| Literature DB >> 34712134 |
Jia-Chen Liu1, Sheng-Hua Liu1, Guang Fu2, Xiao-Rui Qiu1, Run-Dong Jiang1, Sheng-Yuan Huang1, Li-Yong Zhu3, Wei-Zheng Li3.
Abstract
This research was designed to analyze the composition of immune cells in obesity and identify novel and potent drugs for obesity management by epigenetic and transcriptomic conjoint analysis. DNA methylation data set (GSE166611) and mRNA expression microarray (GSE18897) were obtained from the Gene Expression Omnibus database. A total of 72 objects (35 obese samples and 37 controls) were included in the study. Immune cell composition analysis, drug repositioning, and gene set enrichment analysis (GSEA) were performed using CIBERSORT, connectivity map (CMap), and GSEA tools. Besides, we performed a single-cell RNA-seq of the immune cells from whole blood samples obtained from one obese patient and one healthy control. mRNA levels of drug target genes were analyzed by qPCR assay in blood samples from six patients and six healthy controls. Immune cell composition analysis found that CD8 + T cells and NK cells were significantly lower in the obese group. 11 drugs/compounds are considered to possess obesity-control potential, such as atorvastatin. Moreover, the expression of drug targets (STAT3, MCL1, PMAIP1, SOD2, FOX O 3, FOS, FKBP5) in obese patients were higher than those in controls. In conclusion, immune cells are potential therapeutic targets for obesity. Our results also contribute to accelerate research on drug development of obesity.Entities:
Keywords: drug repositioning; epigenomics; immunity; inflammation; obesity; transcriptomics
Year: 2021 PMID: 34712134 PMCID: PMC8546369 DOI: 10.3389/fphar.2021.714643
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
The sequences of RT‐PCR primers.
| Forward | Reverse | Amplicon size | |
|---|---|---|---|
| STAT3 | CAGCAGCTTGACACACGGTA | AAACACCAAAGTGGCATGTGA | 150 |
| MCL1 | TGCTTCGGAAACTGGACATCA | TAGCCACAAAGGCACCAAAAG | 135 |
| PMAIP1 | ACCAAGCCGGATTTGCGATT | ACTTGCACTTGTTCCTCGTGG | 121 |
| SOD2 | GGAAGCCATCAAACGTGACTT | CCCGTTCCTTATTGAAACCAAGC | 116 |
| FOXO3 | CGGACAAACGGCTCACTCT | GGACCCGCATGAATCGACTAT | 150 |
| FOS | GGGGCAAGGTGGAACAGTTAT | CCGCTTGGAGTGTATCAGTCA | 126 |
| FKBP5 | AATGGTGAGGAAACGCCGATG | TCGAGGGAATTTTAGGGAGACT | 250 |
| GAPDH | ACAACTTTGGTATCGTGGAAGG | GCCATCACGCCACAGTTTC | — |
FIGURE 1The proportion of immune cells and gene set enrichment analysis (GSEA) results based on DNA methylation profiles between normal and obese samples (A) The proportion of immune cells between normal and obese samples. The quantified contrast of the distribution of obesity‐related immune cell subtypes and the difference in immune composition in each obesity and control tissues sample (B) Enrichment plots from gene set enrichment analysis (GSEA). The low-density lipoprotein particle remodeling, positive regulation of calcium ion import, and cyclic nucleotide phosphodiesterase activity genes were significantly enriched in obesity groups (C) Clustering of KEGG pathways identified by GSEA analysis. Pathway enrichment analysis revealed a variety of signaling pathways in which fatty acid metabolism and histidine metabolism may be relevant to the pathology of obesity.
FIGURE 2The proportion of immune cells and gene set enrichment analysis (GSEA) results based on gene expression profiles between normal and obese samples (A) The proportion of immune cells between normal and obese samples. Among these, CD8 + T cells and NK cells were negatively associated with obesity (B) Enrichment plots from gene set enrichment analysis (GSEA). The arachidonic acid secretion, acyl CoA binding, and phospholipase a2 activity were significantly enriched in obesity groups (C) Clustering of KEGG pathways identified by GSEA analysis. Pathway enrichment analysis revealed TGF-β signaling pathway and p53 signaling pathway may be relevant to the pathology of obesity (D) Enrichment of immune signatures by GSEA analysis. Immunologic signatures most correlated with NeuromedinU, TGF-β, IL-4 in obese patients.
FIGURE 3Single-cell RNA sequencing and enrichment analysis of immune cells (A) TSNE plot of PBMCs from different groups and different cell type (B) Enrichment analysis of B cells (C)Enrichment analysis of CD8 + T cells (D) Enrichment analysis of CD4 + T cells (E) Enrichment analysis of NK cells (F) Enrichment analysis of monocytes.
FIGURE 4Drug repositioning and network pharmacology analysis (A) The screening results in CMap, DGIdb, and L1000 FWD databases; 12 repeated compounds were shared among all three databases (B) Pharmacology-network of the “drugs-targets-disease”; The red ellipse represent drugs. The pink ellipse represents drug targets of genes (C) GO and KEGG analyses of target genes of atorvastatin (D) Screening of the hub genes; seven genes among 201 drug targets (STAT3, MCL1, PMAIP1, SOD2, FOX O 3, FOS, FKBP5) were overlapping with differential genes from single-cell sequencing (E) Quantitative real-time PCR analysis of hub genes (n = 2 for each group); The expression of the corresponding mRNAs was all up-regulated in obese patient.
Eleven chemicals were identified as potential interventions for obesity.
| Generic name | Associated conditions | Adverse effects | Price |
|---|---|---|---|
| Daunorubicin | Acute Lymphocytic Leukemia | Sores | 163.01 USD/4 ml |
| Menadione | Factor II deficiency | Hemolytic anemia | 5.59 USD/5 mg |
| Docetaxel | Esophageal Cancers | Black, tarry stools | 477.37 USD/0.5 vial |
| Alvocidib | Esophageal cancer | Nausea | 11.4 USD/mg |
| Staurosporine | Acute Myeloid Leukemia (AML) | Abdominal or stomach cramps or pain | 156.1 USD/mg |
| Rucaparib | Advanced Ovarian Cancer | Low blood cell counts | 21.4 USD/mg |
| Cladribine | Chronic Lymphocytic Leukaemia | Hives | 102.78 USD/10 mg |
| Atorvastatin | Anginal Pain | Joint pain | Tablet: 5.0 USD/20 mg |
| Irinotecan | Esophageal Cancers | Fever | 138.07 USD/2 ml |
| Erlotinib | Locally Advanced Non-Small Cell Lung Cancer | Burning, tingling, numbness or pain in the hands, arms, feet, or legs | Tablet: 163.98 USD/150 mg |
| Sorafenib | Advanced Renal Cell Carcinoma | Bleeding | Tablet: 66.61 USD/200 mg |