Lung squamous cell carcinoma (LSCC) is a considerable global health burden, with an incidence of over 600,000 cases per year. Treatment options are limited, and patient's 5-year survival rate is less than 5%. The ubiquitin-specific protease 28 (USP28) has been implicated in tumourigenesis through its stabilization of the oncoproteins c-MYC, c-JUN, and Δp63. Here, we show that genetic inactivation of Usp28-induced regression of established murine LSCC lung tumours. We developed a small molecule that inhibits USP28 activity in the low nanomole range. While displaying cross-reactivity against the closest homologue USP25, this inhibitor showed a high degree of selectivity over other deubiquitinases. USP28 inhibitor treatment resulted in a dramatic decrease in c-MYC, c-JUN, and Δp63 proteins levels and consequently induced substantial regression of autochthonous murine LSCC tumours and human LSCC xenografts, thereby phenocopying the effect observed by genetic deletion. Thus, USP28 may represent a promising therapeutic target for the treatment of squamous cell lung carcinoma.
Lung squamous cell carcinoma (LSCC) is a considerable global health burden, with an incidence of over 600,000 cases per year. Treatment options are limited, and patient's 5-year survival rate is less than 5%. The ubiquitin-specific protease 28 (USP28) has been implicated in tumourigenesis through its stabilization of the oncoproteins c-MYC, c-JUN, and Δp63. Here, we show that genetic inactivation of Usp28-induced regression of established murine LSCC lung tumours. We developed a small molecule that inhibits USP28 activity in the low nanomole range. While displaying cross-reactivity against the closest homologue USP25, this inhibitor showed a high degree of selectivity over other deubiquitinases. USP28 inhibitor treatment resulted in a dramatic decrease in c-MYC, c-JUN, and Δp63 proteins levels and consequently induced substantial regression of autochthonous murine LSCC tumours and human LSCC xenografts, thereby phenocopying the effect observed by genetic deletion. Thus, USP28 may represent a promising therapeutic target for the treatment of squamous cell lung carcinoma.
Lung cancer is the leading cause of cancer death worldwide. Based on histological criteria, lung cancer can be subdivided into non-small cell lung cancer (NSCLC) and the rarer small cell lung cancer. The most common NSCLCs are lung adenocarcinoma (LADC) and lung squamous cell carcinoma (LSCC), with large cell carcinoma being less commonly observed. Progress has been made in the targeted treatment of LADC, largely due to the development of small-molecule inhibitors against EGFR, ALK, and ROS1 (Cardarella and Johnson, 2013). However, no targeted treatment options exist for LSCC patients (Hirsch et al., 2017; Novello et al., 2014). Consequently, despite having limited efficacy on LSCC patient survival, platinum-based chemotherapy remains the cornerstone of current LSCC treatment (Fennell et al., 2016; Isaka et al., 2017; Scagliotti et al., 2008). Therefore, there is an urgent need to identify novel druggable targets for LSCC treatment and to develop novel therapeutics.The Fbxw7 protein product F-box/WD repeat-containing protein 7 (FBW7) is the substrate recognition component of an SCF-type ubiquitin ligase, which targets several well-known oncoproteins, including c-MYC, NOTCH, and c-JUN, for degradation (Davis et al., 2014). These oncoproteins accumulate in the absence of FBW7 function, and genetic analyses of human LSCC samples revealed common genomic alterations in Fbxw7 (Cancer Genome Atlas Research Network, 2012; Kan et al., 2010). In addition, FBW7 protein is undetectable by immunohistochemistry (IHC) in 69% of LSCC patient tumour samples (Ruiz et al., 2019). Genetically engineered mice (GEM) harbouring loss of Fbxw7 concomitant with Kras activation (KF mice) develop LSCC with 100% penetrance and short latency, as well as LADC (Ruiz et al., 2019). Thus, FBW7 is an important tumour suppressor in both human and murine lung cancer.The deubiquitinase USP28 opposes FBW7-mediated ubiquitination of the oncoproteins c-MYC and c-JUN, thereby stabilizing these proteins (Popov et al., 2007). In a murine model of colorectal cancer, deleting Usp28 reduced size of established tumours and increased lifespan (Diefenbacher et al., 2014). Therefore, targeting USP28 in order to destabilize its substrates represents an attractive strategy to inhibit the function of c-MYC and other oncogenic transcription factors that are not amenable to conventional inhibition by small molecules.Here, we describe the characterization of a novel USP28 inhibitory compound (USP28i) and the genetic as well as chemical validation of USP28 as a promising therapeutic target for LSCC tumours. Using an Frt-Flp and Cre-LoxP dual recombinase system (Schönhuber et al., 2014), we show that Usp28 inactivation in established LSCC results in dramatic tumour regression. Importantly, USP28i treatment recapitulates LSCC regression in both mouse models and human LSCC xenografts. Absence or inhibition of USP28 resulted in a dramatic decrease in the protein levels of c-MYC, c-JUN, and Δp63, providing a potential mechanism of action for USP28i. Therefore, USP28 inhibition should be a strong candidate for clinical evaluation, particularly given the paucity of currently available therapy options for LSCC patients.
Results
USP28 is required to maintain protein levels of c-MYC, c-JUN, and Δp63 in LSCC
To gain insights into the molecular differences between LADC and LSCC, we investigated the expression of MYC in these common NSCLCs subtypes. MYC was transcriptionally upregulated in human LSCC compared to healthy lung tissue or LADC tumours (Figure 1A). Quantitative polymerase chain reaction (qPCR) analysis on an independent set of primary human lung biopsy samples confirmed that MYC is highly expressed in LSCC tumours compared with normal lung tissue (Figure 1B). Moreover, IHC staining on primary lung tumours confirmed a significant abundance of c-MYC protein in LSCC samples (Figure 1C and D). Also, Δp63 and c-JUN, critical factors in squamous cell identity and tumour maintenance, respectively, showed higher protein levels in LSCC compared to LADC tumours (Figure 1C and D). Individual downregulation of c-MYC, c-JUN, and Δp63 by small interfering RNA (siRNA) resulted in a significant reduction of cell growth in four independent human LSCC cell lines (Figure 1E,
Figure 1—figure supplement 1A-C).
Figure 1.
MYC, JUN, and Δp63 are highly expressed in lung squamous cell carcinoma (LSCC) tumours.
(A) Expression of MYC in human lung adenocarcinoma (LADC, n = 483), lung squamous cell carcinoma (LSCC, n = 486), and normal non‐transformed tissue (normal LSCC = 338, normal LADC = 347). In box plots, the centre line reflects the median. Data from TCGA and GTEx were analysed using GEPIA software. (B) Relative mRNA expression of MYC in normal lung tissue (n = 5) and LSCC (n = 17) patient samples from the Cordoba Biobank measured by RT-PCR. The p value was calculated using the Student’s two-tailed t test. Plots indicate mean. (C) Representative LADC and LSCC tumours stained with c-MYC, c-JUN, and Δp63 antibodies. Scale bars, 30 μm. (D) Quantification of c-MYC+ (LADC n = 33, LSCC n = 34), c-JUN+ (LADC n = 33, LSCC n = 33), and Δp63+ cells (LADC n = 41, LSCC n = 41) in LADC and LSCC tumours. Plots indicate mean. Student’s two-tailed t test was used to calculate p values. (E) Graph showing the difference in cell proliferation between control and MYC-depleted KF LSCC cells (n = 3). Graph indicates mean ± SEM. Student’s two-tailed t test was used to calculate p values. (F) Genetic alterations in ubiquitin-specific protease 28 (USP28) and FBXW7 genes in human LSCC. Each column represents a tumour sample (n = 178). Data from TCGA were analysed using cBioportal software. (G) Relative mRNA expression of USP28 in normal lung tissue (n = 5) and LSCC (n = 17) patient samples from the Cordoba Biobank measured by RT-PCR. The p value was calculated using the Student’s two-tailed t test. Plots indicate mean. See also Figure 1—figure supplement 1B. (H) shRNA-mediated knockdown of Usp28 decreases c-MYC, c-JUN, and Δp63 protein levels in primary KF LSCC cells. (I) Graph showing the difference in cell proliferation between control and Usp28-depleted KF LSCC cells (n = 3). Graph indicates mean ± SEM. One-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons test was used to calculate p values. Source data for B, D, E, G, and I.
(A) Graphs showing the difference in cell proliferation between control and siMYC-transfected human lung squamous cell carcinoma (LSCC) cell lines (NCI-H226, NCI-H520, CALU-1, and LUDLU-1). Graphs indicate mean ± SEM. p Values calculated using one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test. (B) Graphs showing the difference in cell proliferation between control and siJUN-transfected human LSCC cell lines (NCI-H226, NCI-H520, CALU-1, and LUDLU-1). Graphs indicate mean ± SEM. p Values calculated using one-way ANOVA with Tukey’s multiple comparisons test. (C) Graphs showing the difference in cell proliferation between control and siΔp63-transfected human LSCC cell lines (NCI-H226, NCI-H520, CALU-1, and LUDLU-1). Graphs indicate mean ± SEM. p Values calculated using one-way ANOVA with Tukey’s multiple comparisons test. Source data for A, B, and C.
(A) Dot plot showing association between the log2 mRNA expression (Y-axis) and copy-number alterations (X-axis) for ubiquitin-specific protease 28 (USP28) gene. Data from TCGA were analysed using cBioportal software. One-way analysis of variance (ANOVA) with Bonferroni’s multiple comparisons test was used to calculate p values (n = 2 deep deletion, n = 57 shallow deletion, n = 81 diploid, n = 38 gain). (B) Representative human lung squamous cell carcinoma (LSCC) tumours stained with USP28 and FBW7 antibodies. Scale bars, 100 µm (left panel). Quantification of USP28 and FBW7 protein staining in LSCC tumours (n = 17) (right panel). Source data for A.
Figure 1—figure supplement 1
c-MYC, c-JUN and dp63 knockdown affects LSCC cell line growth.
(A) Graphs showing the difference in cell proliferation between control and siMYC-transfected human lung squamous cell carcinoma (LSCC) cell lines (NCI-H226, NCI-H520, CALU-1, and LUDLU-1). Graphs indicate mean ± SEM. p Values calculated using one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test. (B) Graphs showing the difference in cell proliferation between control and siJUN-transfected human LSCC cell lines (NCI-H226, NCI-H520, CALU-1, and LUDLU-1). Graphs indicate mean ± SEM. p Values calculated using one-way ANOVA with Tukey’s multiple comparisons test. (C) Graphs showing the difference in cell proliferation between control and siΔp63-transfected human LSCC cell lines (NCI-H226, NCI-H520, CALU-1, and LUDLU-1). Graphs indicate mean ± SEM. p Values calculated using one-way ANOVA with Tukey’s multiple comparisons test. Source data for A, B, and C.
MYC, JUN, and Δp63 are highly expressed in lung squamous cell carcinoma (LSCC) tumours.
(A) Expression of MYC in human lung adenocarcinoma (LADC, n = 483), lung squamous cell carcinoma (LSCC, n = 486), and normal non‐transformed tissue (normal LSCC = 338, normal LADC = 347). In box plots, the centre line reflects the median. Data from TCGA and GTEx were analysed using GEPIA software. (B) Relative mRNA expression of MYC in normal lung tissue (n = 5) and LSCC (n = 17) patient samples from the Cordoba Biobank measured by RT-PCR. The p value was calculated using the Student’s two-tailed t test. Plots indicate mean. (C) Representative LADC and LSCC tumours stained with c-MYC, c-JUN, and Δp63 antibodies. Scale bars, 30 μm. (D) Quantification of c-MYC+ (LADC n = 33, LSCC n = 34), c-JUN+ (LADC n = 33, LSCC n = 33), and Δp63+ cells (LADC n = 41, LSCC n = 41) in LADC and LSCC tumours. Plots indicate mean. Student’s two-tailed t test was used to calculate p values. (E) Graph showing the difference in cell proliferation between control and MYC-depleted KF LSCC cells (n = 3). Graph indicates mean ± SEM. Student’s two-tailed t test was used to calculate p values. (F) Genetic alterations in ubiquitin-specific protease 28 (USP28) and FBXW7 genes in human LSCC. Each column represents a tumour sample (n = 178). Data from TCGA were analysed using cBioportal software. (G) Relative mRNA expression of USP28 in normal lung tissue (n = 5) and LSCC (n = 17) patient samples from the Cordoba Biobank measured by RT-PCR. The p value was calculated using the Student’s two-tailed t test. Plots indicate mean. See also Figure 1—figure supplement 1B. (H) shRNA-mediated knockdown of Usp28 decreases c-MYC, c-JUN, and Δp63 protein levels in primary KF LSCC cells. (I) Graph showing the difference in cell proliferation between control and Usp28-depleted KF LSCC cells (n = 3). Graph indicates mean ± SEM. One-way analysis of variance (ANOVA) with Dunnett’s multiple comparisons test was used to calculate p values. Source data for B, D, E, G, and I.
c-MYC, c-JUN and dp63 knockdown affects LSCC cell line growth.
(A) Graphs showing the difference in cell proliferation between control and siMYC-transfected human lung squamous cell carcinoma (LSCC) cell lines (NCI-H226, NCI-H520, CALU-1, and LUDLU-1). Graphs indicate mean ± SEM. p Values calculated using one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test. (B) Graphs showing the difference in cell proliferation between control and siJUN-transfected human LSCC cell lines (NCI-H226, NCI-H520, CALU-1, and LUDLU-1). Graphs indicate mean ± SEM. p Values calculated using one-way ANOVA with Tukey’s multiple comparisons test. (C) Graphs showing the difference in cell proliferation between control and siΔp63-transfected human LSCC cell lines (NCI-H226, NCI-H520, CALU-1, and LUDLU-1). Graphs indicate mean ± SEM. p Values calculated using one-way ANOVA with Tukey’s multiple comparisons test. Source data for A, B, and C.
USP28 expression in LSCC tumours.
(A) Dot plot showing association between the log2 mRNA expression (Y-axis) and copy-number alterations (X-axis) for ubiquitin-specific protease 28 (USP28) gene. Data from TCGA were analysed using cBioportal software. One-way analysis of variance (ANOVA) with Bonferroni’s multiple comparisons test was used to calculate p values (n = 2 deep deletion, n = 57 shallow deletion, n = 81 diploid, n = 38 gain). (B) Representative human lung squamous cell carcinoma (LSCC) tumours stained with USP28 and FBW7 antibodies. Scale bars, 100 µm (left panel). Quantification of USP28 and FBW7 protein staining in LSCC tumours (n = 17) (right panel). Source data for A.As c-MYC, c-JUN, and Δp63 protein levels are controlled by the deubiquitinase USP28 (Popov et al., 2007; Prieto-Garcia et al., 2020), we analysed its expression in publicly available datasets (The Cancer Genome Atlas). We observed that 25% of human LSCC cases show gain-of-function alterations in USP28 (Figure 1F). In addition, a positive correlation between USP28 copy-number and mRNA expression was found in the same datasets (Figure 1—figure supplement 2A). Interestingly, qPCR and IHC analysis on human LSCC samples revealed that low USP28 mRNA levels correlated with low USP28 protein levels and likewise, high/moderate mRNA levels also correlated with high USP28 protein levels (Figure 1G, Figure 1—figure supplement 2B). Since USP28 is involved in Δp63, c-JUN, and c-MYC stabilization and higher expression of USP28 is associated with a significantly shorter survival time (Prieto-Garcia et al., 2020), we targeted its expression. Usp28 downregulation by shRNA resulted in a significant reduction in c-MYC, c-JUN, and Δp63 protein levels in LSCC primary tumour cells and reduced LSCC cell growth (Figure 1H and I). Thus, targeting USP28 in order to destabilize its substrates represents a rational strategy to target tumour cells that rely on oncogenic transcription factors that are currently not druggable by small molecules.
Figure 1—figure supplement 2.
USP28 expression in LSCC tumours.
(A) Dot plot showing association between the log2 mRNA expression (Y-axis) and copy-number alterations (X-axis) for ubiquitin-specific protease 28 (USP28) gene. Data from TCGA were analysed using cBioportal software. One-way analysis of variance (ANOVA) with Bonferroni’s multiple comparisons test was used to calculate p values (n = 2 deep deletion, n = 57 shallow deletion, n = 81 diploid, n = 38 gain). (B) Representative human lung squamous cell carcinoma (LSCC) tumours stained with USP28 and FBW7 antibodies. Scale bars, 100 µm (left panel). Quantification of USP28 and FBW7 protein staining in LSCC tumours (n = 17) (right panel). Source data for A.
Generation of a pre-clinical dual recombinase lung cancer mouse model
Recently, Usp28 was shown to be required for the initiation of lung tumours in the Rosa26-Cas9 sgRNA Kras model (Prieto-Garcia et al., 2020). However, a meaningful pre-clinical model requires targeting the therapeutic candidate gene in existing growing lung tumours. Thus, to assess the function of Usp28 in established tumours, we developed a new GEM model to temporally and spatially separate tumour development from target deletion by using two independent recombinases: FLP and CreERT. In this model, LSCC and LADC formation is initiated by Kras activation and Fbxw7 deletion using FLP recombinase, and the Cre-loxP system can then be used for inactivation of Usp28 in established tumours. To allow conditional FRT/FLP-mediated inactivation of Fbxw7 function, we inserted two FRT sites flanking exon 5 of the endogenous Fbxw7 gene in mice to generate a Fbxw7 allele that can be deleted by FLP recombinase (Figure 2—figure supplement 1A and B). Expression of FLP recombinase resulted in the deletion of Fbxw7 exon 5, which could be detected by PCR (Figure 2—figure supplement 1B). The resulting strain, Fbxw7, was crossed to FRT-STOP-FRT (FSF)-Kras mice to generate Kras (KF-Flp model).
Figure 2—figure supplement 1.
Gene 1 targeting strategy to generate a Fbxw7 FRT/FRT allele that can be deleted by Flp recombinase.
(A) Gene targeting strategy to generate conditional Fbxw7 animals. Two FRT sites were inserted into the intron 4 and 5 of Fbxw7 through the CRISPR-Cas9 technology. (B) Schematic representation of the conditional allele (left panel). In vitro recombination assay demonstrated efficient ablation of the exon 5 upon Flp recombinase adenovirus infection (right panel). (C) KFCU () mice infected with adeno-CMV-Flp virus develop lung adenocarcinoma (LADC) (SFTPC+ and TTF1+) and lung squamous cell carcinoma (LSCC) (CK5+ and Δp63+) tumours. (D) In situ hybridization of ubiquitin-specific protease 28 (Usp28) and Pppib mRNA expression in vehicle- and tamoxifen-treated KFCU mice. Scale bars, 50 µm. (E) Monitoring tolerability in mice treated with vehicle, tamoxifen (Tam), or tamoxifen+ FT206. Body weights of animals during the course of treatment. Two-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test was used to calculate p values (n = 8 vehicle, n = 7 tamoxifen, n = 7 tamoxifen+ FT206). (F) KFCU tumours stained with c-MYC, c-JUN, and Δp63 antibodies. KFCU mice treated with vehicle (left panel) or tamoxifen (right panel). Inserts showing c-MYC+, c-JUN+, and Δp63+ LSCC tumours in mice receiving vehicle but partial positive or negative LSCC lesions in mice receiving tamoxifen. Scale bars, 50 μm. Source data for E.
USP28 is an effective therapeutic target for LSCC, but not KRasG12D; Trp53 mutant LADC tumours
The KF-Flp strain described above was crossed with Rosa26 mice to generate the KFCU model (Figure 2A). KFCU tumour development was monitored by computed tomography (CT) scans. At 10–11 weeks post-infection with FLP recombinase-expressing recombinant adenoviruses, animals displayed lesions in their lungs. At this time point, we confirmed by histology that KFCU mice develop both LADC and LSCC tumours (Figure 2—figure supplement 1C). As expected (Ruiz et al., 2019), KFCU LADC lesions occurred in alveolar tissue and were positive for SFTPC and TTF1. KFCU LSCC tumours occurred mainly in bronchi (rarely manifesting in the alveolar compartment) and expressed CK5 and Δp63. Next, animals displaying lung tumours were exposed to tamoxifen to activate the CreERT protein and delete the conditional Usp28 floxed alleles (Figure 2A, Figure 2—figure supplement 1D). Mice transiently lost body weight during the initial tamoxifen treatment but recovered a few days later (Figure 2—figure supplement 1E). Although the loss of USP28 expression decreased LADC tumour size, it did not reduce the number of LADC tumours (Figure 2B–D). In contrast, histological examination of KFCU mice revealed a clear reduction in the numbers of LSCC lesions in Usp28-deleted lungs (Figure 2F, Figure 2—figure supplement 1D). As well as a significant reduction in tumour number, the few CK5-positive LSCC lesions that remained were substantially smaller than control tumours (Figure 2G). Measurement of the size of 429 individual KFCU LSCC tumours (326 vehicle-treated and 103 tamoxifen-treated) showed an average size of 11.4 × 104 μm2 in the vehicle arm versus 4.6 × 104 μm2 in the tamoxifen arm (Figure 2G). Thus, Usp28 inactivation significantly reduces both the number and the size of LSCC tumours.
Figure 2.
Ubiquitin-specific protease 28 (USP28) is an effective therapeutic target for lung squamous cell carcinoma (LSCC) tumours.
(A) Schematic representation of the KFCU () model and experimental approach used to deplete conditional Usp28 alleles in established lung tumours. (B) Lung histology of animals treated as in A, showing both LSCC (CK5+) and lung adenocarcinoma (LADC) (SFTPC+) tumours in mice receiving vehicle but few LSCC lesions in mice receiving tamoxifen. Scale bars, 1000 μm. (C) Quantification of LADC tumours in vehicle-, tamoxifen-, and tamoxifen+ FT206-treated KFCU mice. Plots indicate mean. One-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test was used to calculate p values (n = 8 vehicle, n = 7 tamoxifen, n = 7 tamoxifen+ FT206). (D) Quantification of LADC tumour size in vehicle-, tamoxifen-, and tamoxifen+ FT206-treated KFCU mice. Plots indicate mean. One-way ANOVA with Tukey’s multiple comparisons test was used to calculate p values (n = 466 vehicle, n = 434 tamoxifen, n = 503 tamoxifen+ FT206). (E) Immunoblot analysis of LADC tumours probed for USP28, c-MYC, c-JUN, SFTPC, cleaved caspase-3 (CC3). VINCULIN is shown as loading control. (F) Quantification of LSCC tumours in vehicle-, tamoxifen-, and tamoxifen+ FT206-treated KFCU mice. Plots indicate mean. One-way ANOVA with Tukey’s multiple comparisons test was used to calculate p values (n = 8 vehicle, n = 7 tamoxifen, n = 7 tamoxifen+ FT206). (G) Quantification of LSCC tumour size in vehicle-, tamoxifen-, and tamoxifen+ FT206-treated KFCU mice. Plots indicate mean. One-way ANOVA with Tukey’s multiple comparisons test was used to calculate p values (n = 326 vehicle, n = 103 tamoxifen, n = 79 tamoxifen+ FT206). (H) Usp28 deletion induces apoptotic cell death (CC3) and decreases c-MYC, c-JUN, and Δp63 protein levels in LSCC lesions. Source data for C, D, F, and G.
(A) Gene targeting strategy to generate conditional Fbxw7 animals. Two FRT sites were inserted into the intron 4 and 5 of Fbxw7 through the CRISPR-Cas9 technology. (B) Schematic representation of the conditional allele (left panel). In vitro recombination assay demonstrated efficient ablation of the exon 5 upon Flp recombinase adenovirus infection (right panel). (C) KFCU () mice infected with adeno-CMV-Flp virus develop lung adenocarcinoma (LADC) (SFTPC+ and TTF1+) and lung squamous cell carcinoma (LSCC) (CK5+ and Δp63+) tumours. (D) In situ hybridization of ubiquitin-specific protease 28 (Usp28) and Pppib mRNA expression in vehicle- and tamoxifen-treated KFCU mice. Scale bars, 50 µm. (E) Monitoring tolerability in mice treated with vehicle, tamoxifen (Tam), or tamoxifen+ FT206. Body weights of animals during the course of treatment. Two-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test was used to calculate p values (n = 8 vehicle, n = 7 tamoxifen, n = 7 tamoxifen+ FT206). (F) KFCU tumours stained with c-MYC, c-JUN, and Δp63 antibodies. KFCU mice treated with vehicle (left panel) or tamoxifen (right panel). Inserts showing c-MYC+, c-JUN+, and Δp63+ LSCC tumours in mice receiving vehicle but partial positive or negative LSCC lesions in mice receiving tamoxifen. Scale bars, 50 μm. Source data for E.
Ubiquitin-specific protease 28 (USP28) is an effective therapeutic target for lung squamous cell carcinoma (LSCC) tumours.
(A) Schematic representation of the KFCU () model and experimental approach used to deplete conditional Usp28 alleles in established lung tumours. (B) Lung histology of animals treated as in A, showing both LSCC (CK5+) and lung adenocarcinoma (LADC) (SFTPC+) tumours in mice receiving vehicle but few LSCC lesions in mice receiving tamoxifen. Scale bars, 1000 μm. (C) Quantification of LADC tumours in vehicle-, tamoxifen-, and tamoxifen+ FT206-treated KFCU mice. Plots indicate mean. One-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test was used to calculate p values (n = 8 vehicle, n = 7 tamoxifen, n = 7 tamoxifen+ FT206). (D) Quantification of LADC tumour size in vehicle-, tamoxifen-, and tamoxifen+ FT206-treated KFCU mice. Plots indicate mean. One-way ANOVA with Tukey’s multiple comparisons test was used to calculate p values (n = 466 vehicle, n = 434 tamoxifen, n = 503 tamoxifen+ FT206). (E) Immunoblot analysis of LADC tumours probed for USP28, c-MYC, c-JUN, SFTPC, cleaved caspase-3 (CC3). VINCULIN is shown as loading control. (F) Quantification of LSCC tumours in vehicle-, tamoxifen-, and tamoxifen+ FT206-treated KFCU mice. Plots indicate mean. One-way ANOVA with Tukey’s multiple comparisons test was used to calculate p values (n = 8 vehicle, n = 7 tamoxifen, n = 7 tamoxifen+ FT206). (G) Quantification of LSCC tumour size in vehicle-, tamoxifen-, and tamoxifen+ FT206-treated KFCU mice. Plots indicate mean. One-way ANOVA with Tukey’s multiple comparisons test was used to calculate p values (n = 326 vehicle, n = 103 tamoxifen, n = 79 tamoxifen+ FT206). (H) Usp28 deletion induces apoptotic cell death (CC3) and decreases c-MYC, c-JUN, and Δp63 protein levels in LSCC lesions. Source data for C, D, F, and G.
Gene 1 targeting strategy to generate a Fbxw7 FRT/FRT allele that can be deleted by Flp recombinase.
(A) Gene targeting strategy to generate conditional Fbxw7 animals. Two FRT sites were inserted into the intron 4 and 5 of Fbxw7 through the CRISPR-Cas9 technology. (B) Schematic representation of the conditional allele (left panel). In vitro recombination assay demonstrated efficient ablation of the exon 5 upon Flp recombinase adenovirus infection (right panel). (C) KFCU () mice infected with adeno-CMV-Flp virus develop lung adenocarcinoma (LADC) (SFTPC+ and TTF1+) and lung squamous cell carcinoma (LSCC) (CK5+ and Δp63+) tumours. (D) In situ hybridization of ubiquitin-specific protease 28 (Usp28) and Pppib mRNA expression in vehicle- and tamoxifen-treated KFCU mice. Scale bars, 50 µm. (E) Monitoring tolerability in mice treated with vehicle, tamoxifen (Tam), or tamoxifen+ FT206. Body weights of animals during the course of treatment. Two-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test was used to calculate p values (n = 8 vehicle, n = 7 tamoxifen, n = 7 tamoxifen+ FT206). (F) KFCU tumours stained with c-MYC, c-JUN, and Δp63 antibodies. KFCU mice treated with vehicle (left panel) or tamoxifen (right panel). Inserts showing c-MYC+, c-JUN+, and Δp63+ LSCC tumours in mice receiving vehicle but partial positive or negative LSCC lesions in mice receiving tamoxifen. Scale bars, 50 μm. Source data for E.To get insights into LSCC tumour regression, we focused on USP28 substrates. Immunoblotting analysis revealed that Usp28 deletion resulted in apoptotic cell death (cleaved caspase-3; CC3). Δp63 protein levels were reduced, but c-JUN and c-MYC protein became undetectable (Figure 2H, Figure 2—figure supplement 1F). Usp28 deletion also decreased c-JUN and c-MYC levels in KFCU LADC lesions, although the reduction in c-MYC protein levels was significantly less pronounced than observed in LSCC (Figure 2E). Strikingly, elimination of Usp28 has little effect, if any, on apoptotic cell death, as determined by its inability to induce CC3 in LADC lesions. Thus, these data suggest that USP28 and its substrates are required for the maintenance of LSCC tumours.To further investigate the role of USP28 in LADC, we studied the consequences of Usp28 deletion in a second LADC genetic model. We used Flp-inducible oncogenic Kras activation combined with Trp53 deletion (Kras and Trp53 or KP-Flp model) (Schönhuber et al., 2014). The KP-Flp mice were crossed to a conditional Usp28 strain together with an inducible CreERT recombinase knocked in at the Rosa26 locus and an mT/mG reporter allele (KPCU mice; Figure 3A). After intratracheal adeno-CMV-Flp virus instillation, Usp28 was deleted in KPCU animals displaying lung tumours by CT (Figure 3A). Loss of USP28 expression in this second LADC model also did not result in a reduction of LADC tumour number and size (Figure 3C and D). Successful CreERT recombination was verified using lineage tracing (GFP staining) and deletion of Usp28 alleles was further confirmed by BaseScope assays (Figure 3B and E). Therefore, also these data argue against an important role for USP28 in LADC tumours.
Figure 3.
Ubiquitin-specific protease 28 (USP28) is not a therapeutic target for advanced KRasG12D; Trp53 mutant tumours.
(A) Schematic representation of the KPCU () model and experimental approach used. At 10 weeks post-infection, KPCU mice were treated with vehicle or tamoxifen. (B) Representative images of H&E (left) and GFP (right) stains from mice of the indicated treatments. Scale bar, 1000 µm. (C) Quantification of mouse lung adenocarcinoma (LADC) tumours in the KPCU model. Plots indicate mean. Student’s two-tailed t test was used to calculate p values (n = 10 vehicle, n = 10 tamoxifen). (D) Quantification of LADC tumour size in vehicle- and tamoxifen-treated KPCU mice. Plots indicate mean. Student’s two-tailed t test was used to calculate p values (n = 110 vehicle, n = 130 tamoxifen). (E) Representative images illustrating histological analysis of lung lesions in KPCU mice, treated with vehicle or tamoxifen. H&E, SFTPC, TTF1, GFP immunohistochemistry staining and in situ hybridization of USP28 and PPIB mRNA expression. Scale bars, 50 µm. Source data for C and D.
Ubiquitin-specific protease 28 (USP28) is not a therapeutic target for advanced KRasG12D; Trp53 mutant tumours.
(A) Schematic representation of the KPCU () model and experimental approach used. At 10 weeks post-infection, KPCU mice were treated with vehicle or tamoxifen. (B) Representative images of H&E (left) and GFP (right) stains from mice of the indicated treatments. Scale bar, 1000 µm. (C) Quantification of mouse lung adenocarcinoma (LADC) tumours in the KPCU model. Plots indicate mean. Student’s two-tailed t test was used to calculate p values (n = 10 vehicle, n = 10 tamoxifen). (D) Quantification of LADC tumour size in vehicle- and tamoxifen-treated KPCU mice. Plots indicate mean. Student’s two-tailed t test was used to calculate p values (n = 110 vehicle, n = 130 tamoxifen). (E) Representative images illustrating histological analysis of lung lesions in KPCU mice, treated with vehicle or tamoxifen. H&E, SFTPC, TTF1, GFP immunohistochemistry staining and in situ hybridization of USP28 and PPIB mRNA expression. Scale bars, 50 µm. Source data for C and D.
Generation of a new USP28 inhibitor: selectivity and cellular target engagement
The finding that USP28 plays a key role in LSCC tumour maintenance prompted us to identify small-molecule inhibitors against this deubiquitinase. A small-molecule discovery campaign based on the ubiquitin-rhodamine cleavable assay (Turnbull et al., 2017) yielded a panel of compounds sharing a thienopyridine carboxamide chemical scaffold with inhibitory selectivity for USP28 and USP25 (Guerin et al., 2017; Guerin et al., 2020; Zablocki et al., 2019). The compound FT206 (Figure 4A) represents a different chemical class from the benzylic amino ethanol-based inhibitors described previously (Wrigley et al., 2017). Quantitative structure-activity relationship was used to develop compound derivative FT206 that was most optimal in terms of drug metabolism and pharmacokinetic properties while preserving potency and selectivity towards USP28/25 (Zablocki et al., 2019). To confirm FT206 cellular target engagement, we used a Ub activity-based probe (ABP) assay (Altun et al., 2011; Clancy et al., 2021; Panyain et al., 2020; Turnbull et al., 2017). ABPs can assess DUB enzyme activity in a cellular context. DUB inhibition leads to displacement of the ABP, resulting in a molecular weight shift measurable by SDS-PAGE and immunoblotting against USP28/25. Using this approach, we found that the compound FT206 interferes with USP28/25 probe labelling (USP-ABP versus USP) in LSCC H520 cell extracts (EC50 ~300–1000 nM, Figure 4B) and intact cells (EC50 ~1–3 μM, Figure 4C). In contrast to FT206, AZ1, a different USP28 inhibitor (Wrigley et al., 2017), based on a benzylic amino ethanol scaffold, appeared to exert lower potency towards USP28 (EC50 >30 μM) and selectivity for USP25 (EC50 ~10–30 μM) (Figure 4—figure supplement 1A). To address compound selectivity more widely, we combined the ABP assay with quantitative mass spectrometry (activity-based probe profiling [ABPP]) to allow the analysis of the cellular active DUBome (Benns et al., 2021; Jones et al., 2021; Pinto-Fernández et al., 2019). When performing such assay in human LSCC cells, we were able to profile 28 endogenous DUBs, revealing a remarkable USP28/25 selectivity for FT206 in a dose-dependent manner (Figure 4D).
Figure 4.
Ubiquitin-specific protease 28 (USP28) inhibitor selectivity and cellular target engagement.
(A) Structure of small-molecular inhibitor FT3951206/CRT0511973 (FT206). (B) Cellular DUB profiling in NCI-H520 lung squamous cell carcinoma (LSCC) cell extracts incubated with the indicated concentrations of FT206 prior to labelling with HA-UbPA, SDS-PAGE, and analysis by Western blotting. Inhibitor potency was reflected by competition with USP28/25-ABP (activity-based probe) adduct formation. (C) Cellular DUB profiling in NCI-H520 LSCC cells incubated with the indicated concentrations of FT206, lysed extracts labelled with HA-UbPA, and analysed as in B. (D) Activity-based probe profiling (ABPP) demonstrating the cellular DUB selectivity profile of cpd FT206 by quantitative mass spectrometry analysis at different inhibitor concentrations. Graph indicates mean ± SEM. (E) USP28 inhibition using FT206 (50 and 100 nM) reduces c-MYC, c-JUN, and Δp63 protein levels in primary KF LSCC cells. (F) USP28 inhibition using FT206 decreases cell proliferation in KF LSCC cells (n = 4). Graph indicates mean ± SEM. Source data for F.
(A) Comparison of ubiquitin-specific protease 28/25 (USP28/25) inhibitor potency by activity-based profiling. Human lung squamous cell carcinoma (LSCC) H520 crude cell extracts were incubated either with AZ1 or FT206 inhibitors at indicated concentrations, followed by HA-UbPA activity-based probe (ABP) labelling. Samples were analysed by SDS-PAGE and immunoblotted using USP28, USP25, HA, and GAPDH antibodies. Inhibitor potency was reflected by competition with USP28/25-ABP adduct formation. (B) TUBE pulldown of endogenous ubiquitylated c-MYC, c-JUN, and USP28 in LSCC cells upon co-treatment with MG132 and FT206. (C) Immunoblot of endogenous USP28, c-JUN, c-MYC, and Δp63 in LSCC cells upon co-treatment with MG132 and FT206. VINCULIN served as loading control. (D) Graphs showing the difference in cell proliferation between control, FT206-treated, and USP28-depleted LSCC cells. Graph indicates mean ± SEM. One-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test was used to calculate p values. VINCULIN is shown as loading control. Source data for D.
Figure 4—figure supplement 1.
USP28 inhibitor targets USP28/25 and ubiquitylation levels of c-MYC, c-JUN and USP28.
(A) Comparison of ubiquitin-specific protease 28/25 (USP28/25) inhibitor potency by activity-based profiling. Human lung squamous cell carcinoma (LSCC) H520 crude cell extracts were incubated either with AZ1 or FT206 inhibitors at indicated concentrations, followed by HA-UbPA activity-based probe (ABP) labelling. Samples were analysed by SDS-PAGE and immunoblotted using USP28, USP25, HA, and GAPDH antibodies. Inhibitor potency was reflected by competition with USP28/25-ABP adduct formation. (B) TUBE pulldown of endogenous ubiquitylated c-MYC, c-JUN, and USP28 in LSCC cells upon co-treatment with MG132 and FT206. (C) Immunoblot of endogenous USP28, c-JUN, c-MYC, and Δp63 in LSCC cells upon co-treatment with MG132 and FT206. VINCULIN served as loading control. (D) Graphs showing the difference in cell proliferation between control, FT206-treated, and USP28-depleted LSCC cells. Graph indicates mean ± SEM. One-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test was used to calculate p values. VINCULIN is shown as loading control. Source data for D.
Ubiquitin-specific protease 28 (USP28) inhibitor selectivity and cellular target engagement.
(A) Structure of small-molecular inhibitor FT3951206/CRT0511973 (FT206). (B) Cellular DUB profiling in NCI-H520 lung squamous cell carcinoma (LSCC) cell extracts incubated with the indicated concentrations of FT206 prior to labelling with HA-UbPA, SDS-PAGE, and analysis by Western blotting. Inhibitor potency was reflected by competition with USP28/25-ABP (activity-based probe) adduct formation. (C) Cellular DUB profiling in NCI-H520 LSCC cells incubated with the indicated concentrations of FT206, lysed extracts labelled with HA-UbPA, and analysed as in B. (D) Activity-based probe profiling (ABPP) demonstrating the cellular DUB selectivity profile of cpd FT206 by quantitative mass spectrometry analysis at different inhibitor concentrations. Graph indicates mean ± SEM. (E) USP28 inhibition using FT206 (50 and 100 nM) reduces c-MYC, c-JUN, and Δp63 protein levels in primary KF LSCC cells. (F) USP28 inhibition using FT206 decreases cell proliferation in KF LSCC cells (n = 4). Graph indicates mean ± SEM. Source data for F.
USP28 inhibitor targets USP28/25 and ubiquitylation levels of c-MYC, c-JUN and USP28.
(A) Comparison of ubiquitin-specific protease 28/25 (USP28/25) inhibitor potency by activity-based profiling. Human lung squamous cell carcinoma (LSCC) H520 crude cell extracts were incubated either with AZ1 or FT206 inhibitors at indicated concentrations, followed by HA-UbPA activity-based probe (ABP) labelling. Samples were analysed by SDS-PAGE and immunoblotted using USP28, USP25, HA, and GAPDH antibodies. Inhibitor potency was reflected by competition with USP28/25-ABP adduct formation. (B) TUBE pulldown of endogenous ubiquitylated c-MYC, c-JUN, and USP28 in LSCC cells upon co-treatment with MG132 and FT206. (C) Immunoblot of endogenous USP28, c-JUN, c-MYC, and Δp63 in LSCC cells upon co-treatment with MG132 and FT206. VINCULIN served as loading control. (D) Graphs showing the difference in cell proliferation between control, FT206-treated, and USP28-depleted LSCC cells. Graph indicates mean ± SEM. One-way analysis of variance (ANOVA) with Tukey’s multiple comparisons test was used to calculate p values. VINCULIN is shown as loading control. Source data for D.To further evaluate the efficacy of FT206 in targeting USP28, we tested its ability to modulate the ubiquitination status of endogenous USP28 substrates. The ubiquitination levels of c-MYC and c-JUN increased upon FT206 and MG132 co-treatment (Figure 4—figure supplement 1B), confirming that FT206 blocks USP28-mediated deubiquitination of its substrates. The ubiquitination level of USP28 also increased upon FT206 treatment (Figure 4—figure supplement 1B), which is consistent with previous observations where the enzymatic activity of DUBs can function to enhance their own stability (de Bie and Ciechanover, 2011). Consequently, treatment of LSCC tumour cells with FT206 resulted in reduced c-MYC, c-JUN, Δp63, and USP28 protein levels, which were restored upon addition of MG132 (Figure 4E, Figure 4—figure supplement 1C).Finally, FT206 treatment impaired LSCC cell growth (Figure 4F). However, in a USP28-depleted background, FT206 neither affected cell growth nor reduced c-MYC protein levels (Figure 4—figure supplement 1D). Thus, this data suggests that the effects of FT206 are mediated by USP28.
Pharmacological inhibition of USP28 is well tolerated in mice and induced LSCC tumour regression
We next evaluated the therapeutic potential of the USP28 inhibitor FT206 using the Kras model (KF mice), which develop both LADC and LSCC tumour types (Ruiz et al., 2019). Nine weeks after adeno-CMV-Cre virus infection, when mice had developed lung tumours, we started treatment with USP28 inhibitor at 75 mg/kg, three times a week for 5 weeks (Figure 5A). FT206 administration had no noticeable adverse effects and treated mice maintained normal body weight (Figure 5—figure supplement 1A and B). Consistent with the effects observed by genetic Usp28 inactivation (Figure 2C), the number of KF LADC lesions was not affected by USP28 inhibition via FT206 treatment (Figure 5B–D). By contrast, we found that FT206 effectively reduced LSCC tumour number by 68% (31–10 LSCC tumours, Figure 5B and E). Moreover, measurement of 252 individual KF LSCC mutant tumours (156 vehicle-treated and 96 FT206-treated lesions) showed a significant reduction of over 45% in tumour size upon FT206 treatment: an average of 8.5 × 104 μm2 in the vehicle arm versus 4.5 × 104 μm2 in the FT206 cohort (Figure 5F). Thus, USP28 inhibition by FT206 leads to a dramatic reduction in the numbers of advanced LSCC tumours, and the small number of remaining LSCC lesions is significantly reduced in size, resulting in a reduction of total LSCC burden of over 85% by single agent treatment.
Figure 5.
Pharmacological ubiquitin-specific protease 28 (USP28) inhibition reduces c-MYC, c-JUN, and Δp63 protein levels in mouse lung squamous cell carcinoma (LSCC) tumours and induces tumour cell death.
(A) Scheme depicting experimental design for in vivo test of FT206 (75 mg/kg), three times a week for 5 weeks. (B) Lung histology of animals treated as in A, showing both LSCC (CK5+) and lung adenocarcinoma (LADC) (SFTPC+) tumours in KRas (KF) mice receiving vehicle but few LSCC lesions in mice receiving FT206. Scale bars, 1000 μm. (C) Quantification of LADC tumours per animal in vehicle- and FT206-treated KF mice. Plots indicate mean. p Values calculated using Student’s two-tailed t test (n = 7 vehicle, n = 10 FT206). (D) Quantification of LADC tumour size in vehicle- and FT206-treated KF mice. Plots indicate mean. Student’s two-tailed t test was used to calculate p values (n = 304 vehicle, n = 481 FT206). (E) Quantification of LSCC tumours per animal in vehicle- and FT206-treated KF mice. Plots indicate mean. p Values calculated using Student’s two-tailed t test (n = 7 vehicle, n = 10 FT206). (F) Quantification of LSCC tumour size in vehicle- and FT206-treated KF mice. Plots indicate mean. Student’s two-tailed t test was used to calculate p values (n = 156 vehicle, n = 96 FT206). (G) LSCC tumours stained with c-MYC, c-JUN, and Δp63 antibodies. KF animals treated with vehicle (left panel) or FT206 (right panel). Inserts showing c-MYC+, c-JUN+, Δp63+ LSCC tumours in mice receiving vehicle (left panel) but partial positive or negative LSCC lesions in mice receiving FT206 (right panel). Scale bars, 50 μm. (H) Scheme depicting experimental design for in vivo test of FT206 (75 mg/kg) for 4 days consecutively (upper panel). Cleaved caspase-3 (CC3) stain shows apoptotic cells (bottom panel). Scale bars, 50 μm. (I) Quantification of CC3-positive cells per field (20×) in LADC (n = 114 vehicle, 203 FT206) and LSCC (n = 94 vehicle, 167 FT206) tumours from KF mice treated as in H. Plots indicate mean. Student’s two-tailed t test was used to calculate p values. Source data for C, D, E, F, and I.
(A) Monitoring tolerability in mice treated with FT206 (75 mg/kg), three times a week for 5 weeks. Body weights of animals during the course of treatment (n = 3 vehicle, n = 3 FT206). (B) Kidney, liver, and spleen sections stained with H&E. Mice treated as in A. Bars, 100 μm. Source data for A.
Figure 5—figure supplement 1.
USP28 inhibitor FT206 tolerability in mice.
(A) Monitoring tolerability in mice treated with FT206 (75 mg/kg), three times a week for 5 weeks. Body weights of animals during the course of treatment (n = 3 vehicle, n = 3 FT206). (B) Kidney, liver, and spleen sections stained with H&E. Mice treated as in A. Bars, 100 μm. Source data for A.
Pharmacological ubiquitin-specific protease 28 (USP28) inhibition reduces c-MYC, c-JUN, and Δp63 protein levels in mouse lung squamous cell carcinoma (LSCC) tumours and induces tumour cell death.
(A) Scheme depicting experimental design for in vivo test of FT206 (75 mg/kg), three times a week for 5 weeks. (B) Lung histology of animals treated as in A, showing both LSCC (CK5+) and lung adenocarcinoma (LADC) (SFTPC+) tumours in KRas (KF) mice receiving vehicle but few LSCC lesions in mice receiving FT206. Scale bars, 1000 μm. (C) Quantification of LADC tumours per animal in vehicle- and FT206-treated KF mice. Plots indicate mean. p Values calculated using Student’s two-tailed t test (n = 7 vehicle, n = 10 FT206). (D) Quantification of LADC tumour size in vehicle- and FT206-treated KF mice. Plots indicate mean. Student’s two-tailed t test was used to calculate p values (n = 304 vehicle, n = 481 FT206). (E) Quantification of LSCC tumours per animal in vehicle- and FT206-treated KF mice. Plots indicate mean. p Values calculated using Student’s two-tailed t test (n = 7 vehicle, n = 10 FT206). (F) Quantification of LSCC tumour size in vehicle- and FT206-treated KF mice. Plots indicate mean. Student’s two-tailed t test was used to calculate p values (n = 156 vehicle, n = 96 FT206). (G) LSCC tumours stained with c-MYC, c-JUN, and Δp63 antibodies. KF animals treated with vehicle (left panel) or FT206 (right panel). Inserts showing c-MYC+, c-JUN+, Δp63+ LSCC tumours in mice receiving vehicle (left panel) but partial positive or negative LSCC lesions in mice receiving FT206 (right panel). Scale bars, 50 μm. (H) Scheme depicting experimental design for in vivo test of FT206 (75 mg/kg) for 4 days consecutively (upper panel). Cleaved caspase-3 (CC3) stain shows apoptotic cells (bottom panel). Scale bars, 50 μm. (I) Quantification of CC3-positive cells per field (20×) in LADC (n = 114 vehicle, 203 FT206) and LSCC (n = 94 vehicle, 167 FT206) tumours from KF mice treated as in H. Plots indicate mean. Student’s two-tailed t test was used to calculate p values. Source data for C, D, E, F, and I.
USP28 inhibitor FT206 tolerability in mice.
(A) Monitoring tolerability in mice treated with FT206 (75 mg/kg), three times a week for 5 weeks. Body weights of animals during the course of treatment (n = 3 vehicle, n = 3 FT206). (B) Kidney, liver, and spleen sections stained with H&E. Mice treated as in A. Bars, 100 μm. Source data for A.In line with the effects found by genetic Usp28 deletion, treatment of KF mice with FT206 also resulted in reduced Δp63, c-JUN, and c-MYC protein levels (Figure 5G). Consequently, FT206 treatment led to a substantial increase in the number of CC3-positive cells in LSCC while LADC cells were not significantly affected, indicating that USP28 inhibition causes apoptotic cell death of LSCC tumour cells (Figure 5H and I).Finally, to further confirm the specificity of FT206, KFCU mice pre-exposed to tamoxifen to delete the conditional Usp28 floxed alleles were further treated with the USP28 inhibitor FT206. In this setting, USP28 inhibition did not result in either a further reduction of LADC and LSCC lesions or body weight loss (Figure 2C and F, Figure 2—figure supplement 1E), suggesting that FT206 targets specifically USP28.
USP28 inhibition causes dramatic regression of human LSCC xenograft tumours
To determine whether the promise of USP28 as a target in mouse lung cancer models can be translated to a human scenario, we established human xenograft tumour models. siRNA-mediated USP28 but not USP25 depletion, and USP28 inhibitor treatment, considerably reduced protein levels of Δp63, c-JUN, and c-MYC and impaired growth in human LSCC tumour cells (Figure 6A–C, Figure 6—figure supplement 1A and B). In contrast, FT206 treatment had marginal effects on c-MYC and c-JUN protein levels in human LADC cells and in USP28 mutant LSCC cells (Figure 6—figure supplement 1C–1E). Crucially, FT206 led to a remarkable growth impairment of xenografts derived from three independent human LSCC cell lines (Figure 6D–I), which was accompanied with a strong reduction of c-MYC protein levels (Figure 6J–L). In summary, these data suggest that USP28 pharmacological intervention is a promising therapeutic option for human LSCC patients.
Figure 6.
Pharmacological inhibition of ubiquitin-specific protease 28 (USP28) prevents human lung squamous cell carcinoma (LSCC) tumour progression and reduces c-MYC protein levels in xenograft models.
(A) Small interfering RNA (siRNA)-mediated knockdown of USP28 decreases c-MYC, c-JUN, and Δp63 protein levels in human LUDLU-1 LSCC cells. (B) USP28 inhibition using FT206 (0.2 and 0.4 μM) reduces c-MYC, c-JUN, and Δp63 protein levels in human LUDLU-1 LSCC cells. (C) USP28 inhibition using FT206 decreases cell proliferation in human LSCC (NCI-H520, CALU-1, and LUDLU-1) cell lines (n = 8). Graphs indicate mean ± SEM. (D, E, F) In vivo tumour graft growth curves of human LSCC (NCI-H520, CALU-1, and LUDLU-1) cell lines subcutaneously injected in flanks of immunocompromised mice. Animals with palpable tumours were treated with vehicle or FT206 (75 mg/kg) via oral gavage. Plots indicate mean ± SD of the tumour volumes. p Values calculated from two-way analysis of variance (ANOVA) with Bonferroni’s multiple comparisons test (NCI-H520 n = 4 vehicle and 4 FT206; CALU-1 n = 3 vehicle and 3 FT206; LUDLU-1 n = 3 vehicle and 3 FT206). (G, H, I) Mice treated as in D, E, and F, respectively. Plots showing the weight of xenograft tumours at the end point. Student’s two-tailed t test was used to calculate p values (NCI-H520 n = 4 vehicle and 4 FT206; CALU-1 n = 3 vehicle and 3 FT206; LUDLU-1 n = 3 vehicle and 3 FT206). (J, K, L) c-MYC immunohistochemistry stainings of NCI-H520, CALU-1, and LUDLU-1 xenografts in mice treated as in D, E, and F, respectively. Scale bars, 50 μm. Source data for C, D, E, F, G, H, and I.
(A) Immunoblot of endogenous ubiquitin-specific protease 25 (USP25), c-JUN, c-MYC, and Δp63 in USP25-depleted lung squamous cell carcinoma (LSCC) cells. VINCULIN served as loading control. (B) Immunoblot of endogenous c-MYC and c-JUN in LSCC cells upon FT206 treatment (IC50 doses display in panel D). VINCULIN served as loading control. (C) Immunoblot of endogenous c-MYC and c-JUN in lung adenocarcinoma (LADC) cells upon FT206 treatment (IC50 doses display in panel D). VINCULIN served as loading control. (D) IC50 values (doses that inhibits 50% of the cell viability) were calculated after exposure of human LADC and LSCC cells to different concentrations of FT206 compound. (E) Immunoblot of endogenous c-MYC and c-JUN in USP28 mutant LSCC cells upon FT206 treatment. The LSCC cell line SKMES contains a nonsense mutation in Usp28 (c.193G > T). VINCULIN served as loading control.
Figure 6—figure supplement 1.
USP25 deletion does not affect c-MYC,c-JUN and Δp63 protein levels.
(A) Immunoblot of endogenous ubiquitin-specific protease 25 (USP25), c-JUN, c-MYC, and Δp63 in USP25-depleted lung squamous cell carcinoma (LSCC) cells. VINCULIN served as loading control. (B) Immunoblot of endogenous c-MYC and c-JUN in LSCC cells upon FT206 treatment (IC50 doses display in panel D). VINCULIN served as loading control. (C) Immunoblot of endogenous c-MYC and c-JUN in lung adenocarcinoma (LADC) cells upon FT206 treatment (IC50 doses display in panel D). VINCULIN served as loading control. (D) IC50 values (doses that inhibits 50% of the cell viability) were calculated after exposure of human LADC and LSCC cells to different concentrations of FT206 compound. (E) Immunoblot of endogenous c-MYC and c-JUN in USP28 mutant LSCC cells upon FT206 treatment. The LSCC cell line SKMES contains a nonsense mutation in Usp28 (c.193G > T). VINCULIN served as loading control.
Pharmacological inhibition of ubiquitin-specific protease 28 (USP28) prevents human lung squamous cell carcinoma (LSCC) tumour progression and reduces c-MYC protein levels in xenograft models.
(A) Small interfering RNA (siRNA)-mediated knockdown of USP28 decreases c-MYC, c-JUN, and Δp63 protein levels in human LUDLU-1 LSCC cells. (B) USP28 inhibition using FT206 (0.2 and 0.4 μM) reduces c-MYC, c-JUN, and Δp63 protein levels in human LUDLU-1 LSCC cells. (C) USP28 inhibition using FT206 decreases cell proliferation in human LSCC (NCI-H520, CALU-1, and LUDLU-1) cell lines (n = 8). Graphs indicate mean ± SEM. (D, E, F) In vivo tumour graft growth curves of human LSCC (NCI-H520, CALU-1, and LUDLU-1) cell lines subcutaneously injected in flanks of immunocompromised mice. Animals with palpable tumours were treated with vehicle or FT206 (75 mg/kg) via oral gavage. Plots indicate mean ± SD of the tumour volumes. p Values calculated from two-way analysis of variance (ANOVA) with Bonferroni’s multiple comparisons test (NCI-H520 n = 4 vehicle and 4 FT206; CALU-1 n = 3 vehicle and 3 FT206; LUDLU-1 n = 3 vehicle and 3 FT206). (G, H, I) Mice treated as in D, E, and F, respectively. Plots showing the weight of xenograft tumours at the end point. Student’s two-tailed t test was used to calculate p values (NCI-H520 n = 4 vehicle and 4 FT206; CALU-1 n = 3 vehicle and 3 FT206; LUDLU-1 n = 3 vehicle and 3 FT206). (J, K, L) c-MYC immunohistochemistry stainings of NCI-H520, CALU-1, and LUDLU-1 xenografts in mice treated as in D, E, and F, respectively. Scale bars, 50 μm. Source data for C, D, E, F, G, H, and I.
USP25 deletion does not affect c-MYC,c-JUN and Δp63 protein levels.
(A) Immunoblot of endogenous ubiquitin-specific protease 25 (USP25), c-JUN, c-MYC, and Δp63 in USP25-depleted lung squamous cell carcinoma (LSCC) cells. VINCULIN served as loading control. (B) Immunoblot of endogenous c-MYC and c-JUN in LSCC cells upon FT206 treatment (IC50 doses display in panel D). VINCULIN served as loading control. (C) Immunoblot of endogenous c-MYC and c-JUN in lung adenocarcinoma (LADC) cells upon FT206 treatment (IC50 doses display in panel D). VINCULIN served as loading control. (D) IC50 values (doses that inhibits 50% of the cell viability) were calculated after exposure of human LADC and LSCC cells to different concentrations of FT206 compound. (E) Immunoblot of endogenous c-MYC and c-JUN in USP28 mutant LSCC cells upon FT206 treatment. The LSCC cell line SKMES contains a nonsense mutation in Usp28 (c.193G > T). VINCULIN served as loading control.
Discussion
Unlike for LADC, there are few approved targeted therapies against LSCC. Consequently, despite its limited effectiveness on disease progression and prognosis, patients with LSCC receive the same conventional platinum-based chemotherapy today as they would have received two decades ago (Fennell et al., 2016; Gandara et al., 2015; Isaka et al., 2017; Liao et al., 2012; Scagliotti et al., 2008). c-MYC is a transcription factor that orchestrates a potent pro-cancer programme across multiple cellular pathways. As c-MYC is often overexpressed in late-stage cancer, targeting it for degradation is an attractive strategy in many settings. The term ‘undruggable’ was coined to describe proteins that could not be targeted pharmacologically. Many desirable targets in cancer fall into this category, including the c-MYC oncoprotein, and pharmacologically targeting these intractable proteins is a key challenge in cancer research.The deubiquitylase family of enzymes have emerged as attractive drug targets, which can offer a means to destabilize client proteins that might otherwise be undruggable (Schauer et al., 2020). The deubiquitinase USP28 was known to remove FBW7-mediated ubiquitination of, and thereby stabilize, the oncoprotein c-MYC (Popov et al., 2007). Importantly, mice lacking Usp28 are healthy (Knobel et al., 2014), suggesting that USP28 is dispensable for normal physiology and homeostasis.In the current study, we identified a requirement for USP28 for the maintenance of murine and human LSCC tumours. In agreement with the absence of major phenotypes in the Usp28 knockout mice, USP28 inhibitor treatment was well tolerated by the experimental animals, while having a dramatic effect on LSCC regression. USP28 small-molecule inhibition phenocopies the effects of Usp28 deletion in LSCC regression, consistent with on-target activity. However, we cannot exclude that the inhibition of USP25 and possibly additional off-targets effects may contribute to the observed phenotype. Inhibitor-treated mice kept a normal body weight, indicating no global adverse effects.While USP28 inhibition resulted in profoundly reduced LSCC growth, the effect on LADC was modest. TP63, c-JUN, and c-MYC protein levels are increased in LSCC compared to LADC (Figure 1C and D). This could indicate a greater dependence of LSCC on these oncoproteins, which consequently may result in increased sensitivity to USP28 inhibition. We previously found that Usp28 deficiency corrected the accumulation of SCF (Fbw7) substrate proteins, including c-JUN and c-MYC, in Fbw7 mutant cells (Diefenbacher et al., 2015). The frequent downregulation of FBXW7 in human LSCC (Ruiz et al., 2019; Figure 1—figure supplement 2B) may underlie the increased accumulation of SCF(Fbw7) substrate proteins like c-MYC, c-JUN, and ΔP63 in LSCC, and thereby cause LSCC tumours to be increasingly dependent on USP28 function. Indeed, our study suggests that those three oncoproteins are all relevant targets of USP28 in LSCC (Figure 2H). In contrast, Prieto-Garcia et al. saw no difference in c-JUN and c-MYC protein levels and suggested a different mechanism of action. Of note, our and the Prieto-Garcia et al. studies used different dual specificity inhibitors of USP28/25 that have distinct properties. FT206, the compound used in this study, preferentially inhibits USP28 compared to USP25, whereas AZ1, the compound used by Prieto-Garcia et al., showed a pronounced activity towards USP25. In addition, FT206 inhibits USP28 in the nano-molar range, while Prieto-Garcia et al. typically used AZ1 at 10–30 μM, possibly because higher compound concentrations are required for therapeutic inhibition of USP28. Therefore, differences in the selectivity and potency of the compounds used may explain some of the differences observed.Interestingly, all human LSCC cell lines used in the xenograft experiment (Figure 6), each of which responded well to USP28 inhibition, do not show neither gain- or loss-of-function mutations in USP28 nor FBXW7, respectively. Thus, these data support the notion that LSCC tumour cells respond to USP28 inhibition, regardless of USP28/FBXW7 mutation status, which suggest that USP28 inhibition might be a therapeutic option for many LSCC patients.In summary, our studies demonstrate that USP28 is a key mediator of LSCC maintenance and progression and hence USP28 represents an exciting therapeutic target. Therefore, USP28 inhibition should be considered as a potential therapy for human LSCC.
Materials and methods
Mice
The Kras (Jackson et al., 2001), Fbxw7 (Jandke et al., 2011), Usp28 (Diefenbacher et al., 2014), Kras (Schönhuber et al., 2014), Trp53 (Schönhuber et al., 2014), Rosa26 (Schönhuber et al., 2014), Rosa26 (Muzumdar et al., 2007) strains have been previously described. Immunocompromised NSG mice were maintained in-house. All animal experiments were approved by the Francis Crick Institute Animal Ethics Committee and conformed to UK Home Office regulations under the Animals (Scientific Procedures) Act 1986 including Amendment Regulations 2012. All strains were genotyped by Transnetyx. Each group contained at least three mice, which generates enough power to pick up statistically significant differences between treatments, as determined from previous experience (Ruiz et al., 2019). Mice were assigned to random groups before treatment.
Generation of Fbxw7 mice
To generate a conditional allele of Fbxw7, we employed the CRISPR-Cas9 approach to insert two FRT sites into the intron 4 and 5 of Fbxw7, respectively. Two guide RNAs targeting the integration sites (gRNA-Int5A: accgtcggcacactggtcca; gRNA-Int4A: cactcgtcactgacatcgat), two homology templates containing the FRT sequences (gRNA-Int5B: agcactgacgagtgaggcgg; gRNA-Int4B: tgcctagccttttacaagat) and the Cas9 mRNA were micro-injected into the fertilized mouse eggs. The offspring were screened by PCR and one line with proper integration of two FRT sites was identified.
Analysis of public data from cancer genomics studies
Data from TCGA Research Network (Lung Squamous Cell Carcinoma [TCGA, Firehose Legacy]), including mutations, putative copy-number alterations, and mRNA expression (mRNA expression z-scores relative to diploid samples [RNA Seq V2 RSEM; threshold 2.0]), were analysed using cBioportal software and visualized using the standard Oncoprint output (Cerami et al., 2012). The Onco Query Language (OQL) used was ‘USP28: MUT AMP GAIN EXP ≥ 2’ ‘FBXW7: MUT HOMDEL HETLOSS EXP ≤ –2’. Source data was from GDAC Firehose, previously known as TCGA Provisional. The complete sample set used was (n = 178). Expression analysis was performed using GEPIA (Gene Expression Profiling Interactive Analysis) software (2017).
Human lung tumour analysis
Human biological samples were collected, stored, and managed by the Cordoba node belonging to the Biobank of the Andalusian Health Service (Servicio Andaluz de Salud [SAS]) and approved by the Ethics and Clinical Research Committee of the University Hospital Reina Sofia. All subjects gave informed consent. Pathologists assessed all samples before use. mRNA extracted from the samples was analysed by qPCR. Primers are listed in Table 1.
Table 1.
Primers for quantitative polymerase chain reaction (qPCR).
Name
Primer (5′–3′)
Forward
Reverse
ACTIN
GAAAATCTGGCACCACACCT
TAGCACAGCCTGGATAGCAA
USP28
ACTCAGACTATTGAACAGATGTACTGC
CTGCATGCAAGCGATAAGG
MYC
TCTCCTTGCAGCTGCTTAG
GTCGTAGTCGAGGTCATAG
Tumour induction and tamoxifen treatment
Induction of NSCLC tumours was carried out in anaesthetized (2–2.5% isoflurane) mice by intratracheal instillation of a single dose of 2.5 × 107 pfu of adenoviruses encoding either the Cre recombinase (adeno-CMV-Cre) or Flp recombinase (adeno-CMV-Flp) (Ruiz et al., 2021). Activation of the inducible CreERT2 recombinase was carried out by intraperitoneal injection of tamoxifen (100 μg/kg body weight) dissolved in peanut oil for 10 days.
CT image acquisition and processing
The SkyScan-1176, a high-resolution low-dose X-ray scanner, was used for 3D CT. Mice were anaesthetized with 2–2.5% isoflurane and CT images were acquired at a standard resolution (35 μm pixel size). The raw scan data was sorted using RespGate software, based on the position of the diaphragm, into end expiration bins. 3D reconstruction was performed using NRecon software. 3D data sets were examined using Data Viewer software.
Mouse treatments with FT206
Nine weeks upon Ad5-CMV-Cre infection, KRas mice were treated with FT206 (75 mg/kg) via oral gavage on days 1, 3, and 5 per week during 5 weeks. Body weights were register every week.
In vivo pharmacology with subcutaneous graft tumours
Human LSCC tumour cell lines (NCI-H520, CALU-1, and LUDLU-1) were resuspended as single-cell suspensions at 107 cells/ml in PBS:Matrigel; 100 μl (106 cells total) of this suspension was injected into the flanks of immunodeficient NSG mice. When tumours were palpable, treatment with FT206 (75 mg/kg) was initiated with the same schedule on days 1, 3, and 5 per week. Tumour grafts were measured with digital callipers, and tumour volumes were determined with the following formula: (length × width2) × (π/6). Tumour volumes are plotted as means ± SD.
Histopathology, IHC, and BaseScope analysis
For histological analysis, lungs were fixed overnight in 10% neutral buffered formalin. Fixed tissues were subsequently dehydrated and embedded in paraffin, and sections (4 μm) were prepared for H&E staining or IHC. Antibodies are given in Table 2. BaseScope was performed following the manufacturer’s protocol. The Usp28-specific probe was custom-designed to target 436–482 of NM_175482.3; Ppib probe was used as a positive control (Bio-Techne Ltd).
Table 2.
List of reagents.
Reagent
Source
Identifier
Antibodies
Rabbit anti-CK5
Abcam
Abcam Cat# ab52635, RRID:AB_869890
Rabbit anti-c-MYC
Abcam
Abcam Cat# ab32072, RRID:AB_731658
Goat anti-GFP
Abcam
Abcam Cat# ab6673, RRID: AB_305643
Rabbit anti-Ki67
Abcam
Abcam Cat# ab16667, RRID: AB_302459
Rabbit anti-TTF1
Abcam
Abcam Cat# ab76013, RRID:AB_1310784
Rabbit anti-USP28
Abcam
Abcam Cat# ab126604, RRID:AB_11127442
Rabbit anti-USP25
Abcam
Abcam Cat# ab187156
Rabbit anti-ACTIN
Abcam
Abcam Cat# ab8227, RRID:AB_2305186
Rabbit anti-USP28
Atlas
Atlas Antibodies Cat# HPA006779, RRID:AB_1080517
Rabbit anti-Δp63
BioLegend
BioLegend Cat# 619001, RRID:AB_2256361
Mouse anti-c-JUN
BD Biosciences
BD Biosciences Cat# 610326, RRID:AB_397716
Rabbit anti-FBW7
Bethyl
Bethyl Cat# A301-721A, RRID:AB_1210898
Rabbit anti-USP7
Enzo
Enzo Life Sciences Cat# BML-PW0540, RRID:AB_224147
Tumour numbers were counted from whole lung sections: LADC and LSCC tumours were identified by SFTPC and CK5 stains, respectively. Tumour areas (μm2) were measured from lung sections using Zen3.0 (blue edition) software. For quantification of tumour cell death, the number of CC3-positive cells was counted in individual tumours per field (20×). The number of ΔP63+, c-MYC+, and c-JUN+ cells was counted in individual tumours/10,000 μm2. All analyses were performed uniformity across all lung sections and the whole lungs were used to derive data.
Cell culture
Primary KF LSCC cells were cultured in N2B27 medium containing EGF (10 ng/ml; Pepro Tech) and FGF2 (20 ng/ml; Pepro Tech) (Ruiz et al., 2019). Human LSCC (NCI-H226, NCI-H520, CALU-1, LUDLU-1, and SKMES) and LADC (NCI-H23, NCI-H441, and NCI-H1650) lines were provided by the Francis Crick Institute Cell Services and cultured in RPMI-1640 medium supplemented with 10% FBS, 1% penicillin/streptomycin, 2 mM glutamine, 1% NEEA, and 1 mM Na pyruvate. All cells were tested Mycoplasma-negative and maintained at 37°C with 5% CO2.
Cell treatments
Mouse KF LSCC and human LUDLU-1 cells were treated with vehicle or FT206 at different concentrations for 48 hr to analyse c-MYC, c-JUN, and Δp63 protein levels by Western blotting.Primary mouse KF LSCC cells were infected with inducible shRNAs against the Usp28 gene and then expose to doxycycline hyclate (1 µg/ml) for 48 hr. Cell number was counted using an automated cell counter (Thermo Fisher Scientific, Countess Automated Cell Counter).Mouse KF LSCC and human cell lines were transfected with specific siRNAs against the Myc, Jun, Tp63, Usp25, or Usp28 genes, using Lipofectamine RNAiMAX and 25 nM of each siRNA according to the manufacturer’s instructions (Dharmacon); 48–96 hr later, cell number was counted using an automated cell counter.For IC50, mouse KF LSCC and human cells were treated with vehicle or FT206 at different concentrations for 72 hr. Cell viability was measured as the intracellular ATP content using the CellTiter-Glo Luminescent Cell Viability Assay (Promega), following the manufacturer’s instructions. IC50 was calculated using GraphPad Prism software.
Western blot analysis
Cells were lysed in ice-cold lysis buffer (20 mM Tris HCl, pH 7.5, 5 mM MgCl2, 50 mM NaF, 10 mM EDTA, 0.5 M NaCl, and 1% Triton X-100) that was completed with protease, phosphatase, and kinase inhibitors. Protein extracts were separated on SDS-PAGE, transferred to a nitrocellulose membrane, and blotted with antibodies, which are given in Table 2. Primary antibodies were detected against mouse or rabbit IgGs and visualized with ECL Western blot detection solution (GE Healthcare) or Odyssey infrared imaging system (LI-COR, Biosciences).
USP28 inhibitor synthesis
Synthesis and characterization of the USP28/25 small-molecule inhibitor FT206, a thienopyridine carboxamide derivative, has been described previously in the patent application WO 2017/139778 Al (Guerin et al., 2017) and more recent updates WO 2019/032863 (Zablocki et al., 2019) and WO 2020/033707, where FT206 is explicitly disclosed as in Guerin et al., 2020.
Cellular DUB profiling using Ub-based active site directed probes
Molecular probes based on the ubiquitin scaffold were generated and used essentially as described (Pinto-Fernández et al., 2019; Turnbull et al., 2017). In brief, HA-tagged Ub propargyl probes were synthesized by expressing the fusion protein HA-Ub75-intein-chitin binding domain in Escherichia coli BL21 strains. Bacterial lysates were prepared, and the fusion protein was purified over a chitin binding column (NEB labs, UK). HA-Ub75-thioester was obtained by incubating the column material with mercaptosulfonate sodium salt (MESNa) overnight at 37°C. HA-Ub75-thioester was concentrated to a concentration of ~1 mg/ml using 3000 MW filters (Sartorius) and then desalted against PBS using a PD10 column (GE Healthcare); 500 μl of 1–2 mg/ml of HA-Ub75- thioester was incubated with 0.2 mmol of bromo-ethylamine at pH 8–9 for 20 min at ambient temperature, followed by a desalting step against phosphate buffer pH 8 as described above. Ub probe material was concentrated to ~1 mg/ml, using 3000 MW filters (Sartorius), and kept as aliquots at –80°C until use.
DUB profiling competition assays with cell extracts and with cells
Crude NCI-H520 cell extracts were prepared as described previously using glass-bead lysis in 50 mM Tris pH 7.4, 5 mM MgCl2, 0.5 mM EDTA, 250 mM sucrose, 1 mM DTT. For experiments with crude cell extracts, 50 μg of NCI-H520 cell lysate was incubated with different concentrations of USP28 inhibitor compounds (FT206 and AZ1) for 1 hr at 37°C, followed by addition of 1 μg HA-UbPA and incubation for 10 min (Figure 4B and C) or 30 min (Figure 4—figure supplement 1A comparing FT206 and AZ1) at 37°C. Incubation with Ub probe was optimized to minimize replacement of non-covalent inhibitor FT206 by the covalent probe. Samples were then subsequently boiled in reducing SDS-sample buffer, separated by SDS-PAGE and analysed by Western blotting using anti-HA (Roche, 1:2000), anti-USP28 (Abcam, 1:1000), anti-USP25 (Abcam, 1:1000), anti-GAPDH (Invitrogen, 1:1000), or beta Actin (Abcam, 1:2000) antibodies. For cell-based DUB profiling, 5 × 106 intact cells were incubated with different concentrations of inhibitors in cultured medium for 4 hr at 37°C, followed by glass-bead lysis, labelling with HA-UbPA probe, separation by SDS-PAGE and Western blotting as described above.
DUB inhibitor profiling by quantitative mass spectrometry
Ub probe pulldown experiments in presence of different concentrations of the inhibitor FT206 were performed essentially as described (Pinto-Fernández et al., 2019; Turnbull et al., 2017) with some modifications. In brief, immune precipitated material from 500 μg to 1 mg of NCI-H520 cell crude extract was subjected to in-solution trypsin digestion and desalted using C18 SepPak cartridges (Waters) based on the manufacturer’s instructions. Digested samples were analysed by nano-UPLC-MS/MS using a Dionex Ultimate 3000 nano UPLC with EASY spray column (75 μm × 500 mm, 2 μm particle size, Thermo Scientific) with a 60 min gradient of 0.1% formic acid in 5% DMSO to 0.1% formic acid to 35% acetonitrile in 5% DMSO at a flow rate of ~250 nl/min (~600 bar/40°C column temperature). MS data was acquired with an Orbitrap Q Exactive High Field (HF) instrument in which survey scans were acquired at a resolution of 60,000 @ 400 m/z and the 20 most abundant precursors were selected for CID fragmentation. From raw MS files, peak list files were generated with MSConvert (Proteowizard V3.0.5211) using the 200 most abundant peaks/spectrum. The Mascot (V2.3, Matrix Science) search engine was used for protein identification at a false discovery rate of 1%, mass deviation of 10 ppm for MS1, and 0.06 Da (Q Exactive HF) for MS2 spectra, cys carbamidomethylation as fixed modification, met oxidation, and Gln deamidation as variable modification. Searches were performed against the UniProtKB human sequence database (retrieved 15.10.2014). Label-free quantitation was performed using MaxQuant Software (V1.5.3.8), and data further analysed using GraphPad Prism software (V7) and Microsoft Excel. Statistical test analysis of variance (ANOVA) (multiple comparison; original FRD method of Benjamini and Hochberg) was performed using GraphPad Prism software. The MS data was submitted to PRIDE for public repository with an internal ID of px-submission #469830.
TUBE pulldown
Endogenous poly-Ub conjugates were purified from cells using TUBE affinity reagents (LifeSensors, UM401). Cells were lysed in buffer containing 50 mM Tris-HCl pH 7.5, 0.15 M NaCl, 1 mM EDTA, 1% NP-40, 10% glycerol supplemented with complete protease inhibitor cocktail, PR-619, and 1,10-phenanthroline. Lysate was cleared by centrifugation, Agarose-TUBEs were added, and pulldown was performed for 16 hr at 4°C on rotation. The beads were then washed three times with 1 ml of ice-cold TBS-T, and bound material was eluted by mixing the beads with sample buffer and heating to 95°C for 5 min.
Statistical analysis
Data are represented as mean ± SEM. Statistical significance was calculated with the unpaired two-tailed Student’s t test, one-way or two-way ANOVA followed by multiple comparison test using GraphPad Prism software. A p value that was less than 0.05 was considered to be statistically significant for all data sets. Significant differences between experimental groups were: *p < 0.05, **p < 0.01, or ***p < 0.001. Biological replicates represent experiments performed on samples from separate biological preparations; technical replicates represent samples from the same biological preparation run in parallel.In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Acceptance summary:This study identifies a specific requirement for ubiquitin-specific protease 28 (USP28) in the survival of lung squamous cell carcinomas (LSCCs). Using genetic knockout models and a novel small molecule inhibitor of USP28, they demonstrate loss or inhibition of USP28 impairs the growth of LSCCs to a much greater degree than lung adenocarcinomas, associated with a greater degree of loss of c-MYC, c-JUN, and Δp63. This work will be of interest to researchers seeking to better understand and treat LSCCs.Decision letter after peer review:[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]Thank you for submitting your work entitled "USP28 deletion and small molecule inhibition destabilises c-Myc and elicits regression of squamous cell lung carcinoma" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by a Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Wee-Wei Tee (Reviewer #3).Reviewer #1:The authors investigate a role for a candidate new inhibitor of USP28 in destabilizing c-MYC to reduce the growth of lung squamous carcinomas. They demonstrate that c-MYC levels are higher in lung squamous cell carcinomas (LSCC) versus lung adenocarcinomas (LADC), and depletion of c-MYC reduces LSCC cell growth. The deubiquitinase USP28 is known to stabilize c-MYC; the authors show that depletion of USP28 also decreases c-MYC protein levels. USP28 action opposes that of a ubiquitin complex targeted by the FBXW7 tumor suppressor; the authors create a new mouse model in which FLP recombinase initially causes deletion of FBXW7 and activation of KRAS to cause tumorigenesis with LSCC and LADC, followed by tamoxifen-dependent CRE recombinase deletion of USP28. Loss of USP28 in this model reduced numbers of LSCC but not LADC, and led to decreased expression of c-MYC and other short-lived proteins such as c-JUN and deltap63. A limitation of the data shown is that tumor number calculations are shown for a relatively small number of mice. Deletion of USP28 also did not restrict LADC growth in a second mouse model, with tumors forming based on activation of KRAS and loss of TP53. The authors then describe a compound, FT206, which they show is a specific inhibitor of USP28 among other ubiquitinases. They demonstrate that this compound reduces expression of c-MYC, c-JUN, and deltap63. They also show FT206 reduces growth of LSCC but not LADC in the KRAS/FBXW7 tumor model, and in human LSCC xenografts. These latter data suggest the compound FT206 may be useful as a lead compound. However, the current data are not sufficient to demonstrate FT206 binding and biological effect is specific for USP28, as the compound may also bind and regulate other non-deubiquitinase proteins.1. Given the article focuses on c-MYC, abruptly introducing c-Jun and deltap63 as also elevated in LSCC is abrupt and seems off topic except as a way of bridging to USP28. This connects directly to a cited recent paper by Prieto-Garcia that implicates deltap63 as the critical target of a USP28 inhibitor. This makes the focus on c-MYC difficult to follow.2. The data showing specificity for LSCC in Figure 2 appear to be based on a total of 4-5 mice/genotype for the +/- tamoxifen groups, and the number of tumors for LADC is extremely heterogeneous between animals. If you look at main figure 2C-F, and Supp Figure S3, you can see the vehicle and Tam mice are the same samples. Oddly, the statistical significance differs between the two figures. There are only 3 LSCC mice treated with Tam+FT in Supp Figure S3 – the very small number of mice could itself be a reason there isn't a significant difference with TAM, as the numbers of tumors seem to actually be trending lower. It is necessary to add additional mice to the study.3. FT206 is a critical reagent for the study. While data shown indicates it is specific for USP28 among USPs (although with partial activity for USP25), it provides no evidence to show that it does not bind non-USP targets. Many compounds bind strongly to multiple targets. MYC expression is highly sensitive to transcriptional inhibitors; BET inhibitors, for example, also result in a rapid loss of MYC expression. It is essential to show data to establish whether this compound inhibits cell or tumor growth, and reduces MYC levels, in a USP28-/- null or USP28 depleted background, to determine whether the biological effect is related to USP28 or another potential target. It would also be important to do parallel IC50 curve determination and measurement of MYC expression in human LSCC and LADC cell lines, to supplement Figure 6 and provide support for the idea the compound acts differently in these cell models.4. The design and findings of the study are very similar to that described by Prieto-Garcia; in that case, deltaNp63 was identified as the primary target of USP28. The discussion should explicitly discuss the relation of the present study to that published work, to emphasize points of similarity and difference.Reviewer #2:In this work Ruiz et al., use a couple of elegant mouse genetic models – KFCU (Fbxw7 deletion and mutant Ras over-expression) and KPCU (p53 deletion and mutant Ras over-expression) – to generate both LADC and LSCC tumors. Using this system, the authors show that deletion of USP28 resulted in less LSCC but not LADC tumor formation. However, both tumor types showed overall decrease in tumor size (in KFCU not shown in KPCU). These results are the genetic proof of concept that USP28 inhibition will be particularly detrimental in the context of LSCC tumors. They further test a compound (FT206) that was previously found to target USP28 and show that indeed this compound is specific for USP28 binding among USPs and can reduce the tumor numbers and size only in LSCC tumors and not LADC in the KF model and in three separate LSCC cell line xenograft models. Altogether making the argument that targeting LSCC tumors with chemical inhibitors of USP28 is a promising clinical strategy for LSCC cancers. Overall this paper is interesting and the results provided in vivo are very strong and nicely demonstrate an on-target effect of FT206 and its specificity in LSCC tumors. The work is very similar to a recent publication of (Prieto-Garcia EMBO Mol Med 2020) describing very similar results for USP28 dependency in LSCC tumors and previous findings regarding the chemical matter used in this paper (FT206).The major strengths of this paper is that the authors use several very elegant mouse models to establish that Usp28 is a good candidate target for potential therapeutic development designated for LSCC patients. They also show the proof of concept using a compound that is described as a Usp28 inhibitor (FT206). It should be noted that much of the genetic data, showing the importance of Usp28 in LSCC was previously described (Prieto-Garcia EMBO Mol Med 2020) including the potential benefit of chemical inhibition of USP28. A potential weakness is that there is no rigorous characterizing of Usp28 substrate ubiquitination and degradation following FT206 treatment. This work will likely motivate the development of the USP28 inhibitor(s) for further preclinical assessment in Usp28 dependent tumors such as LSCC.1. It is not clear in the paper as it is written now how the authors selected FT206. Is this a novel compound? Or was its function as a USP28 inhibitor already described before? There is a couple of publication cited and additional patents but even going through them it does not clarify this point. As this is a central novelty of this paper It would be informative to give a proper background on this compound, why was it selected? Was there a previous screen conducted ? is it a modification of a previously described scaffold ? etc., It makes no sense to dig through the patents to try and figure this out.2. Despite the nice results in vivo and competition assays using ABPP there is no evidence provided to show that there is actually increased ubiquitination and degradation of the substrate proteins following FT206 treatment in cells. If this is the first demonstration of this USP28 inhibitor one would want to show at least in cell culture substrate ubiquitination and degradation. Also, there seems to be consistent decrease in Usp28 levels following FT206, this needs to be addressed in the text.Reviewer #3:The prevalent treatment options for LSCC are limited in efficacy. Through genetic inactivation of Usp28 in a novel lung cancer mouse model, and chemical inhibition of Usp28 in induced LSCC in mice and human LSCC xenograft tumors, the authors demonstrated the specific dependency of LSCC (but not LADC) on the protein deubiquitinase Usp28. The authors also showed that loss of Usp28 by either means leads to depletion of the oncoproteins c-Myc, p63 and c-Jun in LSCC. Finally, the authors described a novel small molecule that is specific for Usp25/28. Based on these results, the authors suggested chemically targeting USP28 as a potential therapeutic option for human LSCC patients.Strengths: The presentation of the work is clear, concise and easily readable. The data presented largely supports the authors' conclusions on the role of USP28 in LSCC tumorigenesis and that inhibition of USP28 is a viable therapeutic option for LSCC treatment. The generation of the KFCU mice model that can give rise to both LADC and LSCC concurrently is interesting and presents a valuable tool for the wider cancer community.Weakness: The manuscript can benefit from a deeper analysis of the relationship between FBW7 and USP28 in patient cohorts. A comparison of the activity/efficacy of FT206 to existing USP28 inhibitors will also be helpful.1. The authors mentioned that 25% of human lung squamous cell carcinoma cases show gain of function alterations in USP28, based on TCGA data.– What is the proportion of cases in the current study cohort (n=17) which show similar gain of function alterations at the DNA level, as well as overexpression of USP28 at the protein level (by immunohistochemistry or immunoblotting)?– What is the correlation between DNA alterations and mRNA/protein expression? This would be clinically relevant if USP28 inhibitors are to be used in clinic, since we need a robust predictive test to select for patients who are most likely to respond to this therapy.2. A previous study by the same first author mentioned that 69% of patients with LSCC show loss of FBW7 expression by immunohistochemistry.– What is the FBW7 status of the cohort in the current study?– Can USP28 overexpression/gain of function co-exists with FBW7 loss, or are they mutually exclusive?– Apart from USP28 gain of function, FBW7 loss of function may also predict sensitivity to USP28 inhibition. Related to this, what is the status of FBW7 and USP28 in the three human LSCC cell lines used in the xenograft studies? This would clarify if the observed effect for USP28 inhibition is specific to LSCC cell lines with USP28 overexpression/FBW7 loss or to LSCC cell lines in general, regardless of USP28/FBW7 status.3. It is interesting that LADC is not affected by the loss of Usp28. What is c-MYC and c-Jun protein expression in the LADC lesions in the KFCU mice? Are they upregulated upon KrasG12D activation and Fbw7 deletion? Although the authors showed in Figure 1 that the expression of c-MYC is lower in LADC compared to LSCC, it will be important to directly assess whether loss of USP28 (either by siRNA knockdown or FT206 treatment) in LADC cell lines can affect c-MYC protein expression.4. As an important part of the paper is about application of the new Usp28 inhibitor FT206, the authors should have compared the efficacy with previously described Usp25/28 inhibitor (Wrigley et al; 2017, ACS Chem Biol 12,3113-3125) or at the very least, comment on potential similarities/differences/improvements etc.5. As the authors advocate targeting USP28 in LSCC treatment, have they tested, or can they comment on, whether USP28 inhibition would be beneficial for LSCC that do not have gain-of-function alterations in USP28 (which represent 75% of LSCC)?[Editors’ note: further revisions were suggested prior to acceptance, as described below.]Thank you for resubmitting your work entitled "USP28 deletion and small molecule inhibition destabilises c-Myc and elicits regression of squamous cell lung carcinoma" for further consideration by eLife. Your revised article has been evaluated by Erica Golemis (Senior Editor) and a Reviewing Editor.The manuscript has been improved but there are some minor remaining issues that need to be addressed, as outlined below. Please address these points.Reviewer #1:This is a revised submission of a manuscript initially deemed as of interest, but rejected due to the need for a large number of experiments to validate the author's model. In this revised submission, the authors have substantially addressed essentially every point made by the referees, providing new in vitro and in vivo data. The work now convincingly makes the point that the ubiquitin protease USP28 is specifically required to support the growth of lung squamous cell carcinomas (LSCCs), more than lung adenocarcinomas (LADCs). The work defines critical USP28 targets as c-Myc, c-Jun, and ∆p63, and shows differential USP28-dependent stability of these proteins in LSCCs and LADCs. The authors also show that the FT206 compound inhibits USP28, and is selectively effective in reducing the growth of LSCCs versus LADCs. Overall, the data provided are much improved, as is the discussion of the context of the work; and the finding is potentially clinically important.Reviewer #2:Overall the authors have addressed most of my concerns in the previous submission. I find the revised manuscript much clearer and significantly improved. I only have 4 additional points for the authors' clarification:1) In light of the new data showing that FT206 can also inhibit USP25, albeit to a lesser extent than USP28, I think it is important to address if depletion of USP25 also results in loss of c-Myc, c-Jun and ∆p63 expressions compared to USP28 knockdown, at least in cell lines. Related to this, what is the phenotype of USP25 KO mice (if known)?2) The authors mentioned that inhibitor treated mice kept a normal body weight, indicating no global adverse effects (Figure S5A). The numbers of mice used (n = 3) are on the low side. Do the authors have body weight and survival information for the other FT206 treated genetic mouse models (e.g Figure 2)?3) The authors showed in Figure S2A that there is a positive correlation between USP28 copy number gain and higher mRNA expression in human LSCC patients, which may be useful for patient selection. However, they also mentioned that the 3 LSCC cell lines used for the xenograft studies do not show gain-of-function mutations in USP28 but responded well to USP28 inhibition. Do the authors have any data comparing the effects of USP28 deletion and/or inhibition in LSCC cell lines with or without USP28 alterations?4) Related to point 3, can the authors speculate or discuss why USP28 deletion/inactivation has a less pronounced effect in LADC despite the latter also having high expression of USP28 and c-MYC ?[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]Reviewer #1:The authors investigate a role for a candidate new inhibitor of USP28 in destabilizing c-MYC to reduce the growth of lung squamous carcinomas. They demonstrate that c-MYC levels are higher in lung squamous cell carcinomas (LSCC) versus lung adenocarcinomas (LADC), and depletion of c-MYC reduces LSCC cell growth. The deubiquitinase USP28 is known to stabilize c-MYC; the authors show that depletion of USP28 also decreases c-MYC protein levels. USP28 action opposes that of a ubiquitin complex targeted by the FBXW7 tumor suppressor; the authors create a new mouse model in which FLP recombinase initially causes deletion of FBXW7 and activation of KRAS to cause tumorigenesis with LSCC and LADC, followed by tamoxifen-dependent CRE recombinase deletion of USP28. Loss of USP28 in this model reduced numbers of LSCC but not LADC, and led to decreased expression of c-MYC and other short-lived proteins such as c-JUN and deltap63. A limitation of the data shown is that tumor number calculations are shown for a relatively small number of mice. Deletion of USP28 also did not restrict LADC growth in a second mouse model, with tumors forming based on activation of KRAS and loss of TP53. The authors then describe a compound, FT206, which they show is a specific inhibitor of USP28 among other ubiquitinases. They demonstrate that this compound reduces expression of c-MYC, c-JUN, and deltap63. They also show FT206 reduces growth of LSCC but not LADC in the KRAS/FBXW7 tumor model, and in human LSCC xenografts. These latter data suggest the compound FT206 may be useful as a lead compound. However, the current data are not sufficient to demonstrate FT206 binding and biological effect is specific for USP28, as the compound may also bind and regulate other non-deubiquitinase proteins.1. Given the article focuses on c-MYC, abruptly introducing c-Jun and deltap63 as also elevated in LSCC is abrupt and seems off topic except as a way of bridging to USP28. This connects directly to a cited recent paper by Prieto-Garcia that implicates deltap63 as the critical target of a USP28 inhibitor. This makes the focus on c-MYC difficult to follow.We agree that the clarity of our manuscript needed to be improved. To clarify the relative importance of c-Jun and ∆p63 as USP28 substrates in LSCC, we have targeted c-Jun and p63 expression by siRNAs in LSCC cells. Our new data suggest that also c-Jun and p63 are required for efficient cell proliferation in human LSCC cell lines (new Figure S1). Therefore, the inhibition of LSCC growth by USP28 inhibition appears to be due to a combination of effects on 3 independent USP28 substrates, c-Myc, c-Jun and ∆p63.2. The data showing specificity for LSCC in Figure 2 appear to be based on a total of 4-5 mice/genotype for the +/- tamoxifen groups, and the number of tumors for LADC is extremely heterogeneous between animals. If you look at main figure 2C-F, and Supp Figure S3, you can see the vehicle and Tam mice are the same samples. Oddly, the statistical significance differs between the two figures. There are only 3 LSCC mice treated with Tam+FT in Supp Figure S3 – the very small number of mice could itself be a reason there isn't a significant difference with TAM, as the numbers of tumors seem to actually be trending lower. It is necessary to add additional mice to the study.This is an important point. Firstly, we want to clarify that the vehicle- and Tamoxifen-treated mice indeed are the same in Figures 2 and S3. We split the data in two Figures because FT206 treatment was mentioned in the manuscript text later (Figure 5), and we only used the vehicle and USP28 KO data in Figure 2. Regarding the statistical analysis, in Figure 2, we are comparing just 2 groups, for which we used a T-test. In Figure S3 we are comparing 3 groups, thus we could not use a T-test. Instead, we used One-way ANOVA. However, to avoid misinterpretations, in the revised version of our manuscript, we show the 3 groups (vehicle- and Tamoxifen-treated and FT206-treated) in Figure 2.As requested, we have increased the number of mice for all 3 experimental groups. We increased the number of mice in the Vehicle cohort from 5 to 8, the number of mice in the Tamoxifen-treated cohort from 4 to 7 and the number of mice in the Tamoxifen+FT206-treated cohort from 3 to 7. Consistent with our previous findings, KFCU mice exposed to tamoxifen to delete the conditional Usp28 floxed alleles, showed a significant reduction in the numbers of LSCC lesions (new Figure 2F). In contrast, loss of Usp28 did not reduce the number of LADC tumors (new Figure 2C).In addition, KFCU mice pre-exposed to tamoxifen, and therefore homozygous deleted for both usp28 alleles, were treated with the USP28 inhibitor FT206. Usp28 inhibition did not result in a further reduction of LADC and LSCC lesions (new Figure 2C,D,F,G), suggesting that FT206 targets specifically Usp28.3. FT206 is a critical reagent for the study. While data shown indicates it is specific for USP28 among USPs (although with partial activity for USP25), it provides no evidence to show that it does not bind non-USP targets. Many compounds bind strongly to multiple targets. MYC expression is highly sensitive to transcriptional inhibitors; BET inhibitors, for example, also result in a rapid loss of MYC expression. It is essential to show data to establish whether this compound inhibits cell or tumor growth, and reduces MYC levels, in a USP28-/- null or USP28 depleted background, to determine whether the biological effect is related to USP28 or another potential target. It would also be important to do parallel IC50 curve determination and measurement of MYC expression in human LSCC and LADC cell lines, to supplement Figure 6 and provide support for the idea the compound acts differently in these cell models.To address the specificity of FT206 towards USP28, we used siRNAs to knockdown Usp28 in LSCC cells, followed by FT206 treatment. Our data showed that in a USP28-depleted background, FT206 neither affected cell growth nor reduced c-Myc protein levels (new Figure S4D). Thus, in line with our observations in the KFCU mouse model, see point 2 above, also this data strongly suggests that the effects of FT206 are mediated by Usp28 (new Figure 2C,D,F,G).As requested, human LADC and LSCC cell lines were treated with FT206 (IC50 doses) to analyse its effect on c-Myc protein levels (new Figure S6).Interestingly, FT206 treatment reduced c-Myc (>65%) and c-Jun (>80%) protein levels in the three human LSCC cell lines used in the xenograft studies (new Figure S6A).Usp28 inhibition also decreased c-Myc levels in 2/3 LADC lines, although the reduction in cMyc protein levels appear to be significantly less pronounced than observed in LSCC (~60%) (new Figure S6B). In contrast, treatment of LADC cells with FT206 resulted in a significant increase in c-Jun protein levels. Thus, Usp28 inhibition acts differently in LADC and LSCC tumor cells.4. The design and findings of the study are very similar to that described by Prieto-Garcia; in that case, deltaNp63 was identified as the primary target of USP28. The discussion should explicitly discuss the relation of the present study to that published work, to emphasize points of similarity and difference.We thank the reviewer for this important suggestion. We have addressed the differences of our work with the study of Prieto-Garcia et al. in the Discussion section. There are key differences between our study as compared to the study of Prieto-Garcia et al. We show that c-Jun, p63 and c-Myc are all relevant targets of Usp28 in LSCC and contribute to the observed effects of Usp28 inhibition/inactivation (Figure 2H), whereas Prieto-Garcia et al. see no difference in c-Jun and c-Myc protein levels (KPLU is the LSCC model with Usp28 inactivation). We would like to point out that in our view the technical quality of our Western blot experiments is higher. We also want to emphasise that both c-Jun and c-Myc are well established targets of Usp28, and that in this revision we show ubiquitylation assays clearly demonstrating increased c-Myc ubiquitylation in the presence of Usp28 inhibitor (new Figure S4B). Therefore, the proposed mechanism of action between our study and the study byPrieto-Garcia et al. is different.Of note, our and the Prieto-Garcia et al. studies used different dual specificity inhibitors of Usp25/Usp28 that have distinct properties. Firstly, FT206, the compound used in our study, preferentially inhibits Usp28 compared to Usp25, whereas AZ1, the compound used by PrietoGarcia et al., showed pronounced activity towards Usp25 (new Figure S4A of the revised manuscript). Secondly, whereas FT206 inhibits Usp28 in the nano-molar range (e.g see Figure 6B and new Figure S6A of the revised manuscript), Prieto-Garcia et al. typically used AZ1 at 10-30µM. We observed a clear reduction of c-Myc levels at 300nM (new Figure S6A of the revised manuscript). Therefore, differences in the selectivity and potency of the compounds used may explain some of the differences observed. We now discuss these differences in the revised manuscript.Reviewer #2:In this work Ruiz et al., use a couple of elegant mouse genetic models – KFCU (Fbxw7 deletion and mutant Ras over-expression) and KPCU (p53 deletion and mutant Ras over-expression) – to generate both LADC and LSCC tumors. Using this system, the authors show that deletion of USP28 resulted in less LSCC but not LADC tumor formation. However, both tumor types showed overall decrease in tumor size (in KFCU not shown in KPCU). These results are the genetic proof of concept that USP28 inhibition will be particularly detrimental in the context of LSCC tumors. They further test a compound (FT206) that was previously found to target USP28 and show that indeed this compound is specific for USP28 binding among USPs and can reduce the tumor numbers and size only in LSCC tumors and not LADC in the KF model and in three separate LSCC cell line xenograft models. Altogether making the argument that targeting LSCC tumors with chemical inhibitors of USP28 is a promising clinical strategy for LSCC cancers. Overall this paper is interesting and the results provided in vivo are very strong and nicely demonstrate an on-target effect of FT206 and its specificity in LSCC tumors. The work is very similar to a recent publication of (Prieto-Garcia EMBO Mol Med 2020) describing very similar results for USP28 dependency in LSCC tumors and previous findings regarding the chemical matter used in this paper (FT206).The major strengths of this paper is that the authors use several very elegant mouse models to establish that Usp28 is a good candidate target for potential therapeutic development designated for LSCC patients. They also show the proof of concept using a compound that is described as a Usp28 inhibitor (FT206). It should be noted that much of the genetic data, showing the importance of Usp28 in LSCC was previously described (Prieto-Garcia EMBO Mol Med 2020) including the potential benefit of chemical inhibition of USP28. A potential weakness is that there is no rigorous characterizing of Usp28 substrate ubiquitination and degradation following FT206 treatment. This work will likely motivate the development of the USP28 inhibitor(s) for further preclinical assessment in Usp28 dependent tumors such as LSCC.1. It is not clear in the paper as it is written now how the authors selected FT206. Is this a novel compound? Or was its function as a USP28 inhibitor already described before? There is a couple of publication cited and additional patents but even going through them it does not clarify this point. As this is a central novelty of this paper It would be informative to give a proper background on this compound, why was it selected? Was there a previous screen conducted ? is it a modification of a previously described scaffold ? etc., It makes no sense to dig through the patents to try and figure this out.We thank the reviewer for this comment. In fact, the small molecule compound FT206 is part of a patent on USP28 inhibitors that was filed by Forma Therapeutics WO 2020/033707 (Guerin D et al., 2020 – referenced in our manuscript), in which several hundred compound derivatives were reported with various degrees of inhibitory potency towards USP28. Amongst those, FT206, explicitly disclosed as compound example 11.1, has been specifically optimised for in vivo use with an adequate stability in serum, suitable biodistribution and pharmacodynamics (DMPK) as described in the patent. We have added a paragraph in the result section that mentions these characteristics (page 9, lines 3-7).2. Despite the nice results in vivo and competition assays using ABPP there is no evidence provided to show that there is actually increased ubiquitination and degradation of the substrate proteins following FT206 treatment in cells. If this is the first demonstration of this USP28 inhibitor one would want to show at least in cell culture substrate ubiquitination and degradation. Also, there seems to be consistent decrease in Usp28 levels following FT206, this needs to be addressed in the text.As suggested, we performed ubiquitination assays on c-Myc, c-Jun and Usp28 following FT206 treatment.We found that the ubiquitination levels of c-Myc and c-Jun increased upon FT206 treatment, confirming that FT206 blocks USP28-mediated deubiquitination of its substrates (new Figure S4B). We also found that the ubiquitination level of USP28 increased upon FT206 treatment (new Figure S4B), which is consistent with previous observations where the enzymatic activity of DUBs is required to enhance their own stability (https://doi.org/10.1038/cdd.2011.16).Reviewer #3:The prevalent treatment options for LSCC are limited in efficacy. Through genetic inactivation of Usp28 in a novel lung cancer mouse model, and chemical inhibition of Usp28 in induced LSCC in mice and human LSCC xenograft tumors, the authors demonstrated the specific dependency of LSCC (but not LADC) on the protein deubiquitinase Usp28. The authors also showed that loss of Usp28 by either means leads to depletion of the oncoproteins c-Myc, p63 and c-Jun in LSCC. Finally, the authors described a novel small molecule that is specific for Usp25/28. Based on these results, the authors suggested chemically targeting USP28 as a potential therapeutic option for human LSCC patients.Strengths: The presentation of the work is clear, concise and easily readable. The data presented largely supports the authors' conclusions on the role of USP28 in LSCC tumorigenesis and that inhibition of USP28 is a viable therapeutic option for LSCC treatment. The generation of the KFCU mice model that can give rise to both LADC and LSCC concurrently is interesting and presents a valuable tool for the wider cancer community.Weakness: The manuscript can benefit from a deeper analysis of the relationship between FBW7 and USP28 in patient cohorts. A comparison of the activity/efficacy of FT206 to existing USP28 inhibitors will also be helpful.1. The authors mentioned that 25% of human lung squamous cell carcinoma cases show gain of function alterations in USP28, based on TCGA data.– What is the proportion of cases in the current study cohort (n=17) which show similar gain of function alterations at the DNA level, as well as overexpression of USP28 at the protein level (by immunohistochemistry or immunoblotting)?We would like to thank also this reviewer for insightful comments. Unfortunately, we cannot evaluate DNA genetic alterations in our study cohort as we do not have any additional remaining sample left to extract DNA. However, as requested, we have performed immunohistochemistry (IHC) analysis for USP28, and found that LSCC tumours express very high levels of USP28 protein (new Figure S2B).However, we have mRNA from these analysed samples, and we found that in our study cohort low USP28 mRNA levels correlate with low Usp28 protein levels and likewise, high/moderate mRNA levels also correlate with high Usp28 protein levels (Figure 1G and new Figure S2B).-What is the correlation between DNA alterations and mRNA/protein expression? This would be clinically relevant if USP28 inhibitors are to be used in clinic, since we need a robust predictive test to select for patients who are most likely to respond to this therapy.This is an excellent suggestion. We have performed this analysis using TCGA data, which revealed that there is a positive correlation between USP28 copy-number gain and higher mRNA expression in human LSCC patients (new Figure S2A). We completely agree with the insightful suggestion by this referee using USP28 status for potential LSCC patient selection for USP28 treatment. It will be very interesting to determine if USP28 inhibitors will have higher efficacy in patients with gain-of-function alterations in USP28.2. A previous study by the same first author mentioned that 69% of patients with LSCC show loss of FBW7 expression by immunohistochemistry.– What is the FBW7 status of the cohort in the current study?As requested, we have performed immunohistochemistry analysis for FBW7, and found that 16/17 (94%) LSCC tumors express low levels of FBW7protein (new Figure S2B), which is even higher than in the cohort we previously reported.– Can USP28 overexpression/gain of function co-exists with FBW7 loss, or are they mutually exclusive?Analysing LSCC TCGA data, we found that 44/178 human LSCC cases show overexpression/gain of function in USP28 (~25%). Interestingly, 30 of those 44 cases (68.1%) also display loss of FBXW7. Thus, in a significant fraction of LSCC patients, USP28 overexpression/gain of function co-exists with FBXW7 loss. However, ~75% of cases with FBXW7 alterations do not show USP28 gain-of-function (new Figure 1F). Thus, USP28 overexpression/gain-of-function and FBXW7 loss are not mutually exclusive.Moreover, in our cohort we found by IHC that all human LSCC samples express USP28 (mostly very strongly; new Figure S2B) concomitant with FBW7 loss (new Figure S2B). Thus, USP28 overexpression co-exists with FBW7 loss in human LSCC patients.– Apart from USP28 gain of function, FBW7 loss of function may also predict sensitivity to USP28 inhibition. Related to this, what is the status of FBW7 and USP28 in the three human LSCC cell lines used in the xenograft studies? This would clarify if the observed effect for USP28 inhibition is specific to LSCC cell lines with USP28 overexpression/FBW7 loss or to LSCC cell lines in general, regardless of USP28/FBW7 status.We have analysed COSMIC (https://cancer.sanger.ac.uk/cosmic) and canSAR(https://cansarblack.icr.ac.uk/) genetic databases and found that all 3 human LSCC cell lines (NCI-H520, CALU-1 and LUDLU-1) used in our study do not show mutations in FBXW7 nor USP28. An example is shown in Author response image 1 (NCI-H520, (Author response image 1); we only added this Figure to the rebuttal letter, not the manuscript, as this information is publicly available, but we would include it in the manuscript if this referee felt this was useful). Thus, these data support the notion that LSCC cells respond to USP28 inhibition, regardless of USP28/FBXW7 mutation status, which suggest that USP28 inhibition might be a therapeutic option for all LSCC patients.
Author response image 1.
Analysis in COSMIC (panel A) or canSAR (panel B) databases showing no evidence of mutations in USP28 nor FBXW7 genes.
3. It is interesting that LADC is not affected by the loss of Usp28. What is c-MYC and c-Jun protein expression in the LADC lesions in the KFCU mice? Are they upregulated upon KrasG12D activation and Fbw7 deletion? Although the authors showed in Figure 1 that the expression of c-MYC is lower in LADC compared to LSCC, it will be important to directly assess whether loss of USP28 (either by siRNA knockdown or FT206 treatment) in LADC cell lines can affect c-MYC protein expression.Our Western blot analysis revealed that Usp28 deletion resulted in reduced c-Jun and c-Myc protein levels in KFCU LADC lesions, although the reduction in c-Myc protein levels appear to be significantly less pronounced than observed in LSCC (new Figure 2E).The modest decrease in Usp28 substrates could explain the modest reduction in LADC tumor size.In addition, human LADC cell lines were treated with FT206 (IC50 doses) and c-Myc/c-Jun levels determined. We found that FT206 treatment reduced c-Myc (>65%) and c-Jun (>80%) protein levels in the three human LSCC cell lines used in the xenograft studies (new Figure S6A).Although Usp28 inhibition also decreased c-Myc levels in 2/3 LADC lines, the reduction in cMyc protein levels appear to be significantly less pronounced than observed in LSCC (new Figure S6B). In contrast, treatment of LADC cells with FT206 resulted in a significant increase in c-Jun protein levels. Thus, Usp28 inhibition acts differently in LADC and LSCC tumor cells.4. As an important part of the paper is about application of the new Usp28 inhibitor FT206, the authors should have compared the efficacy with previously described Usp25/28 inhibitor (Wrigley et al; 2017, ACS Chem Biol 12,3113-3125) or at the very least, comment on potential similarities/differences/improvements etc.We completely agree with this referee that this will be a useful addition to our study. To this end, we have compared USP28 cellular target engagement properties of the AZ1 and FT206 compounds using our activity-based protein profiling assay with a Ub-based probe as described for Figure 4B, and have added this data in new Figure S4A.5. As the authors advocate targeting USP28 in LSCC treatment, have they tested, or can they comment on, whether USP28 inhibition would be beneficial for LSCC that do not have gain-of-function alterations in USP28 (which represent 75% of LSCC)?The three human LSCC cell lines (NCI-H520, CALU-1 and LUDLU-1) used in the xenograft experiment in our study, each of which that responded well to USP28 inhibition, do not show gain-of-function mutations in USP28 (Author response image 1). Thus, these data suggest that targeting USP28 could be beneficial for LSCC patients that do not have gain-of-function alterations in USP28.[Editors’ note: what follows is the authors’ response to the second round of review.]Reviewer #2:Overall the authors have addressed most of my concerns in the previous submission. I find the revised manuscript much clearer and significantly improved. I only have 4 additional points for the authors' clarification:1) In light of the new data showing that FT206 can also inhibit USP25, albeit to a lesser extent than USP28, I think it is important to address if depletion of USP25 also results in loss of c-Myc, c-Jun and ∆p63 expressions compared to USP28 knockdown, at least in cell lines.This is an important point. As suggested, we knockdown the expression of Usp25 by siRNAs and observed that Usp25 downregulation did not reduced protein levels of c-Jun, p63 and cMyc in LSCC cells (new Figure 6 —figure supplement 1A). Thus, together this data suggests that the observed effects of FT206 treatment are mainly mediated by Usp28.Related to this, what is the phenotype of USP25 KO mice (if known)?USP25 KO mice are viable and do not show any abnormalities in growth or survival (Nat Immunol 2012, 13:1110) but are more susceptible to H5N1 or HSV-1 viral infection compared to their wild-type counterparts (PNAS 2015,112:11324). This is linked to USP25 association with TRAF3 and TRAF6, main components of innate immune response, and no apparent functional connections appear to exist with c-Myc, c-Jun or p63 (PNAS 2015,112:11324).2) The authors mentioned that inhibitor treated mice kept a normal body weight, indicating no global adverse effects (Figure S5A). The numbers of mice used (n = 3) are on the low side. Do the authors have body weight and survival information for the other FT206 treated genetic mouse models (e.g Figure 2)?As requested, we now show the body weight for the genetic models displayed in Figure 2 (new Figure 2 —figure supplement 1E, n = 7-8). We observed a transient loss of body weight during Tamoxifen treatment, yet body weight recovered a few days later. This effect has been found in other studies that use Tamoxifen to delete floxed alleles (Cancer Cell 2019; 35:573), as it is well-known that Tamoxifen transiently decreases food intake, body weight and in the short-term fat mass in rodents (Am J Physiol 1993 264:R1219). Importantly, FT206 administration did not result in a further reduction of body weight (new Figure 2 —figure supplement 1E).Unfortunately, we do not have survival curves for these experiments. Mice from different groups (i.e. Vehicle, Tam and Tam+FT) were culled at the same time to quantify side-by-side the number of lung tumours. However, the decreased tumour burden seen in lung tumour in the absence of Usp28 suggested that survival will be impacted. To support the clinical significance of targeting Usp28, we examined the correlation between USP28 expression level and LSCC patient survival (Author response image 2). Lower expression of USP28 is associated with a significantly longer survival time (P = 8.4x10-3).
Author response image 2.
Kaplan-Meier plot showing the association between USP28 expression and patient survival.
Analysis performed using KM plotter lung cancer database.
Kaplan-Meier plot showing the association between USP28 expression and patient survival.
Analysis performed using KM plotter lung cancer database.3) The authors showed in Figure S2A that there is a positive correlation between USP28 copy number gain and higher mRNA expression in human LSCC patients, which may be useful for patient selection. However, they also mentioned that the 3 LSCC cell lines used for the xenograft studies do not show gain-of-function mutations in USP28 but responded well to USP28 inhibition. Do the authors have any data comparing the effects of USP28 deletion and/or inhibition in LSCC cell lines with or without USP28 alterations?This is an interesting point. We believe that both situations are not mutually exclusive. Whereas those patients with gain-of-function alterations in USP28 might have a higher response to USP28 inhibitors, our xenograft data suggest that patients without USP28 alterations could also benefit from USP28 inhibition.As requested, we compared the effects of USP28 inhibition in LSCC cell lines with or without USP28 alterations. In Figure 6 —figure supplement 1B we found that FT206 treatment resulted in a significant decrease of c-Myc and c-Jun protein levels in three human LSCC cell lines (H520, CALU-1 and LUDLU-1) that do not have USP28 genetic alterations. The LSCC cell line SKMES contains a Nonsense Mutation in USP28 (c.193G>T), resulting in a nonfunctional protein product. Consequently, FT206 treatment failed to decrease c-Myc and cJun protein levels in this cell line (new Figure 6 —figure supplement 1E). This data further confirms that the effects of FT206 are mediated by USP28 and also suggests that patients with loss-of-function alterations in USP28 will not respond to USP28 inhibitors.4) Related to point 3, can the authors speculate or discuss why USP28 deletion/inactivation has a less pronounced effect in LADC despite the latter also having high expression of USP28 and c-MYC ?Our Western blot analysis revealed that Usp28 deletion resulted in reduced c-Myc and c-Jun protein levels in LADC lesions, but, importantly, the reduction in c-Myc protein levels appears to be significantly more pronounced in LSCC (Figure 2E). Moreover, Usp28 ablation has a marginal effect, if any, on apoptotic cell death (cleaved caspase-3; CC3). Thus, the modest decrease in Usp28 substrates and the failure to induce cleaved caspase-3 could explain the modest effect in LADC tumours. We have added a paragraph in the Results section that mentions these characteristics (page 8, lines 2-6).
Authors: D A Fennell; Y Summers; J Cadranel; T Benepal; D C Christoph; R Lal; M Das; F Maxwell; C Visseren-Grul; D Ferry Journal: Cancer Treat Rev Date: 2016-02-04 Impact factor: 12.111
Authors: Zhengyan Kan; Bijay S Jaiswal; Jeremy Stinson; Vasantharajan Janakiraman; Deepali Bhatt; Howard M Stern; Peng Yue; Peter M Haverty; Richard Bourgon; Jianbiao Zheng; Martin Moorhead; Subhra Chaudhuri; Lynn P Tomsho; Brock A Peters; Kanan Pujara; Shaun Cordes; David P Davis; Victoria E H Carlton; Wenlin Yuan; Li Li; Weiru Wang; Charles Eigenbrot; Joshua S Kaminker; David A Eberhard; Paul Waring; Stephan C Schuster; Zora Modrusan; Zemin Zhang; David Stokoe; Frederic J de Sauvage; Malek Faham; Somasekar Seshagiri Journal: Nature Date: 2010-07-28 Impact factor: 49.962
Authors: Ethan Cerami; Jianjiong Gao; Ugur Dogrusoz; Benjamin E Gross; Selcuk Onur Sumer; Bülent Arman Aksoy; Anders Jacobsen; Caitlin J Byrne; Michael L Heuer; Erik Larsson; Yevgeniy Antipin; Boris Reva; Arthur P Goldberg; Chris Sander; Nikolaus Schultz Journal: Cancer Discov Date: 2012-05 Impact factor: 39.397
Authors: Mikael Altun; Holger B Kramer; Lianne I Willems; Jeffrey L McDermott; Craig A Leach; Seth J Goldenberg; K G Suresh Kumar; Rebecca Konietzny; Roman Fischer; Edward Kogan; Mukram M Mackeen; Joanna McGouran; Svetlana V Khoronenkova; Jason L Parsons; Grigory L Dianov; Benjamin Nicholson; Benedikt M Kessler Journal: Chem Biol Date: 2011-11-23
Authors: Markus E Diefenbacher; Atanu Chakraborty; Sophia M Blake; Richard Mitter; Nikita Popov; Martin Eilers; Axel Behrens Journal: Cancer Res Date: 2015-02-25 Impact factor: 12.701
Authors: Henry James Benns; Ceire Joanne Wincott; Edward William Tate; Matthew Andrew Child Journal: Curr Opin Chem Biol Date: 2020-08-05 Impact factor: 8.822
Authors: Anne Clancy; Claire Heride; Adán Pinto-Fernández; Hannah Elcocks; Andreas Kallinos; Katherine J Kayser-Bricker; Weiping Wang; Victoria Smith; Simon Davis; Shawn Fessler; Crystal McKinnon; Marie Katz; Tim Hammonds; Neil P Jones; Jonathan O'Connell; Bruce Follows; Steven Mischke; Justin A Caravella; Stephanos Ioannidis; Christopher Dinsmore; Sunkyu Kim; Axel Behrens; David Komander; Benedikt M Kessler; Sylvie Urbé; Michael J Clague Journal: J Cell Biol Date: 2021-03-01 Impact factor: 10.539
Authors: E Josue Ruiz; Markus E Diefenbacher; Jessica K Nelson; Rocio Sancho; Fabio Pucci; Atanu Chakraborty; Paula Moreno; Alessandro Annibaldi; Gianmaria Liccardi; Vesela Encheva; Richard Mitter; Mathias Rosenfeldt; Ambrosius P Snijders; Pascal Meier; Marco A Calzado; Axel Behrens Journal: J Exp Med Date: 2019-01-14 Impact factor: 14.307
Authors: E Josue Ruiz; Adan Pinto-Fernandez; Andrew P Turnbull; Linxiang Lan; Thomas M Charlton; Hannah C Scott; Andreas Damianou; George Vere; Eva M Riising; Clive Da Costa; Wojciech W Krajewski; David Guerin; Jeffrey D Kearns; Stephanos Ioannidis; Marie Katz; Crystal McKinnon; Jonathan O'Connell; Natalia Moncaut; Ian Rosewell; Emma Nye; Neil Jones; Claire Heride; Malte Gersch; Min Wu; Christopher J Dinsmore; Tim R Hammonds; Sunkyu Kim; David Komander; Sylvie Urbe; Michael J Clague; Benedikt M Kessler; Axel Behrens Journal: Elife Date: 2021-10-12 Impact factor: 8.140
Authors: May Zaw Thin; Theodore Evan; Jessica K Nelson; Steven Howell; Mary Wu; Bruna Almeida; Nathalie Legrave; Duco S Koenis; Gabriela Koifman; Yoichiro Sugimoto; Miriam Llorian Sopena; James MacRae; Emma Nye; Michael Howell; Ambrosius P Snijders; Andreas Prachalias; Yoh Zen; Debashis Sarker; Axel Behrens Journal: Nat Commun Date: 2022-04-19 Impact factor: 17.694
Authors: Cristian Prieto-Garcia; Oliver Hartmann; Michaela Reissland; Fabian Braun; Süleyman Bozkurt; Nikolett Pahor; Carmina Fuss; Andreas Schirbel; Christina Schülein-Völk; Alexander Buchberger; Marco A Calzado Canale; Mathias Rosenfeldt; Ivan Dikic; Christian Münch; Markus E Diefenbacher Journal: Mol Oncol Date: 2022-04-30 Impact factor: 7.449
Authors: Hannah B L Jones; Raphael Heilig; Simon Davis; Roman Fischer; Benedikt M Kessler; Adán Pinto-Fernández Journal: Int J Mol Sci Date: 2022-03-17 Impact factor: 5.923