: water, oxygen, ozone, and other atmospheric pollutants [7-10], water being by far the most deleterious element.

Many systems, often based on dehydration, have been used for room temperature storage of purified DNA: freeze-drying [11], inclusion in soluble matrices including liposomes, polymers such as silk [12] or pullulan [13] or adsorption on solid supports such as natural or treated cellulose [14-16]. Other procedures use encapsulation in sol-gel-based silica [17,18] or in silica nanoparticles [19,20], inclusion in salts [21] or layered double hybrids [22], dissolution in deep eutectic solvents [23] or ionic liquids [24]. As none of these procedures can totally protect DNA from atmosphere or moisture, other ways have been proposed: protection under a gold film [25] or encapsulation under an inert atmosphere in hermetic stainless-steel capsules, the DNAshells™ (Imagene SA, France) [6,26,27].

To demonstrate the real efficacy of a given preservation procedure one must estimate the DNA rate of degradation at room temperature (here, 25°C) which is difficult because of the low degradation rate of dehydrated DNA in this condition. So, generally, one must rely on accelerated aging kinetics and extrapolation to room temperature by using Arrhenius equation. Such an approach has recently been used by Grass et al [28] and Organick et al [29], to compare some of these procedures in the context of DNA data storage. Among the tested procedures, DNA encapsulated in DNAshell™ did not give reliable rates of degradation because these were too low.

Here we report an Arrhenius analysis for purified DNA stored in DNAshell complementing these previous studies and exemplifying the high stability of DNA when stored under inert atmosphere.

Material and methods

DNA preparation

DNA was extracted from blood collected on EDTA, following the Puregene protocol (Gentra, Qiagen, Hilden Germany) and resuspended in 10 mM Tris-HCl, 1 mM EDTA, pH 8 and stored at 4°C.

Ethics statement

The data regarding DNA stability presented in this study relate to projects that have been formally approved by the “Comité de protection des personnes Sud Ouest et Outre Mer III”°, including use of blood and blood-derived samples. "L’Etablissement français du sang" (EFS, France) is a French national establishment that is authorized to collect blood samples from adult volunteer donors for both therapeutic and non-therapeutic uses. The donations were collected in accordance with the French blood donation regulations and ethics and with the French Public Health Code (art L1221-1). Blood samples were anonymized according to the French Blood Center (EFS) procedure. Volunteer donors signed written informed consents before blood collection. EFS authorized Imagene to perform this study and provided de-identified blood and blood-derived samples for non-therapeutic use.

DNA encapsulation

DNA encapsulation was realized as previously described [27,30]. Briefly, the DNA solutions (700 ng in 10 μL) were aliquoted in glass inserts fitted in open stainless-steel capsules (DNAshells). The samples were dried under vacuum and left overnight in a glove box under an anoxic and anhydrous argon/helium atmosphere for further desiccation. Then, caps were added and sealed by laser welding. Finally, the DNAshells were checked for leakage by mass spectrometry [27,30]. Capsules are 18 mm x 7 mm weighing 1.3 g. They are made from deep drawing inox 304 with borosilicated glass inserts. This process is summarized in Fig 1.

Fig 1

Workflow of Imagene process.

One hundred and sixty capsules were produced (109 were used for gel electrophoresis and 47 for qPCR analysis).

DNA accelerated degradation studies

DNAshells were heated in a Thermoblock at 100°C, 110°C,120°C, 130°C and 140°C. At each time point of the kinetics, 2 or 3 capsules were retrieved, and stored at -20˚C. For analysis, the capsules were opened, the DNA samples were rehydrated with 20 μL of water. Half of the stored amount (350 ng) was immediately analyzed by electrophoresis. The remaining part of the samples were stored at -20°C for qPCR.

Measure of DNA degradation rates by qPCR with amplicons of two different sizes

Two amplicons of 1064 bp and a 93 bp of the TAF1L gene (TATA-box binding protein associated factor 1 like, Gene ID: 138474) were targeted. For both systems, PCR cycles were as follow: 10 min at 95°C then 40 cycles of (15 s at 95°C; 15 s at 60°C; 60 s at 72°C). The primers sequences were:

For-5’ agactcggacagcgaggaa/ Rev-5’ cggagacacccagcatatca

for the 1064 pb fragment and

For-5’ tgcaggcacttgagaacaac/Rev-5’ aaccctgtcttgtccgaatg

for the 93 pb.

They were produced by Eurogenetec, Les Ulis, France.

The runs were made on the CFX96 Touch Real-Time PCR Detection System (BIO-RAD LABORATORIES, INC).

After rehydration (with 20 μL of water), for each sample and each amplicon, we did a first 2/7 dilution then two ten-fold dilutions to estimate the PCR efficiency and construct the reference straight line. The diluted samples were analyzed independently and defined as “standards”.

For the heated samples, for each time point, three capsules were taken and for each capsule qPCR determinations were done in triplicate. We used 8.35 ng aliquots for each qPCR determination.

To determine DNA recovery and degradation rates, we used a previously developed model [9] based on qPCR amplification of two amplicons (1 and 2) of different sizes (L1 and L2) to measure the number of cuts per nucleotide (or the probability of breakage at a given position). Assuming a random breakage mechanism, the probability of breakage at a given position is: and the probability of this position remaining unbroken is:

From the model:

So, for each temperature, T, a graph of versus time gave us kT by curve fitting.

This method is more reliable than one-sized qPCR because it is independent of the recovery.

Nevertheless, to determine the recovery of total genomic DNA, we used the formula:

Results and discussion

The experimental strategy is summarized in the workflow shown in Fig 2.

Fig 2

Experimental strategy.

Measure of DNA degradation rates by qPCR with two different sizes amplicons

The samples were heated at 100°C, 110°C, 120°C, 130°C and 140°C for periods of time ranging from 2 min to 48 h. The Table 1 gives the number capsules used for each temperature and time point.

Table 1

Number of capsules used for each temperature and time point.

Temperature	Number of time points per kinetic	Number of capsules per time point	Total number of capsules
140	3	3	9
130	4	2	8
120	3	3	9
110	3	3	9
100	4	3	12

First, we ran electrophoresis as size controls to choose the time points corresponding to DNA sizes small enough (< 8 kb apparent size) to give significant values by qPCR. Indeed, when DNA size is too large, N1 and N2 are not different enough. The gels are shown in

The qPCR curves for all the experiments are given in .

DNA recovery

From these curves we obtained the number of amplifiable copies of both amplicons TAF 93 (N2) and TAF 1064 (N1) for each temperature and each time point.

These results are presented in From these values we could determine the total genomic DNA recovery as previously described [9] by using the formula:

These recoveries are given in Table 2 and Fig 3.

Table 2

Genomic DNA recovery.

heating temperature (°C)	heating time
	t1		t2		t3		t4
	mean recovery (%)	standard deviation	mean recovery (%)	standard deviation	mean recovery (%)	standard deviation	mean recovery (%)	standard deviation
140	71%	19	88%	15	101%	10
130	139%	35	169%	8	162%	9
120	53%	1	134%	23	113%	20
110	132%	26	210%	9	115%	3
100	81%	12	175%	18	135%	9	93%	2

Fig 3

Amplifiable copy numbers of 1064 amplicon, 93 amplicon and genomic DNA.

It can be seen that the recovery of genomic DNA is very good in spite of some variability in the values. In particular, it does not seem to exist a decrease in recovery as a function of time and temperature.

As expected, the number amplifiable copies of the 1064 amplicon decreased over time while those of the 93 amplicon did not exhibit a significant decrease.

Degradation kinetics of DNA stored in DNAshells

For each time point, we calculated the proportion of intact nucleotide position, Puncut, from the numbers of amplifiable copies of the 1064 pb and 93 pb amplicons. We plotted these values as a function of the degradation time to determine the degradation rate constants for each temperature by curve fitting (Fig 4).

Fig 4

Degradation kinetics of DNA stored in DNAshells.

The lines are the fit to the data points by Microsoft Excel software.

Then, we plotted the logarithm of kT as a function of the reverse of the absolute temperature (T) (Fig 5).

Fig 5

Arrhenius plot for DNA degradation in DNAshells.

The degradation rate constants, k, were plotted as a function of the reverse of the absolute temperature T.

This plot showed that the degradation rate followed the Arrhenius law with an activation energy of 197 kJ/mol. This is comparable to the 163 kJ/mol to 188kJ/mol previously found for desiccated plasmid DNA [7] and to about the 155 kJ/mol for DNA stored in silica nanoparticles, FTA paper or DNAstable matrix [28]. This is significantly higher than the 100 kJ/mol to 121 kJ/mol found for degradation of double strand DNA in solution (reviewed in [7]).

The Arrhenius law also made it possible to extrapolate the degradation rate at 25°C. This gave a degradation rate constant of 3.82x10-15 cuts /s/nucleotide, equivalent to about 1 cut/century/100 000 nucleotides or 38 000 years of half-life for a 150-nucleotide long DNA fragment (we chose this size for an immediate comparison with the previous works [28,29]).

This allows to calculate the time necessary for a DNA molecule to degrade down to 25 nucleotides, the average length which is the current limit for the sequencing of degraded DNA [31] using the formula:

This gives 1,070,000 years, provided the preservation conditions are maintained.

Fig 6 compares the half-lives of a 150 nucleotides long DNA fragment stored in various conditions at 25°C.

Fig 6

Half-lives of a 150 nucleotides long DNA fragment stored in various conditions.

The half-life of a DNA sample left unprotected from the atmosphere at room temperature (a) or in an Eppendorf closed tube (b) has been calculated from our previous work [7]. The one of a sample encapsulated in silica nanoparticles (g), deposited on FTA card paper (i) or included in Biomatrica DNAstable (h) has been estimated from [28] (Fig 2B). The half-life of DNA dried with calcium phosphate (e) and encapsulated in magnetic silica nanoparticles (f) have been estimated, respectively from [29] (Fig 3B) and [19] (Fig 5) assuming an exponential decay and an activation energy of 155 kJ/mol. The half-life for DNA stored in Gentegra (d) or trehalose (c) was taken from [29] (Fig 2B). In grey: Current commercialized procedures.

So, it appears that the DNA stability at room temperature (25°C) is over three orders of magnitude higher in DNAshells than in any of the other currently commercialized storage devices. This is to be expected because, first, FTA paper, trehalose or calcium phosphate leaves the DNA samples directly exposed to the atmosphere. Second, likewise, the matrices coating DNA: Gentegra, DNA stable and trehalose being water soluble cannot either protect the sample from moisture. Finally, silica nanoparticles, while affording protection from atmosphere, still contain a certain amount of water [28].

It must be noticed that the experiments conducted here mainly detect chain breaks, so, other degradations events not preventing elongation by the polymerase could go undetected. More seriously, these undetected modifications could induce errors in the decoding step. However, this should not be a concern, first because DNA alterations are dependent on water and much slower than depurination and chain breaks [32]. Second controls have been done by Organick et al ([29]) who sequenced DNA samples stored at 85°C for 4 weeks. As a whole, they found that that the number of sequencing errors did not increase with storage and that these errors were stochastic and could be "dealt with easily with various means of error correction such as Reed–Solomon codes".

As a conclusion, this procedure, allowing a standalone storage is well suited for long term preservation of DNA samples because of the high percentage of DNA retrieval and DNA stability. This is especially useful for the recently developing DNA data storage procedures. Our figures make it possible to give an estimation of the lifetime of the data stored that way. Indeed, according to a recent estimation by Organick et al [33], 10 is the lowest copy number necessary for a faithful data storage and retrieval. This means that if one starts with 20 copies, the data could faithfully be retrieved after 30 centuries of storage.

Another advantage is the volume of the capsule which can accommodate large amounts of DNA. With a 200 μL useful volume and a DNA density of 1.4 g/mL [34], a single capsule could store 0.28 g of DNA. According to [35] estimating at about 17 exabytes/g the data density in DNA, this corresponds to 4.76 exabytes of data per DNAshell, equivalent to 1.6x1012 files (assuming an average file size of 3 MB). Of course, it may look difficult to recover a specific file among this mass of data, however, this seems possible as described recently by Tomek et al claiming that, by using a combination of N primers, it could be possible to select a given file in a population of 27 999 N files [36].

So, according to these figures, the 64 zettabytes of data produced in 2020 [37] could theoretically be coded in 3 765 g of DNA which could be stored in 13,445 capsules packed in a suitcase weighing 21 kg.

This procedure could also allow the long-term room temperature preservation of very large DNA molecules which is particularly interesting in the context of genome sequencing, as a recent paper by Nurk et al described for the first time the sequencing of a complete human genome thanks to the use of very long DNA stretches [38].

Gel electrophoresis.

(DOCX)

Click here for additional data file.

qPCR curves.

(PPTX)

Click here for additional data file.

qPCR results.

(XLSX)

Click here for additional data file.

18 Aug 2021

PONE-D-21-23797

Long term conservation of DNA at ambient temperature. Implications for DNA data storage

PLOS ONE

Dear Dr. Bonnet,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we have decided that your manuscript does not meet our criteria for publication and must therefore be rejected.

I am sorry that we cannot be more positive on this occasion, but hope that you appreciate the reasons for this decision.

Yours sincerely,

Mashallah Rezakazemi

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Long term conservation of DNA at ambient temperature. Implications for DNA data storage by Delphine Coudy , Marthe Colotte , Aurélie Luis , Sophie Tuffet and Jacques Bonnet

Herein the authors demonstrate a technique to encapsulate DNA and claim its long term stability.

I have few comments and I strongly feel the study is not matured enough and lacks adequate merits to be published in Plos One.

1. After reading the abstract it is not clear how the authors have stabilized DNA, however after going through material and methods it is somewhat clear that the authors have dehydrated DNA aqueous solution and then stored in stain less steel capsules in very low concentration. This should be written in abstract as well.

2. The authors mentioned that the encapsulation process is described by them previously but have not provided any reference.

3. I don’t see any electrophoresis figures to ascertain the claim. It should be provided as supporting information.

4. The authors have heated the capsules, I believe the stability is due to the absence of moisture, stain less steel is not playing any role except stopping the heat transmission due to perhaps its insulating behaviour. In this case, what exactly is the advantage or role of stainless steel capsules? In any case if water somehow enters it can denature DNA.

5. The authors heat the steel capsules maximum at 140 deg C, DNA degrade in dry condition above 190 deg C.

6. Dimension of capsule shells should be provided, their supplier, type of steel used etc. may be provided.

7. Since authors have a noble aim to preserve the DNA samples under ambient conditions, the DNA should have been kept under ambient conditions after taking out from the shells and then carry out the stability study. This will help the use of DNA for material preparation where robust processing of the building block is desired.

8. DNA Stability study using some other technique should be attempted.

Reviewer #2: The manuscript presents results for the long-term conservation of DNA at ambient temperature. The study demonstrates an innovative way of DNA at ambient temperature. From my point of view, this is a well-performed study, which provides a rationale for further validation studies. However, the paper requires minor revision to become suitable for the readership.

(from the DNAshells™ to the result)

Materials and Methods

An illustration of the workflow would be helpful (samples -> conservation method -> degradation -> qPCR -> result).

Also, a schematic illustration of DNA encapsulation process would be helpful.

How many samples were used for which conservation method? -> A table would certainly be helpful here.

How much DNA was used?

qPCR: Which device was used with which settings?

Results:

qPCR curves should be demonstrated.

DNA recovery and qPCR results should be presented in a table for all conservation methods.

Reviewer #3: I recommend this work for publication, pending minor clarifications. In this work, the authors took two amplicons of different length and aged them at temperatures ranging from 100C to 140C for various lengths of time. The amount of full length product of each sample was then quantified via qPCR, and the extrapolated half life was found to be orders of magnitude longer than previously published preservation methods. The work was easy to understand and clearly described, I have only minor clarifications that should be addressed.

Minor clarifications:

I could not find any mention in the text about what the time points were. Looking at Figure 1, it appears the time points varied from hundredths of a second (i.e., 20x10^-3) to 25 hours (1500 seconds). Are the x-axis mislabeled in the plots for temperatures 100, 110 and 120? A sample will not have had time to come up to a uniform temperature with short amounts of time elapsed, I wonder if the authors meant 10^3?

Could you label the y-axis of Fig. 3?

“Moreover, Organick et al sequenced the DNA samples stored at 85 °C for 4 weeks without noticing any increase in error rates while there is a significant number of chain breaks [29].”

Organick et al [29] did not sequence DNA with chain breaks, so while they found no increase in error rates, I do not think we can claim that DNA that doesn’t break has a similar no increase in error rate. Based on the ambiguous wording of the above sentence, I would rephrase the sentence you wrote to make your claim more clear.

“With a 200 μL useful volume and a DNA density of 1.4 [34], a single capsule could store 0.28 g of DNA. According to [35] estimating at about 17 exabytes/g the data density in DNA, this corresponds to 4.76 exabytes of data per DNAshell, equivalent to 1.6x10^12 files (assuming an average file size of 3 Mo).”

Could you put units on the “1.4” value given, and I believe you mean “3 MB” instead of “3 Mo”?

The Data Availability statement states that all data are fully available, where is the qPCR data located? I wished to look at the data from the two amplicons of different length since neither the figures nor text do not explicitly show how breakage rates varied between the two lengths.

Minor typos:

The sentence: “This implies to keep DNA away from environmental 58

degradation factors, water, oxygen, ozone, and other atmospheric pollutants[7,8,9,10], water 59 being by far the most deleterious element” is incomplete, I’m not sure exactly what the authors are intending to communicate here.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

- - - - -

For journal use only: PONEDEC3

30 Sep 2021

Response to Reviewers

August 21 2021

Reviewer #1: Long term conservation of DNA at ambient temperature. Implications for DNA data storage by Delphine Coudy , Marthe Colotte , Aurélie Luis , Sophie Tuffet and Jacques Bonnet

Herein the authors demonstrate a technique to encapsulate DNA and claim its long term stability.

I have few comments and I strongly feel the study is not matured enough and lacks adequate merits to be published in Plos One.

1. After reading the abstract it is not clear how the authors have stabilized DNA, however after going through material and methods it is somewhat clear that the authors have dehydrated DNA aqueous solution and then stored in stain less steel capsules in very low concentration. This should be written in abstract as well.

answer

In the abstract we stated "…procedure for long-term conservation of biospecimen at room temperature based on the confinement of the samples under an anhydrous and anoxic atmosphere maintained inside hermetic capsules…" The principle of the procedure is quite simple, consisting essentially in protecting the samples in an airtight capsule. There is no need to add further details.

2. The authors mentioned that the encapsulation process is described by them previously but have not provided any reference.

answer

We did provide two references at the end of the paragraph. However, for more clarity, in the revised version we have also added them after the first sentence (Line 98).

3. I don’t see any electrophoresis figures to ascertain the claim. It should be provided as supporting information.

answer

Gel electrophoresis were run only as size controls to choose the time points corresponding to DNA sizes small enough (< 8 kb apparent size) to give significant values by qPCR.

Gel electrophoresis are given in Supporting information file S1 (Line 164).

4. The authors have heated the capsules, I believe the stability is due to the absence of moisture, stain less steel is not playing any role except stopping the heat transmission due to perhaps its insulating behavior. In this case, what exactly is the advantage or role of stainless steel capsules? In any case if water somehow enters it can denature DNA.

answer

It is clear, from our introduction, that moisture is indeed the main problem for DNA preservation, and this point is clearly stated in the papers given in reference, for instance:

27. Colotte M, Coudy D, Tuffet S, Bonnet J. Adverse Effect of Air Exposure on the Stability of DNA Stored at Room Temperature. Biopreserv Biobank. 2011; 9(1): 47-50. doi: 10.1089/bio.2010.0028.

It is also clear that the role of the capsule is precisely to prevent water from reaching the DNA (using metallic container and welding being the only way to have an absolute hermeticity) and in no case to constitute an insulation barrier (which a metal cannot do).

Water does not denature DNA but contributes to its degradation.

5. The authors heat the steel capsules maximum at 140 deg C, DNA degrade in dry condition above 190 deg C.

answer

If this means that dry DNA cannot degrade below 190-degree C, it cannot be true: DNA, even dry, degrades at any temperature, the degradation rates just increasing with temperature.

6. Dimension of capsule shells should be provided, their supplier, type of steel used etc. may be provided.

answer

Details about the characteristics of the capsules have been added (Line 103).

7. Since authors have a noble aim to preserve the DNA samples under ambient conditions, the DNA should have been kept under ambient conditions after taking out from the shells and then carry out the stability study. This will help the use of DNA for material preparation where robust processing of the building block is desired.

answer

Room temperature degradation studies of DNA, protected or unprotected, have previously been reported by us or others, for instance in the above cited paper (ref [27]). Taking the DNA out of the shell is only for analysis purposes, at the end of the room temperature storage or ageing period (potentially stopped by cold storage during the remaining time of the kinetics). The DNA had be used quickly after rehydration to take into account only the events of the analyzed period.

8. DNA Stability study using some other technique should be attempted.

answer

There is a whole literature describing such techniques, in particular: [29]. Organick L, Nguyen BH, McAmis R, Chen WD, Kohll AX, Ang SD, et al. An Empirical Comparison of Preservation Methods for Synthetic DNA Data Storage. Small Methods. 2021; 5. The aim of our paper is precisely to complement these works.

Reviewer #2: The manuscript presents results for the long-term conservation of DNA at ambient temperature. The study demonstrates an innovative way of DNA at ambient temperature. From my point of view, this is a well-performed study, which provides a rationale for further validation studies. However, the paper requires minor revision to become suitable for the readership.

(from the DNAshells™ to the result)

Materials and Methods

1- An illustration of the workflow would be helpful (samples -> conservation method -> degradation -> qPCR -> result).

answer

This workflow has been added as Fig 2. at the line 152.

2- Also, a schematic illustration of DNA encapsulation process would be helpful.

answer

A workflow summarizing the encapsulation process has been added as Fig 1., line 105.

3- How many samples were used for which conservation method? -> A table would certainly be helpful here.

answer

A table (table 1) has been added (Line 158).

4- How much DNA was used?

answer

This is indicated in the experimental strategy (Fig 2 and line 111 and 130).

5- qPCR: Which device was used with which settings?

answer

The PCR apparatus used is specified line 124.

6- Results:

qPCR curves should be demonstrated.

answer

qPCR curves have been added in Supporting Information File S2- qPCR curves, line 164.

7- DNA recovery and qPCR results should be presented in a table for all conservation methods.

answer

A table (table 2) has been added to show DNA recovery (line 172).

A table presenting the qPCR results are presented in Supporting Information File S3, qPCR results (line 163). Fig 3. has been added to visualize theses results (line 174).

Reviewer #3: I recommend this work for publication, pending minor clarifications. In this work, the authors took two amplicons of different length and aged them at temperatures ranging from 100C to 140C for various lengths of time. The amount of full length product of each sample was then quantified via qPCR, and the extrapolated half life was found to be orders of magnitude longer than previously published preservation methods. The work was easy to understand and clearly described, I have only minor clarifications that should be addressed.

Minor clarifications:

1- I could not find any mention in the text about what the time points were.

answer

An indication concerning the time points (ranging from 2 min to 48 h) has been added line 156.

- Looking at Figure 1, it appears the time points varied from hundredths of a second (i.e., 20x10^-3) to 25 hours (1500 seconds). Are the x-axis mislabeled in the plots for temperatures 100, 110 and 120? A sample will not have had time to come up to a uniform temperature with short amounts of time elapsed, I wonder if the authors meant 10^3?

answer

We modified the time labels to make them clearer. The original Fig 1 is now Fig 3.

2- Could you label the y-axis of Fig. 3?

answer

The y-axis of Fig 3 (now Fig 5) has been labeled.

3- “Moreover, Organick et al sequenced the DNA samples stored at 85 °C for 4 weeks without noticing any increase in error rates while there is a significant number of chain breaks [29].”

Organick et al [29] did not sequence DNA with chain breaks, so while they found no increase in error rates, I do not think we can claim that DNA that doesn’t break has a similar no increase in error rate. Based on the ambiguous wording of the above sentence, I would rephrase the sentence you wrote to make your claim more clear.

answer

The sentence has been rewritten.

4- “With a 200 μL useful volume and a DNA density of 1.4 [34], a single capsule could store 0.28 g of DNA. According to [35] estimating at about 17 exabytes/g the data density in DNA, this corresponds to 4.76 exabytes of data per DNAshell, equivalent to 1.6x10^12 files (assuming an average file size of 3 Mo).”

Could you put units on the “1.4” value given,

answer

The units have been added (Line 246).

5- and I believe you mean “3 MB” instead of “3 Mo”?

answer

This has been corrected (Line 249).

The Data Availability statement states that all data are fully available, where is the qPCR data located? I wished to look at the data from the two amplicons of different length since neither the figures nor text do not explicitly show how breakage rates varied between the two lengths.

answer

We added qPCR data in Supporting Information File S3 qPCR results) giving, for each temperature and each time point the amplifiable copy numbers of both amplicons. These data indicate how the breakage rates "varied between the two lengths".

6- Minor typos:

The sentence: “This implies to keep DNA away from environmental 58

degradation factors, water, oxygen, ozone, and other atmospheric pollutants[7,8,9,10], water 59 being by far the most deleterious element” is incomplete, I’m not sure exactly what the authors are intending to communicate here.

answer

This part of the introduction has been modified to be clearer (Lines 57-60).

Submitted filename: Response to Reviewers 20210930.docx

Click here for additional data file.

28 Oct 2021

Long term conservation of DNA at ambient temperature. Implications for DNA data storage

PONE-D-21-23797R1

Dear Dr. Bonnet,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Jian Xu, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: The present work is an excellent study and is now ready to be published in PLOS one. The authors have carefully read all suggestions, have answered each point, and have replied to the suggested changes.

Reviewer #3: The authors have greatly clarified their work. I find the revised work sufficient and greatly improved from their initial submission.

I recommend the work for publication.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

Reviewer #3: No

2 Nov 2021

PONE-D-21-23797R1

Long term conservation of DNA at ambient temperature. Implications for DNA data storage.

Dear Dr. Bonnet:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Jian Xu

Academic Editor

PLOS ONE