Shan-Ying Wu1,2, Yu-Lun Chen3, Ying-Ray Lee4, Chiou-Feng Lin1,2,5,6, Sheng-Hui Lan7, Kai-Ying Lan7, Man-Ling Chu8, Pei-Wen Lin8, Zong-Lin Yang7, Yen-Hsu Chen9,10,11,12, Wen-Hung Wang9,10, Hsiao-Sheng Liu3,8,13. 1. Department of Microbiology and Immunology, School of Medicine, College of Medicine, Taipei Medical University, Taipei 110, Taiwan. 2. Graduate Institute of Medical Sciences, College of Medicine, Taipei Medical University, Taipei 110, Taiwan. 3. Department of Microbiology and Immunology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan. 4. Department of Microbiology and Immunology, College of Medicine, Kaohsiung Medical University, Kaohsiung 807, Taiwan. 5. Core Laboratory of Immune Monitoring, Office of Research & Development, Taipei Medical University, Taipei 110, Taiwan. 6. Center of Infectious Diseases and Signaling Research, National Cheng Kung University, Tainan 701, Taiwan. 7. Department of Life Sciences and Institute of Genome Sciences, National Yang Ming Chiao Tung University, Taipei 112, Taiwan. 8. Center for Cancer Research, Graduate Institute of Clinical Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 807, Taiwan. 9. Division of Infectious Disease, Department of Internal Medicine, Kaohsiung Medical University Hospital, Kaohsiung Medical University, Kaohsiung 807, Taiwan. 10. Sepsis Research Center, Center of Tropical Medicine and Infectious Diseases, Graduate Institute of Medicine, School of Medicine, Kaohsiung Medical University, Kaohsiung 807, Taiwan. 11. Department of Biological Science and Technology, College of Biological Science and Technology, National Yang Ming Chiao Tung University, HsinChu 300, Taiwan. 12. Institute of Medical Science and Technology, National Sun Yat-sen University, Kaohsiung 804, Taiwan. 13. Master of Science Program in Tropical Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 807, Taiwan.
Abstract
Autophagic machinery is involved in selective and non-selective recruitment as well as degradation or exocytosis of cargoes, including pathogens. Dengue virus (DENV) infectioninduces autophagy that enhances virus replication and vesicle release to evade immune systemsurveillance. This study reveals that DENV2 induces autophagy in lung and liver cancer cells andshowed that DENV2 capsid, envelope, NS1, NS3, NS4B and host cell proinflammatory high mobilitygroup box 1 (HMGB1) proteins associated with autophagosomes which were purified by gradientcentrifugation. Capsid, NS1 and NS3 proteins showing high colocalization with LC3 protein in thecytoplasm of the infected cells were detected in the purified double-membrane autophagosome byimmunogold labeling under transmission electron microscopy. In DENV infected cells, the levels ofcapsid, envelope, NS1 and HMGB1 proteins are not significantly changed compared to the dramaticaccumulation of LC3-II and p62/SQSTM1 proteins when autophagic degradation was blocked bychloroquine, indicating that these proteins are not regulated by autophagic degradation machinery.We further demonstrated that purified autophagosomes were infectious when co-cultured withuninfected cells. Notably, these infectious autophagosomes contain DENV2 proteins, negativestrandand full-length genomic RNAs, but no viral particles. It is possible that the infectivity ofthe autophagosome originates from the full-length DENV RNA. Moreover, we reveal that DENV2promotes HMGB1 exocytosis partially through secretory autophagy. In conclusion, we are the firstto report that DENV2-induced double-membrane autophagosomes containing viral proteins andfull-length RNAs are infectious and not undergoing autophagic degradation. Our novel findingwarrants further validation of whether these intracellular vesicles undergo exocytosis to becomeinfectious autophagic vesicles.
Autophagic machinery is involved in selective and non-selective recruitment as well as degradation or exocytosis of cargoes, including pathogens. Dengue virus (DENV) infectioninduces autophagy that enhances virus replication and vesicle release to evade immune systemsurveillance. This study reveals that DENV2 induces autophagy in lung and liver cancer cells andshowed that DENV2 capsid, envelope, NS1, NS3, NS4B and host cell proinflammatory high mobilitygroup box 1 (HMGB1) proteins associated with autophagosomes which were purified by gradientcentrifugation. Capsid, NS1 and NS3 proteins showing high colocalization with LC3 protein in thecytoplasm of the infected cells were detected in the purified double-membrane autophagosome byimmunogold labeling under transmission electron microscopy. In DENV infected cells, the levels ofcapsid, envelope, NS1 and HMGB1 proteins are not significantly changed compared to the dramaticaccumulation of LC3-II and p62/SQSTM1 proteins when autophagic degradation was blocked bychloroquine, indicating that these proteins are not regulated by autophagic degradation machinery.We further demonstrated that purified autophagosomes were infectious when co-cultured withuninfected cells. Notably, these infectious autophagosomes contain DENV2 proteins, negativestrandand full-length genomic RNAs, but no viral particles. It is possible that the infectivity ofthe autophagosome originates from the full-length DENV RNA. Moreover, we reveal that DENV2promotes HMGB1 exocytosis partially through secretory autophagy. In conclusion, we are the firstto report that DENV2-induced double-membrane autophagosomes containing viral proteins andfull-length RNAs are infectious and not undergoing autophagic degradation. Our novel findingwarrants further validation of whether these intracellular vesicles undergo exocytosis to becomeinfectious autophagic vesicles.
Dengue is an arboviral disease caused by the dengue virus (DENV), which is transmitted to humans by mosquitoes of the Aedes family. DENV is a re-emerging virus worldwide, possibly due at least in part to global warming. Therefore, there is an urgent need to develop effective vaccines and therapeutic strategies to combat this growing threat. DENV consists of four serotypes and is an enveloped positive-strand RNA virus belonging to the Flaviviridae family. Each of the four serotypes can cause disease symptoms ranging from mild dengue fever to severe dengue, including hemorrhagic fever and shock syndrome. The genome of DENV is over 11 kb and contains 3 structural and 7 nonstructural genes [1,2]. The capsid protein is essential in virus assembly as it packages de novo synthesized RNA to form a nucleocapsid [3]. Precursor membrane glycoprotein (prM) is important in the formation and maturation of the viral particle. During virus maturation, prM is cleaved into pr and M fragments, which occurs in the acidic post-Golgi vesicles, by cellular protease furin [4]. The envelope protein located on the surface of the mature viral particle participates in the initial attachment of this particle to the host cell and regulation of the inflammatory response [5,6]. Non-structural protein 1 (NS1) exists as multiple oligomeric forms and is found in various cellular locations. Intracellular NS1 plays an essential role in virus replication and colocalizes with double-strand RNA (dsRNA) together with other components of replication complexes [7]. The NS3 protein plays a role as it encodes RNA helicase and NTPase/RTPase [8,9]. NS4B is involved in blocking IFN signaling and inducing autophagosome formation [10]. All of these structural and non-structural proteins of DENV play diverse roles in DENV pathogenesis.Autophagy is functionally classified as conventional degradative autophagy and unconventional secretory autophagy. The former regulates cellular metabolism to protect the cell from stresses caused by damage through degradative machinery [11]. The latter is a poorly understood process. The double-membrane autophagosome-like vesicles along with the recruited cargoes fuse with the plasma membrane instead of lysosomes for exocytosis. Traditionally, the cargoes in the cell are delivered through the conventional endoplasmic reticulum-Golgi apparatus-plasma membrane pathway. In contrast, the proteins without secretory signaling sequences are transported to the extracellular environment by a different mechanism. Secretory autophagy affects the secretion of diverse cargoes ranging from cytokines (IL-1, IL-6, IL-18, CXCL8 and HMGB1), granule contents, ATP and mitochondria to viral particles, including poliovirus, coxsackievirus B, Enterovirus 71 (EV71) and bacteria [12,13,14]. Autophagy-related vesicles (LC3+) are able to transport the mature infectious dengue particles, thereby allowing virus transmission while avoiding antibody neutralization [15]. A recent report demonstrated that a Lyn-dependent exit route of DENV in LC3+ secretory organelles enable them to evade circulating antibodies and might affect tissue tropism [16]. Aberration autophagy-dependent secretion may progress to the development of various diseases, including pathogen infection and neurodegeneration, as well as innate and adaptive immune responses.We previously reported that DENV2 and EV71 infection-induced autophagy promotes viral replication and pathogenesis [17,18,19,20,21,22]. DENV2 infection activates the autophagy machinery to form autophagosomes. The marker of autophagosome LC3 protein colocalized with dsRNA, DENV-NS1 and ribosomal protein L28, indicating that the DENV replication machinery is located on the autophagic vesicles [23]. Furthermore, DENV infection induced-autophagy also regulates cellular mechanisms, such as lipid metabolism and DENV2 induced-autophagy selectively engulfs the lipid droplets followed by the release of free fatty acids, which are converted to β-oxidation to produce ATP and promote DENV replication [24]. Furthermore, we previously reported that DENV2-induced glycolysis and ER stress increases autophagy activity, viral replication and pathogenesis through different signaling pathways both in vitro and in vivo [17,18]. Moreover, DENV NS4A protein can also induce autophagy through the activation of unfolded protein response (UPR) [25]. In addition, DENV can activate the AMP kinase-mTOR axis to stimulate proviral lipophagy [26]. These findings imply that autophagy degradative machinery plays a pivotal role in DENV replication. However, emerging evidence reveals that autophagy also participates in extracellular vesicle trafficking of specific proteins and molecules [14,27,28]. For example, inflammatory cytokine IL-1β and HMGB1 are released by secretory autophagy mediated by Rab8a (a small GTPase) in mammalian cells [29]. Nevertheless, current evidence on the mechanisms of flavivirus secretion is limited.This study reveals that DENV2 structural and non-structural proteins, as well as viral genomic RNAs, are in the purified autophagosomes which are infectious. Based on the findings of Li et al., mature DENV exits the cell through the Lyn-dependent (a src family tyrosine kinase) secretory autophagy machinery, implying that the intracellular infectious autophagosomes carrying DENV proteins and genomic RNAs may use the similar pathway to exit the cargoes.
2. Materials and Methods
2.1. Cell Culture
A549 (Human lung carcinoma), Vero (Monkey kidney), BHK-21 (Baby hamster kidney) and Huh7 (Human hepatoma) cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (Invitrogen) at 37 °C with 5% CO2. All of these cells were supplemented with 10% fetal bovine serum (FBS; Biological Industries, Kibbutz Beit Haemek, Israel) and penicillin/streptomycin with 10,000 units of penicillin and 10 mg of streptomycin/mL (Sigma, Saint Louis, MO, USA).
2.2. Dengue Virus
Vero cells were maintained at 37 °C in DMEM supplemented with 10% FBS and penicillin/streptomycin. DENV2 (16,681 strain) was maintained in Vero cells with DMEM containing 2% FBS and cultured at 37 °C for 4 to 5 days. The cultured media were collected and frozen at −70 °C. The virus titer was determined in BHK-21 cells by plaque assay [30]. For the virus infection experiment, cells were infected with DENV2 at 37 °C for 2 h. The cells were then incubated at 37 °C in the normal medium with or without specific treatment.
2.3. Immunoblotting
The cell lysates were collected from the cells after various treatments and total protein was extracted with the lysis buffer [1 mL RIPA, 4 μL Na3SVO4 (0.5 M), 20 μL EGTA (0.1 M), 10 μL PMSF (0.1 M), 5 μL aprotinin (2 mg/mL) and 5 μL leupeptin (2 mg/mL) and 2 μL EDTA (0.5 M)]. Total protein was separated by SDS-polyacrylamide gel and transferred to polyvinylidene difluoride membranes (EMD Millipore, Burlington, MA, USA) in the transfer buffer (0.025 M Tris-Base, 0.2 M Glycin) at 70 volts for 3 h using electroblotting (Amersham Pharmacia Biosciences Corp., Piscataway, NJ, USA). Membranes were blocked with 5% skim milk for 1 h. The primary antibodies LC3B (MBL), capsid (GeneTex, Irvine, CA, USA), envelope (GeneTex), NS1 (Sigma), NS3 (GeneTex) and NS4B (GeneTex) were used to detect specific proteins. The membrane was rinsed with enhanced chemiluminescence (ECL) (WBKLS0500; Millipore) and exposed by BioSpectrum AC (101-206-009; UVP, Upland, CA, USA).
2.4. Immunofluorescence Staining
The A549 cells were seeded into 6-well plates containing cover glasses (22 mm × 22 mm, Deckglaser, Paul Marienfeld GmbH & Co. KG, Lauda-Königshofen, Germany) and incubated at 37 °C for 24 h. The cells were infected by DENV2 for 2 h and then were replaced with 10% FBS DMEM [31]. The cells were fixed in 3.7% formaldehyde for 30 min. After washing with phosphate-buffered saline (PBS), the cells were incubated for 30 min in 0.1% Triton X-100 in PBS. The primary antibodies were added to the plate and incubated at 4 °C overnight. The primary antibodies LC3B (MBL), capsid (GeneTex), envelope (GeneTex), NS1 (Sigma), NS3 (GeneTex) and NS4B (GeneTex) were used to detect specific proteins. Hoechst (5 mg/mL; Sigma) was used at a dilution of 1:500 in PBS to stain the nucleus. The secondary antibodies: Anti-Mouse IgG Antibody (FITC or PE conjugate) and anti-Rabbit IgG Antibody (FITC or PE conjugate) were used and the mounting media is glycerol gelatin aqueous slide mounting medium (Sigma-Aldrich). The fluorescent change of the cells was detected under a multi-photon confocal microscope (Olympus, FV1000MPE, Tokyo, Japan).
2.5. Small Hairpin RNA (shRNA) Transfection System
A549 cells were seeded in a 10 cm petri dish. After 24 h, cells were transfected with shGFP and shAtg5 by lipofectamine 2000 (Invitrogen, Waltham, MA, USA) and incubated at 37 °C in 5% CO2 overnight. The shRNA ATG5 target sequences were #1: CCTTTCATTCAGAAGCTGTTT and #2: CCTGAACAGAATCATCCTTAA. The shRNA GFP target sequence was ACAACAGCCACAACGTCTATA. All shRNAs were purchased from National RNAi Core Facility, Academia Sinica, Taiwan.
2.6. RNA Extraction
Total RNA of samples was extracted by Trizol reagent (MDBio, Inc., Taiwan) and incubated with chloroform (Sigma) at room temperature for 10 min. The mixture was centrifuged at 12,000 rpm for 15 min at 4 °C and the supernatant was transferred to new Eppendorf tubes containing 0.5 mL isopropanol (Merck KGaA, Darmstadt, Germany) and then precipitated at −70 °C overnight. The supernatant was discarded by centrifugation at 12,000 rpm for 8 min at 4 °C. The pellets were washed with 75% ethanol and then centrifuged at 7500 rpm for 5 min at 4 °C; washing and centrifugation were then repeated. The RNA pellets were air-dried for 3 to 5 min and dissolved by DEPC H2O.
2.7. Reverse Transcription
RNA was transcribed to cDNA by High-Capacity cDNA Reverse Transcription Kits (Thermo Scientific, Waltham, MA, USA). RNA sample (2 µg/10 µL) was mixed with 10 µL 2× RT Master Mix into each tube. The reverse transcription reactions were performed at 37 °C for 2 h in 20 μL of the RT-buffer mixture. In addition, a D8B anti-sense cDNA primer was used to initiate cDNA synthesis [32].The primer sequence of D8B: CTGCAGAGAACCTUTTGATTC.
2.8. Reverse Transcription for DENV Negative-Strand RNA
RNA was transcribed to cDNA by High-Capacity cDNA Reverse Transcription Kits. RNA sample (2 µg/10 µL) was mixed with 10 µL 2× RT Master Mix into each tube. The reverse transcription reactions were performed at 37 °C for 2 h in the presence of Taq-3.2 primer for the negative strand-specific reverse transcription in 20 μL of RT-buffer mixture. [33]. After negative strand-specific reverse transcription, Taq and Taq-3.1 primers were used to amplify the 127 base pair (bp) sequences by PCR [34].Primer sequences:Taq-3.2: 5′- CGGTCATGGTGGCGAATAAGCAGATCTCTGATGAATAAC-3′Taq: 5′- CGGTCATGGTGGCGAATAA-3′Taq-3.1: 5′- TTGTCAACTGTTGCACAGTCG-3′
2.9. Polymerase Chain Reaction (PCR)
DENV2 5′-end N1A-E1 (358 bp) and NS1 (258 bp) cDNAs were amplified by PCR using the following primers:N1A-E1 Forward: 5′-AUAAUTTUTTAGTCTACGTGGACCGACAAAGAC-3′N1A-E1 Reverse: CAGATCTCTGATGAATAACC-3′NS1 Forward: 5′-CACAGATAACGTGCATACATGGAC-3′NS1 Reverse: 5′-TGAGGCCGCAGAGATCG-3′The conditions of the thermal cycler were programmed as follows. Denaturation was conducted at 94 °C for 5 min. The cDNA generated in the presence of RT-primer was subjected to 35 cycles of DNA amplification with sequential steps at 94 °C for 30 s, 58 °C for 30 s and 72 °C for 1 min.
2.10. Autophagosome Purification
The cells with or without DENV infection were suspended in 0.4 mL 10% sucrose and mixed with 0.5 mL 1 M Hepes/0.1 M EDTA and homogenized using a Dounce homogenizer. This homogenate was diluted with homogenization buffer (HB; 0.25 M sucrose, 10 mM HEPES, 1 mM EDTA, pH 7.3) containing 1.5 mM glycyl-l-phenylalanine 2-naphthylamide and 1% dimethyl sulfoxide (DMSO). After incubation for 7 min at 37 °C to destroy the lysosomes, the homogenate was cooled to 4 °C. The extraction was performed as previously reported [35,36].
2.11. Transmission Electron Microscope (TEM)
The cells and autophagosome fraction (AP) were fixed with 2.5% glutaraldehyde in 0.1 M cacodylate buffer for 10 min at 4 °C, followed by three-time treatments of 0.1 M cacodylate buffer containing 4% sucrose for 15 min at 4 °C and post-fixed in 1% osmium tetroxide in 0.1 M cacodylate buffer at RT and washed two times with 0.1 M cacodylate buffer containing 5% sucrose 15 min at RT. The followed by 50%, 70%, 85% and 95% ethanol dehydration for 10 min each and three times with 100% ethanol for 20 min. The sample was treated with propylene oxide two times for 10 min before exposure to propylene oxide/Epikote. After soaking the cells with Epikote two times for 8 h, the cells were embedded with 47.5 μL of Epikote (Glycide ether 100), 24.5 μL of dodecenyl succinic anhydride and 28.5 μL of methylnorbornen-2,3-dicarboxylic anhydride after mixing for 30 min. DMP-30 [2,4,6-tris(dimethylaminomethyl) phenol] (1.5 mL) was then added for 24 h at 60–70 °C. The ultrathin sections of the A549 cell pellet with or without DENV infection and autophagosome fraction (AP) on the nickel grids were treated with 10% H2O2 for 10 min. After washing with PBS, the grids were treated with protease K (10 µg/mL) at 37 °C for 15 min. Grids were then washed in PBS and blocked for 30 min followed by primary antibody treatment. Grids were incubated with anti-mouse IgG (18 nm Gold) secondary antibody (Abcam, MA, USA) or anti-rabbit IgG (12 nm Gold) secondary antibody (Abcam) for 1 h. The sections on the grids were stained with saturated uranyl acetate and lead citrate and investigated under an electron microscope (HITACHI-7000, Tokyo, Japan) [36]. The microscope voltage is 60 KV; the magnification is 10,000× for cell and 70,000× for purified autophagosome.
2.12. Statistical Analysis
Data are presented as the mean ± SD values (error bars). Differences between the experimental and control groups were analyzed by Student’s t-test. The symbol represents *: p < 0.05; **: p < 0.01 and ***: p < 0.001.
3. Results
3.1. DENV2 Increases LC3-II Level, Autophagic Vesicles and Viral Proteins Are Colocalized with LC3 Protein in Infected A549 Lung Cancer Cells
We previously reported that DENV induces autophagy in liver cancer Huh7 cells and plays a promoting role in viral replication [22,37]. Here, we used live and heat-inactivated DENV2 to infect lung cancer cells A549 [31] and demonstrated that the conversion of the autophagy marker LC3-II protein increased, which was accompanied by a higher level of DENV2 NS3 protein in the DENV2 infection cells compared to the non-infection (Mock) and heat-inactivated DENV (iDENV2) cells (Figure 1A). The quantification of LC3 conversion (LC3-II/LC3-I) is widely used to evaluate the level of autophagic activity. Furthermore, more autophagic vesicles including double-membrane autophagosome and single-membrane autophagic vesicles were detected in DENV2-infected A549 cells compared to the Mock infected cells under transmission electron microscopy (TEM) (Figure 1B).
Figure 1
DENV2 increases LC3-II level, autophagic vesicles and viral proteins are colocalized with LC3 protein in infected lung cancer cells. (A) A549 cells were treated with mock, live DENV2 (MOI = 10), or heat-inactivated DENV2 (iDENV2; MOI = 10) for 36 h. Protein was extracted from the whole cell lysate and analyzed by immunoblotting for NS3 and LC3 expression. β-actin was used as the internal control. (B) A549 cells after infection were fixed at 36 h post-infection (p.i.) and observed under TEM. Scale = 2 µm. The white arrow represents double-membrane autophagosome in (a). Single membrane autophagic vesicles in (b). Scale bar = 0.2 µm in the enlarged picture (a). (C) Cells were infected with or without DENV2 (MOI = 10) for 36 h and examined for the colocalization of LC3 (green) and DENV2-Capsid, Envelope, NS1, NS3 and NS4B (red) under confocal microscopy. The yellow dots indicate colocalization of DENV2 proteins and LC3. Scale bar = 10 µm. (D) Quantification of the colocalization between DENV2 proteins (capsid, envelope, NS1, NS3 and NS4B) and LC3 puncta in DENV2-infected cells. The percentage of colocalization was quantified by counting the number of yellow dots in the cells and the cells containing more than five yellow dots represent colocalization-positive. Three fields of 10 cells each were countered under each experimental condition. The data shows Mean ± SD and the p values were determined by Student’s t-test analysis. * p < 0.05, ** p < 0.01, *** p < 0.001.
As a defense response, autophagosomes selectively engulf pathogens for degradation in the host cells. In this study, we were interested in identifying the DENV2 components that are associated with autophagosomes in infected cells. We found that the number of fluorescent green LC3 punctate structures (representing autophagic vesicles) was increased after DENV2 infection by confocal microscopy. The infected cells were examined to determine the presence or absence of DENV2 structural proteins capsid (C) and envelope (E) and non-structural proteins (NS1, NS3 and NS4B) as well as their colocalization with autophagy LC3 protein. We detected these five proteins (red) and showed varying degrees of colocalization with LC3 (green) in infected cells, with capsid protein showing the greatest colocalization, followed by NS3, NS1, envelope and NS4B protein (Figure 1C,D).
3.2. DENV2 Capsid, Envelope, NS3, NS4B and Cellular HMGB1 Proteins Were Abundantly Detected in the Purified Autophagosomes of Infected Lung Cancer Cells
To clarify whether DENV2 proteins are associated with the autophagosomes in infected cells, the autophagosomes of DENV2-infected A549 cells were purified by density gradient centrifugation. Double-membrane autophagosomes were observed in the purified autophagosome fraction under TEM (Figure 2A). DENV2 capsid, NS1 and NS3 proteins showing higher colocalization with LC3 (Figure 1D) were confirmed in the purified autophagosomes under TEM using immunogold-labeled antibodies (Figure 2B, arrowhead). Most importantly, no virus-like particles were found in the purified autophagosomes.
Figure 2
DENV2 capsid, envelope, NS1, NS3 and NS4B proteins are abundantly detected in the purified autophagosomes of infected lung cancer A549 cells. (A) Cells were infected with DENV2 (MOI = 10) for 36 h followed by treatment with chloroquine (CQ, 50 μM) for another 24 h to block lysosome fusion and degradation. The autophagosome was purified by sucrose gradient centrifugation and observed under TEM. Scale bar = 100 nm. The arrow indicates the double-membrane of the purified autophagosome. (B) The protein expression of the capsid, NS1 and NS3 was detected by specific antibodies. Negative control (N.C.) used IgG antibody for immunogold-labeling. Immuno-gold labeled NS1 (18 nm gold beads), Capsid (12 nm gold beads) and NS3 (12 nm gold beads) in the purified autophagosomes were detected under the TEM. The quantification of gold particles for each protein inside autophagosomes was shown. Scale bar = 100 nm. * p < 0.05, ** p < 0.01, *** p < 0.001. (C) Lung cancer cells (A549) without DENV infection and culture for 36 h followed by blocking autophagosome and lysosome fusion with chloroquine (CQ, 50 μM) for another 24 h. Sucrose gradient centrifugation was conducted to obtain purified AP and PNS. A total of 10 μg protein from AP and PNS was loaded in SDS PAGE and analyzed by electrophoresis. The protein expression of LC3, NS3, HMGB1, Hsp 60 and Calreticulin was determined by immunoblotting. (D) Lung cancer cells (A549) were infected with DENV2 (MOI = 10) for 36 h followed by blocking autophagosome and lysosome fusion with CQ (50 μM) for another 24 h. Sucrose gradient centrifugation was conducted to obtain purified autophagosome (AP) and post-nucleus supernatant (PNS). A total of 10 μg protein from AP and PNS was loaded in SDS PAGE and analyzed by electrophoresis. The protein expression of LC3, LAMP1, capsid, envelope, NS1, NS3, NS4B, NS5, prM and HMGB1 was determined by immunoblotting using specific antibodies. LAMP1 is the marker of the lysosome and calreticulin is the marker of the endoplasmic reticulum.
We purified the autophagosome (AP) from A549 cells without DENV infection and showed very low levels of ER (calreticulin) and mitochondria (Hsp60) contamination (Figure 2C). Parallelly, in cells with DENV infection, the level of the lysosome (LAMP1) and ER (calreticulin) in AP is low. These results represent successful autophagosome purification, which was confirmed by the abundant amount of LC3-II (autophagosome marker) in the AP fraction compared to the post-nucleus supernatant (PNS) by immunoblotting (Figure 2D). Similarly, high amounts of DENV2 capsid, envelope, NS1, NS3 and NS4B proteins, accompanied with equal amounts of DENV2 prM and NS5 protein, as well as host high mobility group box 1 (HMGB1) proteins, were detected in the purified autophagosomes (Figure 2D). A similar result was seen in DENV2-infected Huh7 cells (Supplemental Figure S1). Altogether, our results demonstrated that DENV2-related proteins and host cell HMGB1 proteins, but not viral particles were present with the autophagosome in two infected cell lines.
3.3. DENV2 Capsid, Envelope, NS3 and NS4B Proteins Were Not Degraded by the Autophagic Degradation Process
As a part of the immune system, autophagy is responsible for the recruitment and degradation of harmful molecules, damaged organelles and pathogens [38]. Here, we conducted a time-course investigation of the levels of DENV2 capsid, envelope, NS3 and NS4B proteins from 0 h to 48 h p.i. during a 12 h interval. Our data showed that the levels of DENV2 capsid, envelope, NS3 and NS4B proteins each gradually increased with the duration of infection and the kinetics of these protein expressions was similar to that of LC3-II expression (Figure 3A). Blocking the autophagic degradation with lysosome, infected cells were treated with CQ and the results showed that the accumulation of LC3-II and p62 proteins increased in the CQ group compared to the untreated group, indicating that CQ effectively blocked the autophagic degradation machinery (Figure 3B). The levels of DENV2 capsid, envelope, NS3 and NS4B proteins did not accumulate in the CQ treatment group compared to the non-treatment group in DENV2-infected cells (Figure 3B), indicating that DENV2 capsid, envelope, NS3 and NS4B proteins were not affected by autophagic degradation machinery.
Figure 3
DENV2 proteins were not degraded by the conventional autophagic degradation process. (A) The protein expression levels of DENV2 capsid, envelope, NS3 and NS4B, as well as autophagy LC3 at 12, 24, 36 and 48 h in A549 cells with or without DENV2 (MOI = 10) infection, were investigated by immunoblotting using specific antibodies. (B) A549 cells were infected with or without DENV2 (MOI = 10) for 12 and 24 h followed by co-treatment with CQ (50 μM) for another 24 h. The whole-cell lysate extracted from each group was analyzed for the expression levels of DENV2 capsid, envelope, NS3 and NS4B, as well as autophagy LC3 and p62 proteins by immunoblotting using specific antibodies. β-actin was used as the internal control.
3.4. DENV2 RNAs Are Identified in Autophagosomes and the Purified Autophagosomes Are Infectious
We and other groups have reported that DENV infection induces autophagosome formation, which promotes DENV replication either by using the autophagosome double membrane as part of the replication complex or by degradation of lipid droplets to provide ATP energy [22,39]. However, whether the autophagosome selectively recruits and conveys the viral components, including the viral genome, remains poorly understood.The use of full-length genome RNA to generate infectious viruses was first reported by Racaniello and Baltimore (1981), who synthesized infectious type 1 poliovirus from the plasmid cDNA [40]. We previously revealed an in vivo approach to detect and produce matured DENVs with infectivity from the full-length genome RNA reverse-transcribed from the plasmid cDNA [30]. Moreover, we previously reported a RT-PCR method to identify DENV full-length positive-strand RNA genome in infected cells [32]. Briefly, we used a primer (D8B), which recognizes the 3′-end of the +RNA genome, to reverse-transcribe the RNA genome to cDNA (Figure 4A). To confirm the synthesis of the full-length RNA genome, we applied PCR to amplify the 3′-end of the cDNA sequence (5′end of RNA sequence) using a N1A/E1 primer set and we also used the NS1 region primer set to amplify the cDNA sequence in the middle region (Figure 4A). Our RT-PCR amplified larger amounts of a 258 bp fragment (5′-end of the genome) and a 358 bp of NS1 fragment (middle) in the purified autophagosome (AP) and the DENV2-infected cells (DENV2, as a positive control), compared to no amplification in mock infection (M) (Figure 4B), indicating that the purified autophagosomes indeed contained the full-length DENV RNA genome. Moreover, we also detected DENV2 negative-strand RNA, which was de novo synthesized to form a replication complex during viral replication (Figure 4C diagram and 4D, 127 bp fragment) accompanied with DENV-NS1 RNA expression (Figure 4D, 258 bp) in the purified autophagosome by RT-PCR. These data indicate that besides DENV proteins, the autophagosome possibly recruits both viral genome and replicative-form RNA of DENV. Because the viral particles were not identified in the purified autophagosome and importantly the replicative full-length viral +RNA was identified in the purified autophagosome, suggesting that DENV-induced autophagosome functions not only as the docking site and ATP producer for replication but also as the vesicles to convey infectious DENV components.
Figure 4
DENV2 RNAs are identified in the purified autophagosomes, which are infectious. (A) Primer D8B at the 3′end of the DENV genome was used for the initiation of cDNA synthesis. The PCR primers N1A-E1 and NS1 were used for PCR amplification and the corresponding fragments and sizes were 258 and 358 bps, respectively. (B) RNA was extracted from A549 cells with (DENV) or without DENV2 infection (Mock) and purified autophagosomes from infected cells (AP). The expression of the 5′end N1A-E1 (358 bp) and middle NS1 (258 bp) region of the DENV2 genome was measured by RT-PCR. (C) The experimental design for (D,E). The autophagosome was purified from DENV2-infected A549 cells. The upper panel shows the purified autophagosome and PNS were treated with other uninfected A549 cells. The lower panel shows the primer region in the DENV2 genome for cDNA synthesis and PCR of negative-strand DENV2 RNA. (D) RNA was extracted from A549 cells with DENV2 (Cell) or without DENV2 infection (Mock) and purified autophagosomes from infected cells (AP). The expression of negative-strand RNA and NS1 of DENV2 was determined by RT-PCR. N.C.: control of RT-PCR (without cDNA template). (E) A549 cells were cultured with purified autophagosome (AP) or PNS fraction for 72 h, followed by measuring the levels of DENV2 capsid and NS3 proteins by immunoblotting using specific antibodies. N.C.: control of RT-PCR (without cDNA template). The data shows Mean ± SD and the p values were determined by Student’s t-test analysis.
Furthermore, we co-cultured either the purified autophagosomes (AP) or the post-nucleus supernatant (PNS) from DENV2-infected cells with A549 cells (Figure 4E) to clarify whether the purified autophagosomes are infectious. Notably, higher levels of DENV2 capsid, as well as NS3 proteins, were detected in the AP fraction compared to the PNS fraction and no viral proteins were detected in the Mock treatment by immunoblotting (Figure 4E), indicating that the purified autophagosomes contained much more infectious materials. This finding is consistent with the result displayed in Figure 4B indicating that DENV-associated autophagosomes are infectious.
3.5. DENV2 Triggers HMGB1 Exocytosis Partially through Unconventional Secretory Autophagy
HMGB1 is a nuclear DNA-binding protein, which loosely binds to chromatin and is present in almost all eukaryotic cells. Extracellular HMGB1 functions as a damage-associated molecular pattern (DAMP), which has potent proinflammatory effects in many inflammatory diseases. Kim et al. reported that heat shock protein 90 (HSP90AA1) mediates the translocation of HMGB1 from nuclei to the cytoplasm and secretory autophagy is accompanied by the multivesicular body (MVB) formation-mediated HMGB1 secretion [41]. In this study, we found an increased number and translocation of the HMGB1 puncta formation in the cytoplasm in DENV2-infected A549 cells (Figure 5A), indicating that DENV2 infection increased HMGB1 the translocation from the nucleus to the cytoplasm and to be puncta formation. Furthermore, our data showed that HMGB1 was detected in the purified autophagosomes from DENV2-infected A549 and Huh7 cells (Figure 2D and Supplemental Figure S1B). These data indicate that HMGB1 associated with the autophagosome in DENV2-infected cells. To clarify whether autophagosome-associated HMGB1 was degraded by the autophagic degradation system, chloroquine (CQ) was used to block lysosome fusion and degradation. At 24 h post-infection (p.i.), CQ was added to the infected cells for another 24 h. Our data showed that LC3-II protein accumulated in the CQ treatment group, indicating that the autophagic flux was effectively blocked. Under these conditions, the HMGB1 expression level of whole cell lysate did not accumulate (Figure 5B), implying that HMGB1 was not degraded by the autophagic degradation machinery. We further investigated whether autophagosomes play a role in HMGB1 release after DENV2 infection by detecting the expression of HMGB1 in the extracellular environment at 36 h and 48 h p.i. We determined that HMGB1 exocytosis (HMGB1 expression level in culture medium) was increased in a time-dependent manner (Figure 5B). We then silenced ATG5 expression by short hairpin RNA (shATG5) to suppress the autophagic process in A549 cells. The ATG5 proteins were downregulated by RNA interference in A549 cells (Figure 5C). The ATG5 knockdown cells were infected with DENV2 at the MOI of 10 for 36 h. The expression of LC3-II protein was significantly decreased in DENV-infected ATG5 knockdown cells and the level of HMGB1 in the culture medium was decreased in shATG5 cells compared to the control shGFP cells. In contrast, the intracellular level of HMGB1 was not significantly affected (Figure 5D, whole-cell lysate). Moreover, to clarify the role of DENV-induced cell death in HMGB1 release, lactate dehydrogenase (LDH, a marker of cellular cytotoxicity and cytolysis) assay was conducted. We reveal that in DENV infected cells, LDH level was increased, however, the level of LDH showed no significant difference between DENV2-infected shATG5 cells and DENV2-infected control shGFP cells (Supplemental Figure S2). Therefore, decreased HMGB1 secretion in ATG5 KD cells may result from blockage of the secretory process or suppression of viral replication (Figure 5D). Taken together, our data imply that secretory autophagy also participates in HMGB1 exocytosis in addition to cytolysis of the DENV2-infected A549 cells. Since HMGB1 together with DENV proteins were detected in the autophagic vesicles, it is possible that these autophagic vesicles may utilize a similar trafficking pathway like HMGB1 to exocytosis of the autophagic vesicles harboring infectious DENV components such as full-length RNA genome.
Figure 5
DENV2 triggers HMGB1 exocytosis through unconventional secretory autophagy. (A) A549 cells were infected by DENV2 (MOI = 10), or heat-inactivated DENV2 (iDENV2; MOI = 10) for 36 h. The mock treatment was negative control without infection of DENV. Cells were examined for the localization of DENV-NS1 (green) and HMGB1 (red) by confocal microscopy. The quantification was the percentage of cells showing HMBGB1 puncta in the cytoplasm. Scale bar = 10 µm. ** p < 0.01. (B) A549 cells were infected with or without DENV2 (MOI = 10) for 12 h and 24 h followed by co-treatment with CQ (25 μM) for another 24 h. The whole-cell lysate and extracellular supernatant were analyzed by immunoblotting for LC3, NS3 and HMGB1 expression using specific antibodies. (C) The levels of ATG5 expression in negative control (shGFP) cells or two shATG5 clones were evaluated by immunoblotting. (D) The levels of cellular ATG5, LC3, HMGB1, and DENV-NS3 in shGFP or shATG5 cells and released-HMGB1 expression in culture medium with or without DENV2 infection were investigated by immunoblotting.
4. Discussion
We and other groups have reported that DENV infection induces autophagosome formation, which may serve as the docking site for virus replication [22,42]. Heaton et al. (2010) revealed that DENV-induced lipophagy regulates lipid metabolism by selectively recruiting lipid droplets and triglycerides to release free fatty acids followed by increasing cellular β-oxidation to generate ATP. These processes were shown to be required for efficient DENV replication [39]. DENV-NS4A proteins have been found to play an essential role in autophagy induction [25]. However, the relationships among autophagy, DENV proteins, genome RNA, viral particles and viral replication remain poorly understood. In this study, we found that part of the DENV proteins and genomic RNAs were selectively associated with the autophagosome during viral infection. Notably, purified autophagosomes containing specific DENV2 proteins and full-length genomic RNA were found to be infectious (Figure 6). Although the viral particles were not observed in the purified autophagosome under TEM, full-length positive genome RNA can de novo generate viral particles both in vitro and in vivo. Our data were providing compelling evidence that the autophagic vesicles, both intracellular and extracellular, are infectious. Our findings support the results of Li et al. (2020) who identified a Lyn-dependent exit route of DENV-containing secretory organelles, which are infectious and might affect tissue tropism [16].
Figure 6
A schematic hypothesis of the role of autophagy in DENV infection and exocytosis. DENV2 triggers the endoplasmic reticulum to form the isolation membrane in the presence of multiple factors, followed by progression to form the mature autophagosome, which may selectively recruit DENV2 proteins and RNA, including negative-stranded and full-length DENV RNAs. These infectious autophagic vesicles may be released from the infected cells partially through the secretory autophagy pathway.
In our study, DENV increased LC3-II levels at 36 h and 48 h p.i. (Figure 3 and Figure 5B) may be caused by increased autophagic activity or blockage of autophagic degradation, which can be clarified by autophagic degradation inhibitors such chloroquine (CQ) or bafilomycin A1. It is known that DENV2 internalization is mediated by clathrin-mediated endocytosis followed by trafficking to an endosomal compartment with a low-pH environment, which is required for entry, uncoating of viral particles and promoting the deposition of viral RNA into the host cytoplasm [43,44]. Bafilomycin A1 blocks degradation by preventing the acidic environment of the organelles. Differently, CQ inhibits autophagic degradation by blockage of the fusion of autophagosome and lysosome without affecting pH [45]. To avoid affecting the viral invasion process and viral replication, we selected CQ to clarify the mechanism of DENV-induced autophagy. Our data showed that CQ effectively blocked autophagic degradation in uninfected A549 cells demonstrated by significant accumulation of LC3-II and p62 proteins (Figure 3 and Figure 5). However, in DENV2 infected cells, LC3-II, as well as p62 accumulation, was not further increased either at 36 h or 48 h p.i. For example, in Figure 3B at 36 h p.i., the accumulation of LC3-II (11.0 in lane 4) after subtraction of the basal accumulation of 6.5 in lane 2 is 4.5, which is smaller than 4.8 in lane 3. Similar results were seen in Figure 3B at 48 h and Figure 5B at 36 h and 48 h p.i.. These data imply that DENV2 infection mainly leads to blockage of autophagic degradation in A549 cells. Similarly, Meza et al. (2015) reported that DENV infection of Huh7 cells induced an initial activation of autophagic flux followed by inhibition of general and specific autophagy at 36 h p.i. [46]. However, in A549 cells, whether DENV could induce an earlier autophagic flux remains to be determined.To the best of our knowledge, we are the first to successfully purify autophagosomes from DENV2-infected A549 and Huh7 cells and to reveal that DENV2 proteins and genome RNAs existed in these autophagosomes. The numbers of identified peptide sequences (peptide spectrum matches (PSMs)) of the DENV proteins in the purified autophagosomes are shown in Supplemental Figure S3. All of the DENV structural and nonstructural proteins were detected but in different proportions, indicating that mature viral particles may exist in the autophagosome. We attempted to identify the progeny DENV particles in the purified autophagosomes. However, no typical DENV virion could be observed in the purified autophagosomes under TEM. Similarly, Li et al. (2020) utilized various techniques, including discontinuous sucrose gradient centrifugation and biochemical analysis, to claim that the secretory autophagosome-like vesicles contained mature DENV particles; but the authors did not prove this result under TEM (with the exception of Zika virus) [16]. Our observation implies that the autophagosome may not directly carry the DENV2 virion out of the cell. Instead, it is probable that the infectivity of the intracellular autophagosome or the extracellular autophagosome-like vesicle originates from the full-length DENV RNA. Positive full-length viral RNA can de novo generate infectious virus when entering neighboring uninfected cells through endocytosis [30]. This speculation warrants further investigation.Previous studies revealed that HMGB1 is released passively by DENV-infected non-immune cells. However, in the present study, we discovered that the level of HMGB1 in the culture medium was reduced in ATG5 knockdown A549 cells compared with control knockdown cells (Figure 5D). Moreover, the level of LDH showed no significant difference between DENV2-infected ATG5 knockdown cells and DENV2-infected control cells (Supplemental Figure S2). Taken together, these data imply that secretory autophagy plays a partial role in HMGB1 release in DENV2-infected A549 cells. Similarly, secretory autophagy accompanied by the multivesicular body (MVB) formation-mediated HMGB1 secretion has been reported [41]. Here, we detected HMGB1 and DENV proteins, as well as RNAs in DENV-related autophagosomes (Figure 2D and Figure 4B,C,E), which provides strong evidence for our speculation that secretory autophagy participates in the exocytosis of DENV proteins and RNAs.Moreover, the release of HMGB1 was increased after CQ treatment (Figure 5B) which was similar to other group reported that secretory autophagy may be promoted by inhibiting lysosome degradation [16]. This phenomenon has also been reported in Parkinson’s disease, indicating that the inhibition of degradative autophagic flux induces α-synuclein release through secretory autophagy. The precise mechanism by which lysosome inhibitor triggers the secretory autophagy pathway remains unclear and, therefore, further research is needed.DENV infection triggered exocytosis of autophagy-related vesicles to infect neighboring cells and evade immune system surveillance. These autophagic vesicles contain DENV NS1, prM, envelope proteins and RNA [15]. Herein, we further confirmed the presence of DENV2 RNA, capsid, envelope, NS1, NS3 and NS4B proteins in the purified autophagosome of infected lung and liver cells (Figure 2D and Supplemental Figure S1). We also reveal that DENV2-induced autophagosomes were infectious, possibly through full-length DENV2 genome RNA (Figure 4E). This finding is consistent with a report by Li et al. (2020) showing that secretory autophagy mediated exocytosis of LC3+ vesicles containing infectious viruses. In summary, our results indicate that extracellular infectious dengue vesicles may originate from autophagosomes containing infectious DENV RNA.Following the maturation of the double-membrane autophagosome, it proceeds to fuse with multivesicular bodies (MVBs). In the early endosome, the cargoes within are either sorted to the vesicles that proceed to late endosomes/MVB or recycle back to the plasma membrane [47]. The late endosomes/MVB fuse with lysosomes in which their cargo is degraded and their degraded products such as amino acids are made available for reuse by the cell. MVBs and lysosomes transport cargos from the endocytic and autophagy pathways [48]. Both degradative and secretory autophagosomes are known to fuse with MVBs to generate amphisomes before fusion with lysosome or plasma membrane, respectively [27]. Degradative and secretory autophagosomes undergo interconversion or redirection of the substrate to process whether the substrate can be secreted or degraded. Given the critical role of MVB biogenesis, they regulate the interplay between autophagy and protein secretion. Exosomes are generated from the fusion of MVB with the plasma membrane and release their accumulated small vesicles with a size of 40–100 nm into the extracellular matrix [49]. A recent study has observed an analogous process in maturing reticulocytes in which LC3-positive MVB were shown to fuse with the plasma membrane in vitro and similar vesicles were identified in peripheral blood [16].Approximately 70 different Rab proteins in humans are involved in vesicle trafficking and play key roles in the regulation of the autophagic process. Rab5 is a regulator of the early steps of autophagosome formation [50]. Rab7 is required for the fusion of the autophagosome with late endosomes or lysosomes [51,52]. Rab8a and Rab8b control the autophagy secretion and degradation process, respectively [29]. Rab proteins regulate vesicle trafficking and autophagic processes are important for the DENV life cycle. Rab8 was colocalized with DENV2 in HpeG2 cells and viral entry, release and production were significantly reduced in Rab8-mutated cells [53]. Rab18 participates in the interaction of fatty acid synthase (FASN) with DENV NS3 and the recruitment of the FASN-NS3 complex to the sites of viral replication/assembly, including ER and LDs, during DENV2 infection [54]. Furthermore, Rab5 is essential for DENV entry [55]. Li et al. (2020) reported that Rab11, the transferrin receptor and LC3 were enriched in membranes of both recycling endosomes, as well as exosomal and secretory autophagic vesicles [16]. In this study, fifty Rab proteins were detected and overexpressed in the purified autophagosomes from DENV2-infected A549 cells which compare to uninfected cells by proteomic analysis, indicating that Rab proteins may participate in autophagic vesicle trafficking harboring DENV proteins and RNA (Supplemental Table S1). Rab8a and Rab11 were detected in the purified autophagosomes of DENV-infected cells, which further supports the role of secretory autophagy in DENV2-infected cells. Furthermore, SNARE complex proteins (for example syntaxin 3, syntaxin 4, SNAP29 and Sec22b) were also detected in the purified autophagosomes from DENV2-infected A549 cells by proteomic analysis, indicating that Rab and SNARE proteins may participate in autophagic vesicle trafficking harboring DENV proteins and RNA. However, the identification of the specific SNARE proteins that involve in the fusion of secretory autophagosomes with the plasma membrane needs further study.In conclusion, the intracellular autophagosomes harboring DENV2 proteins and genome RNA are infectious, however, whether they proceed to extracellular autophagic vesicles with infectivity warrants further exploration.
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6