Literature DB >> 34672097

In vitro study of chlorine dioxide on porcine intestinal epithelial cell gene markers.

Orsolya Palócz1, Zoltán Noszticzius2, Kristóf Kály-Kullai2, Emma Bradley1, György Csikó1.   

Abstract

BACKGROUND: Chlorine dioxide (ClO2 ) is an inorganic, potent biocide and is available in highly purified aqueous solution. It can be administered as an oral antiseptic in this form.
OBJECTIVES: Our aim is to determine the level of inflammatory markers and cytochrome genes expressed by enterocytes exposed to different concentrations of hyperpure chlorine dioxide solution.
METHODS: Porcine jejunal enterocyte cell (IPEC-J2) cultures were treated with the aqueous solution of hyper-pure chlorine dioxide of various concentrations. We determined the alterations in mRNA levels of inflammatory mediators, such as IL6, CXCL8/IL8, TNF, HSPA6 (Hsp70), CAT and PTGS2 (COX2); furthermore, the expression of three cytochrome genes (CYP1A1, CYP1A2, CYP3A29) were analysed by quantitative PCR method.
RESULTS: The highest applied ClO2 concentration reduced the expression of all three investigated CYP genes. The gene expression of PTGS2 and CAT were not altered by most concentrations of ClO2 . The expression of IL8 gene was reduced by all applied concentrations of ClO2 . TNF mRNA level was also decreased by most ClO2 concentrations used.
CONCLUSIONS: Different concentrations of chlorine dioxide exhibited immunomodulatory activity and caused altered transcription of CYP450 genes in porcine enterocytes. Further studies are needed to determine the appropriate ClO2 concentration for oral use in animals.
© 2021 The Authors. Veterinary Medicine and Science published by John Wiley & Sons Ltd.

Entities:  

Keywords:  chlorine dioxide; cytochrome genes; inflammatory markers; intestinal cells

Mesh:

Substances:

Year:  2021        PMID: 34672097      PMCID: PMC8959260          DOI: 10.1002/vms3.658

Source DB:  PubMed          Journal:  Vet Med Sci        ISSN: 2053-1095


INTRODUCTION

Chlorine dioxide (ClO2) is a transfer‐oxidising agent with high efficacy and speed in killing pathogens, vegetative bacteria, spores, viruses and fungi. ClO2 is a strong, but a rather selective oxidiser. Chlorine dioxide prevents the spread of pathogens between animals, from animals to humans and vice versa. ClO2 reacts fast with cysteine and methionine (two sulphur‐containing amino acids), with tyrosine and tryptophan (two aromatic amino acids) and with two inorganic ions: Fe2+ and Mn2+ (Noszticzius et al., 2013). Due to widespread and continuously emerging antimicrobial resistance, antimicrobial drug consumption is required to be significantly reduced in animal husbandry. Among arising alternative solutions, the hyperpure ClO2 (patent: Noszticzius et al., 2007) could be an ideal biocidal additive to the diet of food‐producing animals. It is a great advantage that microbial resistance to chlorine dioxide is unlikely because it acts on the thiol group which is fundamental in all living organisms (Noszticzius et al., 2013). Furthermore, during this pandemic era, the use of safe antiseptics is gaining prominence, as their use has also become generic in everyday life. Chlorine dioxide has found to be highly biocidal in low concentrations on intestinal biota while simultaneously at this same concentration having no negative effect to daily weight gain (Akamatsu et al., 2012). It is proposed that the animals can safely drink it, without any adverse effect (Ma et al., 2017). There are no scientific data regarding the biological effects of chlorine dioxide as an intestinal antiseptic in swine. We have chosen the porcine intestinal epithelial cell line (IPEC‐J2) to begin exploring these effects. The gene expression profile of IPEC‐J2 cell cultures makes them suitable for studying the effects of added compounds (Rhoads et al., 1997, Arce et al., 2010, Vergauwen et al., 2015, Razzuoli et al., 2018). The IPEC‐J2 cells are non‐cancerous intestinal columnar epithelial cells that were isolated from neonatal piglet mid‐jejunum (Langerholc et al., 2011). According to these aspects, IPEC‐J2 cell line is an adequate model for preliminary studies investigating the effect of chlorine dioxide. Our aim is to determine whether chlorine dioxide has any effect on inflammatory markers and cytochrome genes expressed by the small intestinal epithelia. The cytochrome P450 (CYP450) enzymes are involved in drug metabolism, by investigating them we might gain information about the drug interaction properties of this biocidal agent.

MATERIALS AND METHODS

Cell line and culture conditions

The non‐transformed porcine intestinal epithelial cell line IPEC‐J2, originally isolated from jejunal epithelia of a neonatal unsuckled piglet (Schierack et al., 2006), was a kind gift of Dr. Jody Gookin, Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, NC, USA. IPEC‐J2 cells were grown and maintained in complete medium, which consisted of a 1:1 mixture of Dulbecco's modified eagle's medium and Ham's F‐12 Nutrient Mixture (DMEM/F12) (plain medium) supplemented with 5% foetal bovine serum (FBS), 5 μg/ml insulin, 5 μg/ml transferrin, 5 ng/ml selenium, 5 ng/ml epidermal growth factor and 1% penicillin–streptomycin (all from Lonza Group Ltd, Belgium). Cells were grown at 37°C in a humidified atmosphere of 5% CO2. IPEC‐J2 cells were seeded onto six‐well plates (Corning Inc., Corning, NY, USA), coated with 8 μg/cm2 rat tail collagen type I (Sigma–Aldrich, Steinheim, Germany), at a density of 106 cells/ml; the volume of complete medium was 2.5 ml. Cells could adhere for 24 h before being washed and re‐fed every other day.

Cell viability test

Influence of chlorine dioxide on the viability of enterocytes was tested. A twofold serial dilution of hyperpure chlorine dioxide solution (Solvocid® Vet, Solumium Ltd, Hungary) was prepared across 7 points in phosphate‐buffered saline (PBS) from 300 to 4.7 ppm. IPEC‐J2 cells were seeded onto a 96‐well plate and incubated with the test substances for 15 min at 37°C in 5% CO2. After treatment, the cells were washed two times with PBS and were placed back to the thermostat in complete medium. Viability of IPEC‐J2 cells was measured 24 h after treatment by Neutral red uptake assay as described by Repetto et al. (2008).

Treatment of cell cultures

Before treatment, confluent monolayers of the IPEC‐J2 cells were washed with plain medium. Chlorine dioxide (ClO2) dilutions were freshly prepared prior to the experiment. Starting from 300 ppm (4.44 mM) initial ClO2 concentration, a six‐membered twofold serial dilution (2 × –64 ×) was made in PBS. Control wells received PBS for the same time period. After 15 min treatment at 37°C in 5% CO2, the cells were washed with plain medium and cultured at 37°C in 5% CO2 for additional 1 h for PCR studies.

Quantitative PCR measurements

One hour after the treatment, culture medium was removed, cells were collected, mRNA was extracted and cDNA was synthetised according to Palócz et al. (2016). Tested genes of interest were IL6, CXCL8/IL8, TNF, PTGS (COX2), CAT, CYP1A1, CYP1A2, CYP3A29 and HSPA6 (Hsp70). Hypoxanthine phosphoribosyl transferase (HPRT) and peptidylprolyl isomerase A (PPIA) were used as reference genes. Primer sequences are listed in Table 1. Quantitative PCR was performed using the iQ SYBR Green Supermix kit (BioRad, Hercules, CA, USA) on the MiniOpticon System (BioRad) according to Palócz et al. (2019).
TABLE 1

Sequence of primer sets for porcine genes, used for quantitative PCR

Gene symbolAccession numberPrimer sequences (5′–3′)Product size (bp)EfficiencyReference
CXCL8 NM_213867

F: AGAGGTCTGCCTGGACCCCA

R: GGGAGCCACGGAGAATGGGT

1261.972Paszti‐Gere et al., 2012
IL6 NM_214399

F: TTCACCTCTCCGGACAAAAC

R: TCTGCCAGTACCTCCTTGCT

1221.970Sakumoto et al., 2006
TNF NM_214022

F: TTCCAGCTGGCCCCTTGAGC

R: GAGGGCATTGGCATACCCAC

1461.873Hyland et al., 2006
PTGS2 NM_214321

F: AGAAGCGAGGACCAGCTTTC

R: AAAGCGGAGGTGTTCAGGAG

2151.905Farkas et al., 2015
CAT NM_214301

F: CAGCTTTAGTGCTCCCGAAC

R: AGATGACCCGCAATGTTCTC

1801.944Luci et al., 2007
CYP1A1 NM_214412

F: CAGAGCTGCTTAGCCTTATCAACC

R: CTGGATGCTGGGATTTGTCACCAG

3862.00Kojima et al., 2010
CYP1A2 NM_001159614

F: GTGAGGAGATGTTCAGCATCGTGAAG

R: CTTCTGTATCTCAGGATATGTCACA

3861.750Kojima et al., 2008
CYP3A29 NM_214423

F: TTCGTGCTTCACAGAGAGACCC

R: TACTAGGTGGGGGTGGATGG

5761.975Farkas et al., 2014
HSPA6 NM_001123127

F: GCCCTGAATCCGCAGAATA

R: TCCCCACGGTAGGAAACG

1522.0Zhong et al., 2010
PPIA NM_214353

F: GCGTCTCCTTCGAGCTGTT

R: CCATTATGGCGTGTGAAGTC

1601.907Hyland et al., 2006
HPRT NM_001032376

F: GGACTTGAATCATGTTTGTG

R: CAGATGTTTCCAAACTCAAC

911.963Nygard et al., 2007

Abbreviations: 1A1, family 1 subfamily A member 1; 1A2, family 1 subfamily A member 2; 3A29, family 3 subfamily A member 29; CAT, catalase; CXCL8, C‐X‐C motif chemokine ligand 8; CYP, cytochrome P450; F, forward; HPRT1, hypoxanthine phosphoribosyl transferase 1; HSPA6, heat shock protein family A (Hsp70) member 6; IL6, interleukin 6; PPIA, peptidylprolyl isomerase A; PTGS2, prostaglandin‐endoperoxide synthase 2; R, reverse; TNF, tumour necrosis factor.

Sequence of primer sets for porcine genes, used for quantitative PCR F: AGAGGTCTGCCTGGACCCCA R: GGGAGCCACGGAGAATGGGT F: TTCACCTCTCCGGACAAAAC R: TCTGCCAGTACCTCCTTGCT F: TTCCAGCTGGCCCCTTGAGC R: GAGGGCATTGGCATACCCAC F: AGAAGCGAGGACCAGCTTTC R: AAAGCGGAGGTGTTCAGGAG F: CAGCTTTAGTGCTCCCGAAC R: AGATGACCCGCAATGTTCTC F: CAGAGCTGCTTAGCCTTATCAACC R: CTGGATGCTGGGATTTGTCACCAG F: GTGAGGAGATGTTCAGCATCGTGAAG R: CTTCTGTATCTCAGGATATGTCACA F: TTCGTGCTTCACAGAGAGACCC R: TACTAGGTGGGGGTGGATGG F: GCCCTGAATCCGCAGAATA R: TCCCCACGGTAGGAAACG F: GCGTCTCCTTCGAGCTGTT R: CCATTATGGCGTGTGAAGTC F: GGACTTGAATCATGTTTGTG R: CAGATGTTTCCAAACTCAAC Abbreviations: 1A1, family 1 subfamily A member 1; 1A2, family 1 subfamily A member 2; 3A29, family 3 subfamily A member 29; CAT, catalase; CXCL8, C‐X‐C motif chemokine ligand 8; CYP, cytochrome P450; F, forward; HPRT1, hypoxanthine phosphoribosyl transferase 1; HSPA6, heat shock protein family A (Hsp70) member 6; IL6, interleukin 6; PPIA, peptidylprolyl isomerase A; PTGS2, prostaglandin‐endoperoxide synthase 2; R, reverse; TNF, tumour necrosis factor.

Statistical analyses

Relative gene expression levels of the genes of interest were calculated by the Relative Expression Software Tool (REST) 2009 Software which uses the Pair Wise Fixed Reallocation Randomisation Test©. Statistical analyses were performed by R version 3.6.3 (R Core Team, 2012; R: A language and environment for statistical computing [R Foundation for Statistical Computing, Vienna, Austria; ISBN 3‐900051‐07‐0]). Differences between means were evaluated by one‐way analysis of variance (ANOVA) followed by a post hoc comparison using Tukey's ‘Honest Significant Difference’ method. Differences were considered significant if the p‐value was < 0.05.

RESULTS

Viability of IPEC‐J2 cells

Viability of the cells was monitored after 15 min treatment with 0.07–4.44 mM chlorine dioxide (Figure 1). Control cells were incubated for 15 min in PBS. Treatment with different concentrations of chlorine dioxide for 15 minutes did not damage the cells. Compared to the 15‐min PBS treatment, the chlorine dioxide treatment did not decrease the viability of the IPEC‐J2 cells.
FIGURE 1

Viability of porcine jejunal cells (IPEC‐J2) after 15 min of chlorine dioxide (ClO2) treatment. Data expressed as mean ± SD, n = 8/group. The chlorine dioxide was diluted in phosphate‐buffered saline; the 0 mM concentration is the control treatment, contains only phosphate‐buffered saline

Viability of porcine jejunal cells (IPEC‐J2) after 15 min of chlorine dioxide (ClO2) treatment. Data expressed as mean ± SD, n = 8/group. The chlorine dioxide was diluted in phosphate‐buffered saline; the 0 mM concentration is the control treatment, contains only phosphate‐buffered saline

Effect of chlorine dioxide on relative expression of inflammatory genes

The gene expression of PTGS2 and CAT were not altered by most concentrations of ClO2. The 0.28 mM (18.75 ppm) ClO2 decreased the level of CAT mRNA, and the most concentrated, 2.22 mM (150 ppm) ClO2 downregulated the PTGS2 gene (Figure 2). The expression of CXCL8 gene was reduced by all concentration of ClO2 (Figure 3). TNF mRNA was also alleviated by most ClO2 concentration except the 1.11 mM (75 ppm). IL6 gene expression remained unchanged due to the higher concentrations of ClO2 – 2.22 and 1.11 mM (150 and 75 ppm) – but it was attenuated by all the other concentrations – 0.07–0.56 mM (4.69–37.5 ppm) (Figure 3). The ClO2 treatment had opposite effect on the HSPA6 (Hsp70) gene: the higher concentrations – 2.22 and 1.11 mM (150 and 75 ppm) – increased the gene expression, and the lower concentrations – 0.28, 0.14 and 0.07 mM (18.75, 9.38, and 4.69 ppm, respectively) – decreased the gene expression (Figure 4).
FIGURE 2

The relative gene expressions of CAT and PTGS2/COX2 at various ClO2 concentrations from 0.07 to 2.22 mM in porcine jejunal cell cultures. Results are expressed as mean mRNA expression ratio relative to controls (n = 6/group). Significant differences are shown in comparison to untreated controls (*p < 0.05, **p < 0.01). Data are shown as means ± SD. CAT, catalase; PTGS2, prostaglandin‐endoperoxide synthase 2, also known as cyclooxygenase 2 (COX2)

FIGURE 3

The relative gene expressions of IL6, CXCL8/IL8 and TNF at various ClO2 concentrations from 0.07 to 2.22 mM in porcine jejunal cell cultures. Results are expressed as mean mRNA expression ratio relative to controls (n = 6/group). Significant differences are shown in comparison to untreated controls (*p < 0.05, **p < 0.01). Data are shown as means ± SD. CXCL8, C‐X‐C motif chemokine ligand 8; IL, interleukin; TNF, tumour necrosis factor

FIGURE 4

The relative gene expression of HSPA6 at various ClO2 concentrations from 0.07 to 2.22 mM in porcine jejunal cell cultures. Results are expressed as mean mRNA expression ratio relative to controls (n = 6/group). Significant differences are shown in comparison to untreated controls (* and # p < 0.05, **p < 0.01). Data are shown as means ± SD. HSPA6, heat shock protein family A (Hsp70) member 6

The relative gene expressions of CAT and PTGS2/COX2 at various ClO2 concentrations from 0.07 to 2.22 mM in porcine jejunal cell cultures. Results are expressed as mean mRNA expression ratio relative to controls (n = 6/group). Significant differences are shown in comparison to untreated controls (*p < 0.05, **p < 0.01). Data are shown as means ± SD. CAT, catalase; PTGS2, prostaglandin‐endoperoxide synthase 2, also known as cyclooxygenase 2 (COX2) The relative gene expressions of IL6, CXCL8/IL8 and TNF at various ClO2 concentrations from 0.07 to 2.22 mM in porcine jejunal cell cultures. Results are expressed as mean mRNA expression ratio relative to controls (n = 6/group). Significant differences are shown in comparison to untreated controls (*p < 0.05, **p < 0.01). Data are shown as means ± SD. CXCL8, C‐X‐C motif chemokine ligand 8; IL, interleukin; TNF, tumour necrosis factor The relative gene expression of HSPA6 at various ClO2 concentrations from 0.07 to 2.22 mM in porcine jejunal cell cultures. Results are expressed as mean mRNA expression ratio relative to controls (n = 6/group). Significant differences are shown in comparison to untreated controls (* and # p < 0.05, **p < 0.01). Data are shown as means ± SD. HSPA6, heat shock protein family A (Hsp70) member 6

Effect of chlorine dioxide on relative expression of CYP450 genes

The highest ClO2 concentration – 2.22 mM (150 ppm) – reduced the expression of all the three investigated CYP genes (Figure 5). Furthermore, the gene expression of CYP1A2 was decreased by 0.56 mM (37.5 ppm) ClO2 and the CYP3A29 gene was downregulated by 0.28 mM (18.75 ppm) ClO2. The CYP1A1 mRNA level was enhanced after incubation with the lower concentrations of ClO2: 0.07–0.56 mM (4.69–37.5 ppm).
FIGURE 5

The relative gene expressions of CYP1A1, CYP1A2 and CYP3A29 at various ClO2 concentrations from 0.07 to 2.22 mM in porcine jejunal cell cultures. Results are expressed as mean mRNA expression ratio relative to controls (n = 6/group). Significant differences are shown in comparison to untreated controls (# p < 0.05, ** and ## p < 0.01). Data are shown as means ± SD. CYP, cytochrome P450

The relative gene expressions of CYP1A1, CYP1A2 and CYP3A29 at various ClO2 concentrations from 0.07 to 2.22 mM in porcine jejunal cell cultures. Results are expressed as mean mRNA expression ratio relative to controls (n = 6/group). Significant differences are shown in comparison to untreated controls (# p < 0.05, ** and ## p < 0.01). Data are shown as means ± SD. CYP, cytochrome P450

DISCUSSION

Based on the mechanism of action of chlorine dioxide, we hypothesise that negligible amount would reach the small intestine when administered via feed. However, via drinking water administration a significant portion of the administered amount could pass through the stomach if empty, and the incidence of this is increased by long‐term use or inadequate inclusion ratio. The examined inflammatory and cytochrome genes expressed by the non‐cancerous intestinal epithelial cells were influenced by certain concentrations of chlorine dioxide. The lower concentrations applied decreased the gene expression of HSPA6. Heat shock protein 70 is crucial in cell survival: it can prevent apoptosis, repair damaged proteins (Murphy, 2013) and reduce mitochondrial and cellular ROS production (Li et al., 2018). TNF induces apoptosis (Guicciardi et al., 2000) and also damages the epithelial barrier integrity and stimulate the inflammatory process, inhibition of TNF decreases the production of proinflammatory mediators, reduces the proapoptotic markers and the ileal paracellular permeability (Halpern et al., 2006). Overall, downregulation of TNF can hinder acute or chronic inflammation and tissue necrosis. IL6 is an acute phase immune mediator that cooperates with host defence when infections or injuries occur. However, permanent presence of IL6 leads to chronic inflammation and the development of other immune‐mediated diseases (Tanaka & Kishimoto, 2014). IL8/CXCL8 is a chemokine and a chemoattractant for neutrophils, neutral killer cells, T‐cells, basophils, and eosinophils (Akdis et al., 2011). CXCL8 is responsible for a faster, more effective and targeted inflammatory response at the site of invasion. Inhibition of CXCL8 production is not favourable during the nursing and fattening period. However, it was shown by Razzuoli et al. (2017) that reduction of IL8 was accompanied by a significant decrease in the ability of Salmonella Typhimurium to penetrate IPEC‐J2. Overall, signs of inflammation, such as cytokine production, promote colonisation of Salmonella and progression of Salmonella infection in piglets (Chirullo et al., 2015). According to this, decreased level of inflammatory mediators – interleukins and chemokines – can be beneficial in the prevention of bacterial colonisation and invasion of the gastrointestinal system. Based on our results, lower concentrations of chlorine dioxide are more likely to cause attenuation in the pro‐inflammatory and inflammatory gene expression. Only the highest applied ClO2 concentration inhibited the gene expression of PTGS2, formerly known as cyclooxygenase‐2 (COX2), which might cause dramatic decrease in the intestinal level of prostaglandin E2, and as a consequence it would facilitate intestinal inflammation (Tanaka et al., 2009). The 0.28 mM ClO2 concentration decreased the CAT mRNA level. Inhibition of catalase will directly result in increased production of reactive oxygen species, which consequently leads to higher apoptosis rate (Majumder et al., 2017). Concerning drug metabolism, the 1.11 mM ClO2 concentration exerted no effect on the transcription of the three investigated CYP genes of porcine intestinal cells. The lower ClO2 concentrations (0.07 and 0.14 mM) resulted in increased expression of the CYP1A1 gene; this six‐ to eight‐time increase might result in elevated protein levels which would lead to altered metabolism of the known CYP1A1 substrate drugs such as azole antifungals (Velík et al., 2004) and quinolone antimicrobials (Li et al., 2018). Finding the recommended oral dose that has no effect on the xenobiotic metabolising enzymes would be crucial to avoid drug–feed interactions or any alteration in drug biotransformation. There were very few studies investigating the effect of per os chlorine dioxide in food‐producing animals; one study demonstrated how 0.4 and 0.5 ppm chlorine dioxide oral treatment for 28 days decreased the occurrence of pathogenic microorganisms such as Escherichia coli and Salmonella in the intestinal tract while not negatively impacting the daily weight gain and feed palatability of broiler chickens (Sultan et al., 2015). In another study, the broiler feed was supplemented with ClO2 powder at 500 and 1000 ppm for 35 days; consequently, the number of E. coli was reduced in the ileum and cecum (Ahmed et al., 2015). These results make chlorine dioxide a promising antiseptic agent for oral use. The introduction of the use of chlorine dioxide in pig diets could also be effective in preventing the colonisation and multiplication of pathogens. According to the outcome of our in vitro studies on the non‐cancerous IPEC‐J2 cells, chlorine dioxide modulated the transcription of the investigated inflammatory markers. The effect of chlorine dioxide on inflammatory markers and drug metabolising enzymes should be supported by in vivo studies and the determination of the appropriate oral concentration remains to be elucidated.

AUTHOR CONTRIBUTIONS

Emma Bradley contributed in the investigation and methodology. György Csikó contributed in conceptualisation, investigation, methodology, resources, supervision and reviewing and editing. Kristóf Kály‐Kullai contributed in investigation and writing the manuscript. Zoltán Noszticzius contributed in conceptualisation, validation and reviewing of the manuscript. Orsolya Palócz contributed in data curation, investigation, methodology and project administration and drafted the original manuscript.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

ETHICS

The authors confirm that the ethical policies of the journal, as noted on the journal's author guidelines page, have been adhered to. No ethical approval was required as no live animal experiments were performed during this study.

PEER REVIEW

The peer review history for this article is available at https://publons.com/publon/10.1002/vms3.658.
  34 in total

1.  Effects of enrofloxacin on antioxidant system, microsomal enzymatic activity, and proteomics in porcine liver.

Authors:  Y Li; Y Mou; M Thunders; Y Wu; X Ai; X Zhou; J Qiu
Journal:  J Vet Pharmacol Ther       Date:  2018-04-14       Impact factor: 1.786

2.  Effects of Lactobacillus plantarum 2142 and sodium n-butyrate in lipopolysaccharide-triggered inflammation: comparison of a porcine intestinal epithelial cell line and primary hepatocyte monocultures with a porcine enterohepatic co-culture system.

Authors:  O Farkas; G Mátis; E Pászti-Gere; O Palócz; A Kulcsár; J Petrilla; Gy Csikó; Zs Neogrády; P Gálfi
Journal:  J Anim Sci       Date:  2014-07-01       Impact factor: 3.159

3.  Catalase inhibition an anti cancer property of flavonoids: A kinetic and structural evaluation.

Authors:  Debashis Majumder; Asmita Das; Chabita Saha
Journal:  Int J Biol Macromol       Date:  2017-06-27       Impact factor: 6.953

4.  Expression of mRNAs for interleukin-4, interleukin-6 and their receptors in porcine corpus luteum during the estrous cycle.

Authors:  Ryosuke Sakumoto; Tokushi Komatsu; Etsuko Kasuya; Toshiyuki Saito; Kiyoshi Okuda
Journal:  Domest Anim Endocrinol       Date:  2005-11-22       Impact factor: 2.290

5.  Cathepsin B contributes to TNF-alpha-mediated hepatocyte apoptosis by promoting mitochondrial release of cytochrome c.

Authors:  M E Guicciardi; J Deussing; H Miyoshi; S F Bronk; P A Svingen; C Peters; S H Kaufmann; G J Gores
Journal:  J Clin Invest       Date:  2000-11       Impact factor: 14.808

Review 6.  The HSP70 family and cancer.

Authors:  Maureen E Murphy
Journal:  Carcinogenesis       Date:  2013-04-04       Impact factor: 4.944

7.  Six-month low level chlorine dioxide gas inhalation toxicity study with two-week recovery period in rats.

Authors:  Akinori Akamatsu; Cheolsung Lee; Hirofumi Morino; Takanori Miura; Norio Ogata; Takashi Shibata
Journal:  J Occup Med Toxicol       Date:  2012-02-21       Impact factor: 2.646

8.  Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR.

Authors:  Ann-Britt Nygard; Claus B Jørgensen; Susanna Cirera; Merete Fredholm
Journal:  BMC Mol Biol       Date:  2007-08-15       Impact factor: 2.946

9.  Chlorine dioxide is a size-selective antimicrobial agent.

Authors:  Zoltán Noszticzius; Maria Wittmann; Kristóf Kály-Kullai; Zoltán Beregvári; István Kiss; László Rosivall; János Szegedi
Journal:  PLoS One       Date:  2013-11-05       Impact factor: 3.240

Review 10.  Novel and established intestinal cell line models - An indispensable tool in food science and nutrition.

Authors:  Tomaz Langerholc; Petros A Maragkoudakis; Jan Wollgast; Lidija Gradisnik; Avrelija Cencic
Journal:  Trends Food Sci Technol       Date:  2011-04-09       Impact factor: 12.563

View more
  1 in total

1.  In vitro study of chlorine dioxide on porcine intestinal epithelial cell gene markers.

Authors:  Orsolya Palócz; Zoltán Noszticzius; Kristóf Kály-Kullai; Emma Bradley; György Csikó
Journal:  Vet Med Sci       Date:  2021-10-20
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.