Literature DB >> 34591845

A CENH3 mutation promotes meiotic exit and restores fertility in SMG7-deficient Arabidopsis.

Claudio Capitao1, Sorin Tanasa2,3, Jaroslav Fulnecek2, Vivek K Raxwal2, Svetlana Akimcheva1, Petra Bulankova1, Pavlina Mikulkova2, Lucie Crhak Khaitova2, Manikandan Kalidass4, Inna Lermontova4, Ortrun Mittelsten Scheid1, Karel Riha2.   

Abstract

Meiosis in angiosperm plants is followed by mitotic divisions to form multicellular haploid gametophytes. Termination of meiosis and transition to gametophytic development is, in Arabidopsis, governed by a dedicated mechanism that involves SMG7 and TDM1 proteins. Mutants carrying the smg7-6 allele are semi-fertile due to reduced pollen production. We found that instead of forming tetrads, smg7-6 pollen mother cells undergo multiple rounds of chromosome condensation and spindle assembly at the end of meiosis, resembling aberrant attempts to undergo additional meiotic divisions. A suppressor screen uncovered a mutation in centromeric histone H3 (CENH3) that increased fertility and promoted meiotic exit in smg7-6 plants. The mutation led to inefficient splicing of the CENH3 mRNA and a substantial decrease of CENH3, resulting in smaller centromeres. The reduced level of CENH3 delayed formation of the mitotic spindle but did not have an apparent effect on plant growth and development. We suggest that impaired spindle re-assembly at the end of meiosis limits aberrant divisions in smg7-6 plants and promotes formation of tetrads and viable pollen. Furthermore, the mutant with reduced level of CENH3 was very inefficient haploid inducer indicating that differences in centromere size is not the key determinant of centromere-mediated genome elimination.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34591845      PMCID: PMC8509889          DOI: 10.1371/journal.pgen.1009779

Source DB:  PubMed          Journal:  PLoS Genet        ISSN: 1553-7390            Impact factor:   5.917


Introduction

A sexual life cycle consisting of alternating haploid and diploid life forms is the defining feature of eukaryotes. Entry into the haploid phase requires meiosis, a reductional cell division that forms four haploid cells from a single diploid precursor. It involves segregation of homologous chromosomes in the first meiotic division that is followed, without intervening DNA replication, by segregation of sister chromatids in the second meiotic division. In contrast to the mitotic cell division machinery, meiosis requires mechanisms for tethering homologous chromosomes via recombination in prophase I, sister kinetochore monoorientation and protection of centromeric cohesion in metaphase-anaphase I, and inhibition of DNA replication in interkinesis [1,2]. While the sequence of meiotic events is evolutionally highly conserved, regulation of meiosis and its position in the context of the life cycle differ across diverse phylogenetic units [3,4]. Meiosis in angiosperm plants occurs in megaspore and pollen mother cells located in pistils and anthers, respectively, and leads to the formation of haploid spores. Rudimentary multicellular gametophytes carrying male and female gametes are formed by subsequent mitotic divisions. A number of genes involved in induction, progression, and termination of the meiotic program have been identified in plants. Genes required for meiotic fate acquisition and progression through early meiotic events include the transcription factor SPOROCYTELESS, RNA binding protein MEL2, AMEIOTIC1/SWITCH1, and RETINOBLASTOMA RELATED1 [5-9]. Redox status and small-RNA-mediated gene silencing have also been implicated in establishing meiotic cell fate [10-12]. Entry into meiosis is further accompanied by the induction of genes required for core meiotic functions [13,14]. Progression through the meiotic cell cycle is driven by cyclin dependent kinases (CDKs), in Arabidopsis mainly by CDKA;1, the key CDK that is also required for mitosis [15]. CDKA;1 plays a role in regulating meiotic spindle organization, cytokinesis, as well as recombination and chromosome pairing [16-18]. CDKA;1 activity is modulated by several mechanisms to implement the meiotic program. CDK substrate specificity is determined through association with different cyclins. Several A- and B- type cyclins are expressed in Arabidopsis pollen mother cells (PMCs) [19] and CDKA;1 was found to interact with at least three of them. SOLO DANCERS (SDS) is a meiosis-specific cyclin that mediates phosphorylation of the chromosome axis assembly factor ASYNAPTIC 1 (ASY1) and is essential for homologous recombination and pairing [16,20]. A-type cyclin TARDY ASYNCHRONOUS MEIOSIS (TAM) and CYCB3;1 have been implicated in organization of the meiotic spindle and regulation of cell wall formation [16,19,21,22]. An important aspect of meiosis is the absence of S-phase in interkinesis between meiosis I and II. In yeasts and mammals, this is achieved via partial inhibition of the anaphase promoting complex (APC/C) after anaphase I, which results in residual CDK activity in interkinesis to prevent DNA replication. A similar mechanism was also suggested in Arabidopsis, where inactivation of the APC/C inhibitor OMISSION OF SECOND DIVISION 1 (OSD1) leads to premature meiotic exit after meiosis I [23,24]. Two genes have been implicated in terminating the meiotic program and enabling the transition to gametophytic development in Arabidopsis. THREE DIVISION MUTANT1 (TDM1)/MS5/POLLENLESS3 is a plant-specific gene that is exclusively expressed in meiocytes, and loss of its function results in male sterility [25-28]. Mutant PMCs fail to exit meiosis and the chromosomes of the haploid nuclei re-condense, nucleate four spindles, and attempt to undergo a third division [25,29]. Another gene required to terminate meiosis is SUPPRESSOR WITH MORPHOGENETIC EFFECTS ON GENITALIA7 (SMG7), an evolutionary conserved protein involved in nonsense-mediated RNA decay (NMD). Arabidopsis smg7-null mutants are NMD-deficient, exhibit stunted growth due to an upregulated immune response, and are infertile [30,31]. The infertility is caused by meiotic arrest in anaphase II and inability to exit meiosis. Analysis of plants with a hypomorphic smg7-6 allele that contains a T-DNA insertion in the diverged C-terminal domain of the gene indicate that the meiotic function of SMG7 is not connected to its role in NMD [32], but the mechanism of its action in meiosis remains unknown. We reasoned that mutations that restore fertility and increase pollen count in smg7-6 mutants might help identify genes that affect meiotic exit in Arabidopsis and therefore performed a genetic suppressor screen in this background. We identified two suppressor lines with a mutation in the CENH3 gene, which encodes the centromeric variant of histone H3. This mutation does not alter the amino acid sequence of the protein but leads to inefficient splicing of CENH3 mRNA and a substantial reduction of CENH3 protein levels. We describe the consequences of decreased CENH3 for meiosis, mitosis, and centromere-mediated induction of haploid plants.

Results

Meiosis in smg7-6 PMCs is followed by multiple rounds of spindle reassembly prior to polyad formation

The multiple functions of Arabidopsis SMG7 were described in our previous studies of an allelic series of T-DNA insertion mutants in this gene [32]. The smg7-1 and smg7-3 alleles, disrupted in the conserved central domain, are NMD-deficient and exhibit retarded growth and defects in leaf development and shoot branching (S1 Fig). In addition, smg7-1 and smg7-3 mutants are completely sterile (Fig 1A)[30]. In contrast, smg7-6 mutants, which contain a T-DNA insertion downstream of the conserved central domain, grow normally and are only mildly deficient in NMD [31](S1 Fig). Nevertheless, fertility is strongly reduced in early flowers of smg7-6 plants, but, in contrast to smg7-1 and smg7-3, some seeds are produced from late flowers. Anthers of these flowers have approximately 10-times less viable pollen than wild type (Fig 1A). We noticed that seed production is approximately halved upon pollination of smg7-6 mutants with wild type pollen indicating that the female gametophyte is also affected (S2 Fig). Because the smg7-6 phenotype differed from the one detected in smg7-1, we transformed the mutant with the wild-type SMG7 gene construct. This complementation restored pollen production and confirmed that the reduced fertility is indeed caused by the smg7-6 allele (S3 Fig).
Fig 1

Aborted pollen development in smg7-6 mutants.

(A) Anthers of indicated mutants after Alexander staining. Viable pollen stain red. (B) Anther loculi in telophase II (Col-0, smg7-6 left panel) and assumed aberrant anaphase II (smg7-6, middle panel) stained with DAPI. Scale bar corresponds to 20 μm. (C) Alexander staining of pollen produced by the indicated mutants. The qrt1-2 mutation causes pollen from one tetrad to remain together. (D) Percentage of tetrads with one, two, three, four or no viable pollen. 245 tetrads from qrt1-2 smg7-6 plants were counted.

Aborted pollen development in smg7-6 mutants.

(A) Anthers of indicated mutants after Alexander staining. Viable pollen stain red. (B) Anther loculi in telophase II (Col-0, smg7-6 left panel) and assumed aberrant anaphase II (smg7-6, middle panel) stained with DAPI. Scale bar corresponds to 20 μm. (C) Alexander staining of pollen produced by the indicated mutants. The qrt1-2 mutation causes pollen from one tetrad to remain together. (D) Percentage of tetrads with one, two, three, four or no viable pollen. 245 tetrads from qrt1-2 smg7-6 plants were counted. Previous cytogenetic analysis performed on dissected smg7-6 meiocytes showed PMCs seemingly arrested in anaphase II, as well as meiocytes that reached telophase II [32]. This observation can be interpreted as a reduced penetrance of the smg7-null phenotype in mutants with this allele, allowing occasional continuation into normal pollen development. If this were the case, one anther should contain a mixture of aberrant and normal meiocytes. To test this, we performed cytogenetic analysis of meiocytes in entire anthers. In contrast to our prediction, we observed anthers in which all meiocytes resembled aberrant anaphase II, as well as anthers with all meiocytes in telophase II (Fig 1B). This suggests that all meiocytes in smg7-6 plants are able to reach telophase II and that the residual fertility cannot be attributed to the reduced penetrance of the phenotype observed in smg7-1 mutant. To analyze pollen derived from the same meiocyte, we took advantage of the Arabidopsis qrt1 mutant that is deficient in post-meiotic pollen separation, resulting in pollen tetrads that remain tethered together. Analysis of qrt1-2 smg7-6 double mutants showed that tetrads mainly consisted of one viable and three aborted pollen (Fig 1C and 1D), eliminating the possibility that viable pollen originated from a bypass of anaphase II arrest and continuation of normal pollen development for all four products. We next performed immunocytogenetic analysis of dissected smg7-6 meiocytes stained with an α-tubulin antibody. We detected meiocytes containing four separate spindles, each attached to approximately five chromatids (Fig 2A). This phenotype resembles tdm1 mutants, where haploid nuclei re-enter a third division without preceding DNA replication (Fig 2A). Nevertheless, tdm1 and smg7-6 mutations have slightly different phenotypes. In contrast to smg7-6 plants, tdm1 mutants are infertile and do not form any pollen (S4A Fig). We have also noticed that chromatids in tdm1 mutants condense only partially during the aberrant post-meiotic division, while they fully condense in smg7-6 plants (Fig 2B). tdm1 is epistatic to smg7-6 as tdm1 smg7-6 double mutants are infertile and exhibit partially condensed chromosomes during the third meiotic division (S4B Fig).
Fig 2

Meiosis in smg7 and tdm1 mutants.

(A) Immunodetection of spindles using anti-α-tubulin antibody (red) in pollen mother cells. DNA is counterstained by DAPI (blue). AII—anaphase II, TII—telophase II, MIII—metaphase III, AIII—anaphase III. (B) Structure of chromosomes counterstained by DAPI in the third meiotic division.

Meiosis in smg7 and tdm1 mutants.

(A) Immunodetection of spindles using anti-α-tubulin antibody (red) in pollen mother cells. DNA is counterstained by DAPI (blue). AII—anaphase II, TII—telophase II, MIII—metaphase III, AIII—anaphase III. (B) Structure of chromosomes counterstained by DAPI in the third meiotic division. To gain more insights into meiotic progression in smg7-6 plants, we performed time-lapse analysis of PMCs using fluorescently labelled tubulin [22,33]. In wild type, microtubules undergo two rounds of spindle formation in meiosis I and meiosis II, separated by spindle disassembly in interkinesis (Fig 3A and 3B; S1 Movie). By tracking spindle formation, we determined the duration of metaphase I to telophase II, interkinesis, and metaphase II to telophase II in wild type to be 46, 38, and 39 min, respectively, with cytokinesis ensuing 203 min after meiosis II spindle disassembly (average values from 5 meiocytes). PMCs in smg7-6 mutants underwent up to four additional cycles of spindle assembly and disassembly beyond meiosis II (Fig 3A and 3C; S2 and S3 Movies). We also noticed that meiosis I and II in smg7-6 plants were extended to an average of 66 and 67 min, respectively (n = 5 meiocytes; Fig 3B). While the interkinesis II that preceded meiosis III was relatively brief (32 min), interkinesis in subsequent cycles were substantially longer (Fig 3B).
Fig 3

Live imaging of meiotic progression in smg7-6 PMCs.

(A) Time-lapse series of PMCs containing microtubules labeled with the pRPS5A::TagRFP:TUB4 construct. Timepoints relate to nuclear envelope breakdown at the end of prophase I. Scale bars correspond to 5 μm. (B) Duration of indicated meiotic stages inferred from spindle dynamics in time-lapse movies of pRPS5A::TagRFP:TUB4. Five individual PMCs from each wild type and smg7-6 plants are shown. (C) Duration of postmeiotic cycles of spindle assembly and disassembly in individual PMCs from two separate anther lobes of smg7-6 mutants.

Live imaging of meiotic progression in smg7-6 PMCs.

(A) Time-lapse series of PMCs containing microtubules labeled with the pRPS5A::TagRFP:TUB4 construct. Timepoints relate to nuclear envelope breakdown at the end of prophase I. Scale bars correspond to 5 μm. (B) Duration of indicated meiotic stages inferred from spindle dynamics in time-lapse movies of pRPS5A::TagRFP:TUB4. Five individual PMCs from each wild type and smg7-6 plants are shown. (C) Duration of postmeiotic cycles of spindle assembly and disassembly in individual PMCs from two separate anther lobes of smg7-6 mutants. These observations indicate that smg7-6 plants are unable to complete meiosis by regular cytokinesis. Instead, after meiosis II, smg7-6 PMCs undergo several cycles of spindle assembly/disassembly and chromatin condensation/decondensation, leading to an unequal distribution of chromatin and formation of polyads that only exceptionally form functional haploid microspores and pollen. We did not detect any aneuploids among 19 cytologically scored progeny of smg7-6 self-pollinated plants indicating that the majority of viable pollen do not contain supernumerary chromosomes. This indicates that the viable pollen are not derived from stochastic clustering of chromosomes, but rather represent events where the original set of chromosomes remained associated throughout the cycles of chromatin condensation and decondensation.

Suppressor screening results in mutations that recover fertility of smg7-6 plants

SMG7 and TDM1 are important elements of a regulatory network that governs meiotic exit in Arabidopsis [29]. To uncover additional genes and molecular processes required for transition from meiosis to pollen differentiation, we performed a forward genetic screen for mutants that restore the fertility of smg7-6 plants. The screen is based on a characteristic feature of smg7-6 mutants: the first 20–25 flowers on the main inflorescence bolt are infertile and only later flowers give rise to seeds (Fig 4A and 4B). Interestingly, pollen production and ability to form seeds are reduced to a similar extend in all flowers, indicating that increased fertility in late flowers is not caused by changes in the meiotic program during plant aging, but rather by unknown physiological factors that affect pollination or fertilization (S2 Fig and Fig 4C and 4D). In the screen, we scored plants from the M2 population of ethyl-methanesulfonate (EMS)-mutagenized smg7-6 plants and selected suppressor lines that produced seeds from the first 20 flowers on the main inflorescence bolt. Two suppressor lines, EMS30 and EMS155, are characterized in detail in this study.
Fig 4

Characterization of the EMS30 and EMS155 suppressor lines.

(A) Five week-old plants of indicated genotypes. (B) Analysis of silique length along the main inflorescence bolt in wild type (n = 16), smg7-6 (n = 15), EMS30 (n = 16), EMS155 (n = 15) and cenh3-4 (n = 16) plants. Position 1 corresponds to the oldest and position 40 to the youngest silique scored on the main bolt. Error bars represent standard deviations. (C) Anthers of indicated lines after Alexander staining. (D) Number of viable pollen per anther from flowers at positions 5–15 and 25–35 along the main inflorescence bolt. Error bars represent standard deviations (n = 9).

Characterization of the EMS30 and EMS155 suppressor lines.

(A) Five week-old plants of indicated genotypes. (B) Analysis of silique length along the main inflorescence bolt in wild type (n = 16), smg7-6 (n = 15), EMS30 (n = 16), EMS155 (n = 15) and cenh3-4 (n = 16) plants. Position 1 corresponds to the oldest and position 40 to the youngest silique scored on the main bolt. Error bars represent standard deviations. (C) Anthers of indicated lines after Alexander staining. (D) Number of viable pollen per anther from flowers at positions 5–15 and 25–35 along the main inflorescence bolt. Error bars represent standard deviations (n = 9). Both lines produce seeds and substantially longer siliques from early flowers, although the siliques are still shorter than in wild type (Fig 4A and 4B). They also generate about 250 viable pollen per anther, which is six times more than smg7-6 plants and approximately half of that in wild type (Fig 4C and 4D). While cytogenetic analysis revealed some meiocytes still undergoing a third meiotic division (Fig 5A), their abundance substantially decreased in comparison with smg7-6 mutants (Fig 5B). Whole anther staining showed a number of meiocytes forming tetrads, while only a relatively small fraction exhibited the aberrant post-meiotic divisions (Fig 5C). Therefore, the aberrant exit from meiosis in smg7-6 PMCs is at least partially suppressed in the double mutants, resulting in a relatively high level of correct tetrad formation and improved seed set.
Fig 5

Meiotic progression in the EMS30 line.

(A) Immunocytological analysis of EMS30 PMCs with spindles visualized with anti-α-tubulin antibody (red). DNA is counterstained with DAPI (blue). MI, MII, MIII—metaphase I, II, III; AI, AII, AIII—anaphase I,II, III; TII—telophase II. Scale bar represents 5 μm. (B) Anther loculi stained with DAPI. Wild type and smg7-6 loculi contain tetrads and polyads, respectively. EMS30 plants contain tetrads (middle panel) and a mixture of polyads, tetrads, and AIII in their loculi (right panel). The inset shows a detail of a PMC in the MIII/AIII stage. Scale bar represents 20 μm. (C) Quantification of PMCs in late stages of meiosis. Number of PMCs analyzed for each genotype is indicated in parentheses.

Meiotic progression in the EMS30 line.

(A) Immunocytological analysis of EMS30 PMCs with spindles visualized with anti-α-tubulin antibody (red). DNA is counterstained with DAPI (blue). MI, MII, MIII—metaphase I, II, III; AI, AII, AIII—anaphase I,II, III; TII—telophase II. Scale bar represents 5 μm. (B) Anther loculi stained with DAPI. Wild type and smg7-6 loculi contain tetrads and polyads, respectively. EMS30 plants contain tetrads (middle panel) and a mixture of polyads, tetrads, and AIII in their loculi (right panel). The inset shows a detail of a PMC in the MIII/AIII stage. Scale bar represents 20 μm. (C) Quantification of PMCs in late stages of meiosis. Number of PMCs analyzed for each genotype is indicated in parentheses.

Restored fertility is caused by mutation in CENH3

To identify the mutations responsible for the restored fertility, we created mapping populations by backcrossing EMS30 and EMS155 lines to the parental smg7-6. The restored fertility phenotype segregated as a recessive trait. EMS-induced de novo mutations were identified by comparing genome sequencing data from pools of fertile B2 plants with the parental smg7-6 genome using the ArtMAP mapping algorithm [34]. Although EMS30 and EMS155 contained different de novo mutations distributed throughout their genomes, they shared one identical polymorphism in the CENH3 gene at the end of the left arm of chromosome 1 (S5 Fig). The mutation was present with 100% frequency in the pools with DNA from fertile plants in the B2 populations derived from EMS30 and EMS155 lines. In both cases, the mutation represents a G to A transition in the splicing donor site of the 3rd exon of the CENH3 gene (Fig 6A). It is a silent mutation that does not alter amino acid sequence. Since this mutation was uncovered independently in two suppressor lines that do not share any other de novo polymorphism, we consider this mutation to be responsible for the restored fertility of smg7-6 and refer to it as the cenh3-4 allele.
Fig 6

Molecular characterization of the cenh3-4 allele.

(A) Diagram of the CENH3 gene with exons marked as boxes. DNA sequence surrounding the intron 3 is shown; capital letters depict exons. Amino acids encoded by canonically spliced mRNA are indicated. The cenh3-4 mutation at the splice donor site of exon 3 is indicated in red, stop codon in the intron of unspliced mRNA in blue. (B) Relative abundance of spliced and unspliced CENH3 mRNA determined by quantitative RT-PCR. Two sets of primers were designed for fully spliced mRNA matching either wild type (CENH3-G) or cenh3-4 (CENH3-A) allele sequences. (C) Western blot detection of total CENH3 protein by anti-CENH3 antibody. Protein loading is shown on a Ponceau-S stained membrane (bottom panel). (D) Abundance of SMG7 mRNA relative to wild type determined by qRT-PCR. (E) NMD efficiency assessed by qRT-PCR analysis of alternatively spliced variants of the AT2G45670 gene with or without a premature termination codon (PTC) relative to wild type. Error bars in (B), (D) ad (E) represent standard deviations from 3 biological replicas.

Molecular characterization of the cenh3-4 allele.

(A) Diagram of the CENH3 gene with exons marked as boxes. DNA sequence surrounding the intron 3 is shown; capital letters depict exons. Amino acids encoded by canonically spliced mRNA are indicated. The cenh3-4 mutation at the splice donor site of exon 3 is indicated in red, stop codon in the intron of unspliced mRNA in blue. (B) Relative abundance of spliced and unspliced CENH3 mRNA determined by quantitative RT-PCR. Two sets of primers were designed for fully spliced mRNA matching either wild type (CENH3-G) or cenh3-4 (CENH3-A) allele sequences. (C) Western blot detection of total CENH3 protein by anti-CENH3 antibody. Protein loading is shown on a Ponceau-S stained membrane (bottom panel). (D) Abundance of SMG7 mRNA relative to wild type determined by qRT-PCR. (E) NMD efficiency assessed by qRT-PCR analysis of alternatively spliced variants of the AT2G45670 gene with or without a premature termination codon (PTC) relative to wild type. Error bars in (B), (D) ad (E) represent standard deviations from 3 biological replicas. By backcrossing the mutant suppressor line with wild type, selfing the progeny, and genotyping in the F2, we also generated a line which carries the cenh3-4 allele independent from the smg7-6 mutation. As a single or double mutant, the cenh3-4 mutation causes inefficient splicing and retention of the third intron, which results in an approximately 10-fold reduction of fully spliced CENH3 mRNA (Fig 6B). We used two combinations of primers matching either wild type (CENH3-G) or mutant (CENH3-A) cDNA to ascertain that the observed reduction is due to lower level of spliced CENH3 mRNA and not because of inefficient RT-PCR amplification (Fig 6B). Since the mis-spliced mRNA encodes a short open reading frame comprising only the first 32 amino acids of CENH3 (Fig 6A), cenh3-4 plants have a substantially decreased amount of CENH3 protein (Fig 6C). The cenh3-4 mutation does not affect expression of SMG7 mRNA or the efficiency of NMD, as the abundance of an endogenous transcript containing a premature termination codon is not altered (Fig 6D and 6E). CENH3 is a histone H3 variant that is specifically localized to centromeres. In Arabidopsis, CENH3 is loaded onto centromeres during G2 and remains there throughout the cell cycle [35]. To determine whether CENH3 is present on centromeric chromatin in cenh3-4 mutants, we performed immunolocalization using a CENH3 antibody. In wild type, we readily detected ten discrete dots in tapetum nuclei that likely correspond to ten centromeres, and approximately five pronounced dots in pachytene meiocytes that reflect synapsed centromeres of paired homologous chromosomes (Fig 7A and S6 Fig). In contrast, no signals were detected when we used the same imaging conditions in cenh3-4 mutants (S6 Fig). Substantially increasing the exposure time revealed weak fluorescence at DAPI-dense regions, indicating limiting amounts of CENH3 at the centromeres (Fig 7A). A substantial reduction of the CENH3 was also observed on centromeres in root and leaf nuclei of cenh3-4 mutants (S7 Fig). This was further validated by chromatin immunoprecipitation in seedlings that showed association of CENH3 with the Arabidopsis centromeric satellite repeat CEN180 in cenh3-4 plants, albeit at a lower level compared to wild type (Fig 7B and 7C). Thus, the cenh3-4 mutation substantially reduces the amount of CENH3 in centromeric chromatin.
Fig 7

Effect of cenh3-4 mutation on the localization of CENH3 on Arabidopsis centromeres.

(A) Immunodetection of CENH3 in PMCs and tapetum cells using α-CENH3 antibody (green); DNA is counterstained with DAPI (blue). Longer exposure times for EMS30, EMS155, and cenh3-4 were applied to detect the signal. Scale bar corresponds to 5 μm. (B) Association of CENH3 with the CEN180 satellite repeat determined by chromatin immunoprecipitation with CENH3 antibody and dot blot hybridization. Antibody against histone H3 was used as a control. (C) Quantification of the CEN180 repeat in the ChIP experiments by qPCR. Error bars represent standard deviation of three technical replicates. Three independent experiments are presented.

Effect of cenh3-4 mutation on the localization of CENH3 on Arabidopsis centromeres.

(A) Immunodetection of CENH3 in PMCs and tapetum cells using α-CENH3 antibody (green); DNA is counterstained with DAPI (blue). Longer exposure times for EMS30, EMS155, and cenh3-4 were applied to detect the signal. Scale bar corresponds to 5 μm. (B) Association of CENH3 with the CEN180 satellite repeat determined by chromatin immunoprecipitation with CENH3 antibody and dot blot hybridization. Antibody against histone H3 was used as a control. (C) Quantification of the CEN180 repeat in the ChIP experiments by qPCR. Error bars represent standard deviation of three technical replicates. Three independent experiments are presented. CENH3 forms a hub for binding kinetochore proteins during chromosome segregation. Therefore, we next performed immunolocalization in cenh3-4 nuclei for CENP-C and MIS12, key proteins of the inner kinetochore complex [36,37], and KNL2, a CENH3 assembly factor [38]. CENP-C, MIS12 and KNL2 signals in cenh3-4 root nuclei were substantially lower than in wild type (Fig 8), suggesting that the decreased amount of CENH3 in the mutant affects the kinetochore structure.
Fig 8

Immunodetection of CENP-C, KNL2 and MIS12 in root nuclei of cenh3-4 and wild type.

DNA is counter-stained with DAPI (blue). Longer exposure times for cenh3-4 were applied to detect a signal. Scale bar = 5 μm.

Immunodetection of CENP-C, KNL2 and MIS12 in root nuclei of cenh3-4 and wild type.

DNA is counter-stained with DAPI (blue). Longer exposure times for cenh3-4 were applied to detect a signal. Scale bar = 5 μm.

cenh3-4 affects mitotic progression and chromosome segregation

Considering the role of CENH3 in chromosome segregation not only during meiosis, but also during the mitotic cell cycle and progression through M-phase, it was striking that the somatic growth of cenh3-4 plants was hardly affected, despite a drastically reduced level of CENH3. Mutant plants are viable, fertile, and do not show any gross growth retardation (Fig 4A). More thorough examination revealed that the roots of plants carrying the cenh3-4 allele grow slower when cultivated on agar plates (Fig 9A and 9B), which is indicative of impaired cell division. To reveal whether mitosis is affected in cenh3-4 plants, we performed live imaging of mitotic progression in root cells expressing the HTA10:RFP chromatin marker [33]. We determined the duration of early mitosis from nuclear envelope breakdown (NEB) through prometaphase to the end of metaphase, and of anaphase from chromatid separation to their arrival at the final position within the dividing cell (Fig 9C). We noticed that the duration of prometaphase/metaphase is approximately twice as long in cenh3-4 mutants as in wild type, whereas anaphase is unaffected (Fig 9D, S4 and S5 Movies, Table 1).
Fig 9

Mitotic defects in cenh3-4 mutants.

(A) Seedlings grown on vertically oriented agar plates for 10 d after germination. (B) Dynamics of root growth on vertical agar plate. Error bars represent standard deviations (n = 17 to 39). (C) An example of mitotic progression in a root cell visualized by the HTA10:RFP marker. Classification of stages whose duration was quantified in Table 1 is indicated. (D) Time-lapse series of mitotic nuclei from wild type and cenh3-4 plants that were treated with 1.5 μM oryzalin (Ory) during the experiment.

Table 1

Duration of mitotic phases in root cells.

NEB was defined as a time point when nuclei lost round shape (Fig 9C). None of the examined cells in cenh3-4 roots treated with oryzalin that entered the mitosis formed a metaphase plate (n = 12).

No oryzalinOryzalin 1.5 μM
Wild typeNEB to anaphase10.0 ± 1.3n = 913.8 ± 2.9n = 13
Anaphase4.2 ± 0.74.2 ± 0.8
No metaphasen. a.n = 0n. a.n = 1
cenh3-4 NEB to anaphase20.8 ± 5.9n = 14n. a.n = 0
Anaphase4.2 ± 0.7n. a.
No metaphasen. a.n = 0n. a.n = 12

Mitotic defects in cenh3-4 mutants.

(A) Seedlings grown on vertically oriented agar plates for 10 d after germination. (B) Dynamics of root growth on vertical agar plate. Error bars represent standard deviations (n = 17 to 39). (C) An example of mitotic progression in a root cell visualized by the HTA10:RFP marker. Classification of stages whose duration was quantified in Table 1 is indicated. (D) Time-lapse series of mitotic nuclei from wild type and cenh3-4 plants that were treated with 1.5 μM oryzalin (Ory) during the experiment.

Duration of mitotic phases in root cells.

NEB was defined as a time point when nuclei lost round shape (Fig 9C). None of the examined cells in cenh3-4 roots treated with oryzalin that entered the mitosis formed a metaphase plate (n = 12). A prolonged prometaphase indicates problems with chromosome biorientation and the formation of a bipolar spindle. Therefore, we next examined whether mitosis in cenh3-4 mutants is sensitive to oryzalin, a dinitroaniline herbicide that disrupts polymerization of microtubules [39]. We found that treatment of roots with 1.5 μM oryzalin has a relatively mild effect on mitotic progression in wild type, causing extension of the prometaphase from 10 to 14 min, which was followed by a normal anaphase (Fig 9D, Table 1, S6 Movie). However, the same concentration of oryzalin inhibited chromosome biorientation and formation of a stable metaphase plate in cenh3-4 mutants. All scored cells entering mitosis remained arrested in prometaphase and did not reach anaphase even after 1 hr of recording (Table 1, S7 Movie). The increased sensitivity to a microtubule inhibitor indicates that association of kinetochores with microtubules is impaired in cenh3-4 plants.

The cenh3-4 allele does not promote the formation of haploid plants in crosses with wild type

Interference with CENH3 function through structural rearrangements in the N-terminal tail or amino acid substitutions in the conserved histone fold domain was shown to induce chromosome elimination and formation of haploid plants in Arabidopsis F1 crosses with wild type [40-43]. Some of the mutations were reported to decrease CENH3 levels, which suggested that downregulation of CENH3 could be sufficient to induce formation of haploid plants upon outcrossing [41,44]. To test this hypothesis, we pollinated cenh3-4 mutants with pollen from trichomeless gl1-1 plants. Haploid plants with this recessive mutant allele would be easily scored by their smooth leaf surface, in contrast to rough leaves in diploid hybrids. Out of 500 F1 plants, we identified only a single haploid plant validated by flow cytometry (S8 Fig). The frequency of haploid offspring (0.2%) in cenh3-4 crosses is much lower than frequencies reported with mutations that alter the CENH3 amino acid sequence [40-43], suggesting that the decreased amount of CENH3 in cenh3-4 mutants is insufficient to trigger uniparental genome elimination in Arabidopsis.

Discussion

Transition from meiosis to post-meiotic differentiation of haploid gametophytes is governed by a dedicated mechanism that requires the nonsense-mediated RNA decay factor SMG7 [30]. So far, the only molecular function assigned to SMG7 was related to NMD, where SMG7 binds to phosphorylated UPF1 via its N-terminal phosphoserine binding domain and mediates re-localization of UPF1-bound RNA to P-bodies [45]. In vertebrates, the C-terminal region of SMG7 further associates with the CCR4-NOT deadenylase to degrade aberrant mRNA. This mechanism also appears to be conserved in plants [46,47]. Nonetheless, two lines of evidence argue that the meiotic function of SMG7 in Arabidopsis is not implemented through NMD. First, Arabidopsis UPF1-deficient plants are more impaired in NMD than SMG7-null mutants [48], but they do not show a meiotic phenotype and produce viable pollen [32]. Second, the hypomorphic smg7-6 allele carrying a T-DNA insertion in the C-terminal region is NMD-proficient, but still exhibits meiotic defects [31,32]. We therefore conclude that SMG7 has an additional role in regulating meiotic exit, at least in the male pathway. We previously proposed that SMG7 directly or indirectly contributes to the downregulation of CDK activity at the end of meiosis [29]. Processes required for chromosome segregation, such as nuclear envelope breakdown, chromosome condensation, and spindle formation are driven by increasing activity of M-phase CDKs. Degradation of M-phase cyclins by the APC/C in anaphase and downregulation of CDKs revert these processes and allow cytokinesis, exit from the M-phase, and licensing of origins of replication for DNA synthesis in the next S-phase [49,50]. If CDK activity is not irreversibly downregulated, untimely chromosome re-condensation, spindle reassembly, and re-initiation of chromosome segregation might be consequences, as seen in tdm1 and smg7-6. The complete lack of pollen in tdm1 versus low numbers of viable pollen grains in smg7-6 could originate from differences in the degree of re-condensation: less condensed chromatin in tdm1 in the third division might preclude the formation of any chromosome cluster that would result in a functional microspore, while slightly stronger chromosome condensation at the respective state in smg7-6 could increase the chance of encapsulating the right chromosome combination for the occasional formation of viable pollen. This residual fertility in smg7-6 permitted a suppressor screen to identify genes whose mutations affect meiotic exit in Arabidopsis and increase production of viable pollen and seeds. Identifying a mutation, twice independently, in the gene for centromeric histone CENH3 that partially rescues infertility of smg7-6 plants came as a surprise. CENH3 is the key determinant of centromeric chromatin and kinetochore assembly. Its inactivation in Arabidopsis is embryonic lethal [40], and RNAi-mediated knock down of CENH3 mRNA to 27–43% of the wild type level was reported to cause dwarfism and severe developmental defects [51]. Although the cenh3-4 mutation leads to a 10-fold reduction of fully spliced CENH3 mRNA and depletion of CENH3 from centromeres, mutant plants do not exhibit growth abnormalities under standard conditions and are fully fertile. Immunolocalization of CENH3 and the inner kinetochore proteins CENP-C and KNL2 suggest that centromeres and kinetochores are smaller in cenh3-4 plants compared to wild type. These data indicate that plants can tolerate a substantial decrease of CENH3 level and centromere size. This has also been shown for centromeres on supernumerary B-chromosomes in maize that retained their functionality despite being trimmed to approximately 100 kb via chromosome fission [52]. How does the decreased level of CENH3 contribute to the restored fertility of smg7-6 plants? The most notable cytological effect of the single cenh3-4 mutant was delayed congression of mitotic chromosomes to the metaphase plate, suggesting less efficient establishment of a stable bipolar spindle. Chromosome congression and the bipolar spindle are formed by a search-and-capture mechanism in which microtubules initially establish lateral contacts with kinetochores that are later transformed into more stable attachments to the plus ends of microtubules [53,54]. The small kinetochores in cenh3-4 mutants may decrease the efficiency of kinetochore-microtubule interaction and increase the time required for spindle formation. Such size-dependent attachment of kinetochores was predicted by computational modelling [54] and supported by the observation that chromosomes with larger kinetochores acquire bi-polar orientation faster than chromosomes with smaller kinetochores [55]. Smaller kinetochores in the cenh3-4 smg7-6 double mutant PMCs could therefore reduce the degree or speed of aberrant meiotic divisions compared to smg7-6 single mutant plants. We propose that inefficient formation of centromere-microtubule interactions hinders spindle reassembly, re-entry into aberrant rounds of chromosome segregation, and thereby allows more efficient formation of viable pollen and higher fertility. Centromere-mediated genome elimination is a promising strategy for inducing haploid plants for various breeding applications [56]. This technology was developed in Arabidopsis where all chromosomes of mutants with structurally altered CENH3 are eliminated upon crossing with wild type [40-42,57]. The underlying mechanism is assumed to be based on postzygotic incompatibility, whereby the parental chromosome set with the structurally altered CENH3 at its centromeres is mitotically unstable and therefore is left behind in early embryonic divisions [40,58,59]. It was hypothesized that CENH3 mutations may impair chromatin loading, forming smaller centromeres that cannot compete with the larger centromeres of the crossing parent [44], causing early loss of chromosomes due to size dimorphism of parental centromeres. Indeed, genome elimination can be induced in crosses between species with centromeres of different size, and by a CENH3 mutation that affects centromere loading [41,44]. Furthermore, haploid plants were generated in crosses with maize heterozygous for a cenh3 null mutation, suggesting that dilution of CENH3 during gametophytic divisions can render centromeres smaller or dysfunctional [60]. However, the substantially reduced level of CENH3 that, according to the immunocytological data, results in smaller centromeres and impaired mitotic spindles, was not efficient in haploid induction, at least in Arabidopsis cenh3-4 mutants. Notably, a comparably low frequency of Arabidopsis haploids was found after reducing the amount of wild-type CENH3 through female gametogenesis in plants heterozygous for the cenh3-1 null mutation [61]. Also in wheat, multiple knock-outs of homeologous CENH3 genes are insufficient to induce haploid plants unless combined with a hypomorphic mutation containing a short deletion in the CENH3 N-terminal domain [62]. Thus, the efficiency of centromere-mediated genome elimination may depend on the extent and combined effects of qualitative and quantitative changes in centromere structure.

Methods

Plant material and growth conditions

Arabidopsis thaliana ecotype Columbia (Col-0) and mutant seeds were grown on soil in growth chambers at 21°C at 50–60% humidity under 16 h/8 h light/dark cycles. The following mutant lines were used in this study: smg7-6 [32], smg7-1, smg7-3 [30], gl1-1 derived from tert line [63]. The tdm1-4 mutant was obtained from NASC (SALK_123139) and PCR-genotyped using PCR primers described in S1 Table. Plants used for live cell imaging were generated by introgression of reporter constructs from HTA10:RFP [33] and pRPS5A::TagRFP:TUB4 [22] lines. Root growth assay was performed by growing surface-sterilized seeds on vertically oriented MS agar plates (0.7% plant agar, Duchefa Biochemie) at 21°C under 16 h/8 h light/dark photoperiods. The position of the root tip was marked 5, 8 and 10 days after germination to determine the root growth rate.

Assessment of plant fertility

Pollen viability was determined by Alexander staining as described [64]. Silique length was measured when apical meristems ceased forming new flowers. Average silique length was calculated at each position for the first 40 siliques along the main inflorescence bolt (numbered with 1 for the oldest and 40 for the youngest silique).

Genetic screening

Seeds from smg7-6 plants were incubated in 50 ml of water at 4°C overnight. Water was replaced with 50 ml of 0.3% (v/v) ethyl-methanesulfonate (EMS) in water and incubated for 8 h at room temperature in the dark with gentle shaking. The EMS solution was replaced with water and the seeds were incubated for 3 days at 4°C in the dark. Twelve seeds were sown per pot (9x9 cm) and M2 seeds were pooled from all plants in one pot. Around 100 M2 seeds from each pool were grown and manually scored for improved fertility compared to smg7-6 mutants grown in parallel. The genetic transmissibility of restored fertility was confirmed in the M3 generation and M3 plants were backcrossed to the parental smg7-6 line to create B2 mapping populations. Inflorescences from segregants with improved fertility in B2 were pooled (at least 50 plants per line) for DNA extraction using the CTAB (cetyltrimethyl ammonium bromide) method [65]. DNA (2 μg) was sheared in a S220 Focused-ultrasonicator (Covaris), DNA fragments were purified using the DNA Clean &Concentrator-5 kit (Zymo Research), and quantified using the Quant-iT PicoGreen dsDNA Reagent (Thermo Fisher Scientific). After analyzing the samples for proper fragmentation (~150 bp) in an Agilent 2100 Bioanalyser System (Agilent Technologies), DNA libraries were prepared using 300 ng of fragmented DNA following the instructions of the NEBNext Ultra II DNA Library Prep kit (New England Biolabs). Samples were sequenced on a HiSeq 2500 (Illumina) with the sequencing output of single ends with 100 nucleotides in size. Mutations associated with improved fertility were identified using ArtMAP software [34]. For further genetic experiments, the identified cenh3-4 mutation was PCR-genotyped by the Derived Cleaved Amplified Polymorphic Sequences (dCAPS) method using primers described in S1 Table. The PCR product was cleaved with PstI and separated in 2% (w/v) high-resolution agarose in TBE buffer. The amplicon of the wild type allele remained uncleaved with a size of 222 bp, while that of the cenh3-4 allele was cut into 188 bp and 34 bp fragments.

Cytology

Staining of PMCs in whole anthers was performed as previously described [66] with the following modifications: inflorescences were fixed in PEM buffer (50 mM Pipes pH 6.9, 5 mM EGTA pH 8.0, 5 mM MgSO4, 0.1% Triton X100) supplemented with 4% formaldehyde by 15 min vacuum infiltration and 45 min incubation at room temperature. Inflorescences were washed 3x with PEM buffer and buds smaller than 0.6 mm were dissected, transferred to 100 μl of PEM supplemented with DAPI (5 μg/ml), and stained for 1 h in the dark. Anthers were washed twice with 1 ml of PEM buffer for 5 min, then incubated in PEM buffer at 60°C for 10 min and at 4°C for 10 min. Anthers were washed once, mounted in Vectashield (Vector Laboratories), covered with cover slips, and examined on an LSM700 or LSM880 confocal microscope (Zeiss). Immunodetection of microtubules in pollen mother cells was performed using rat anti-α-tubulin antibody (Serotec) as previously described [29]. The same protocol was applied to detect CENH3 with a custom-made (LifeTein, https://www.lifetein.com) polyclonal antisera raised against the N-terminal peptide of CenH3 [67] and anti-Rabbit-Alexa Fluor 488 (ThermoFisher Scientific). KNL2, MIS12 and CENP-C were detected in root nuclei as previously described [68] using custom made anti-AtKNL2 (dilution 1:2000) [38], anti-MIS12 (1:1000) or anti-AtCENP-C (1:300) antibodies (http://www.eurogentec.com/) [51] and goat anti-rabbit rhodamine (Jackson Immuno Research Laboratories). DNA content in nuclei of haploid plants was determined by flow cytometry as previously described [69].

Live cell imaging

Live cell imaging of spindles in PMCs was performed with the pRPS5A::TagRFP:TUB4 marker [22] using a protocol developed for light sheet microscopy [33]. Briefly, the floral buds were embedded in 5MS (5% sucrose + ½ MS, Murashige & Skoog Medium including vitamins and MES buffer, Duchefa Biochemie) supplemented with 1% low gelling agarose (Sigma Aldrich) in a glass capillary (size 4, Brand). The capillary was mounted in the metal holder of the Light sheet Z.1 microscope (Zeiss), the agarose with the embedded floral bud was partially pushed out from the glass capillary into the microscopy chamber containing 5MS media, and imaged in Light sheet Z.1 microscope using 10x objective (Detection optics 10x/0.5), single illumination (Illumination Optics 10x/0.2), 561 nm laser (15% intensity) in 5min time increments. The image data were processed by ZEN Blue software (Zeiss). Live cell imaging of mitosis in roots was performed with the HTA10:RFP marker as follows: surface-sterilized seeds were germinated on 1 ml of ½ MS medium with 0.8% phyto-agar (Duchefa Biochemie) in petri dishes with a glass bottom (MatTek corporation). Once growing roots reached the glass bottom, they were imaged with an LSM780 inverted confocal microscope (Zeiss, 40x objective) in 1 min intervals. Two ml of 2 μM oryzalin solution were added to plates 10 min before imaging. Images were processed using Zen Black (Zeiss).

Chromatin immunoprecipitation

ChIP experiments were performed from 10 day old seedlings with chromatin sheared to approximately 500 bp fragments by sonication according to a previously described protocol [70]. Five μl of anti-histone H3 antibody (1 mg/ml; ab1791; Abcam), and 10 μl of anti-CENH3 antibody were used. Detection of centromeric 180 bp satellite DNA was performed by dot-blot hybridization as well as by qPCR. For dot-blot hybridization, 40 μl from 50 μl samples were combined with 10 μl of MILI-Q water and 6 μl of 3 M NaOH, incubated for 1 h at 65°C and dot-blotted on Amersham HybondTM-XL membrane (GE Healthcare). DNA was fixed by UV using a UV crosslinker BLX-254 (Analytik Jena). After prehybridization at 65°C for 2 h in hybridization buffer (7% SDS, 0.25 M sodium-phosphate buffer pH 7.2), membranes were hybridized at 65°C overnight with denatured probes generated by Klenow-labeling of an Arabidopsis centromere 180 bp satellite fragment with α32P dATP (DecaLabel DNA Labeling Kit, Thermo Scientific). The fragment was prepared by PCR amplification of Arabidopsis genomic DNA using the primer combination CEN-1 ATCAAGTCATATTCGACTCCA and CEN-2 CTCATGTGTATGATTGAGAT, followed by purification (NucleoSpin Gel and PCR Clean-up, Macherey-Nagel). Membranes were washed twice with 2x SSC, 0.1% SDS at RT for 5 min and twice with 0.2x SSC, 0.1% SDS at 65°C for 15 min. Membranes were wrapped in Saran wrap and exposed to a phospho-screen which was scanned with a Typhoon FLA 7000 (GE Healthcare). Signals were quantified using ImageQuant software (GE Healthcare). For qPCR quantification, 1 μl from 50 μl samples was used in a 20 μl qPCR reaction containing 1x LightCycler 480 High Resolution Melting Master mix, 3 mM MgCl2, and 0.25 μM of each primer CEN-f CCGTATGAGTCTTTGGCTTTG and CEN-r TTGGTTAGTGTTTTGGAGTCG. Reactions were performed in technical triplicates and quantified as percent of input.

Western blot analysis

For nuclei purification, 300 mg of inflorescences were collected in 15 ml Falcon tubes, frozen in liquid nitrogen, and homogenized with metal beads by vortexing. The disrupted tissue was resuspended in 5 ml of nuclei isolation buffer (NIB) (10 mM MES-KOH pH 5.3, 10 mM NaCl, 10 mM KCl, 250 mM sucrose, 2.5 mM EDTA, 2.5 mM ß-mercaptoethanol, 0.1 mM spermine, 0.1 mM spermidine, 0.3% Triton X-100), and filtered through two layers of Miracloth into a 50 ml Falcon tube. Nuclei were pelleted by centrifugation, resuspended in 1 ml NIB and collected again by centrifugation. The pellet was resuspended in 150 μl of N buffer (250 mM sucrose, 15 mM Tris-HCl pH 7.5, 60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 1 mM CaCl2, 1 mM DTT, 10 mM ß-glycerophosphate, protease inhibitors). Nuclei were lysed by adding 40 μl 5x Laemmli loading buffer (Sigma) and boiling for 5 min. 40 μg of nuclear protein was separated by SDS-polyacrylamide gel electrophoresis. Separated proteins were transferred to PVDF membranes (Thermo Scientific) by electroblotting. The membranes were incubated in low-fat milk with rabbit anti-CENH3 antibody (1:5,000; ab72001; Abcam) for 12 h at 4°C. Secondary anti-rabid-HPR conjugated antibody was diluted (1:5000) and incubated for 2 h. TBST (25 mM Tris-Cl, pH 7.5, 150 mM NaCl, 0.05% Tween-20, pH 7.5) was used to wash the membranes and the signal was detected using ECL Western Blotting Substrate (Pierce).

RNA analysis

RNA was isolated from inflorescences using the RNeasy Plant Mini Kit (Qiagen). Samples were treated with TURBO DNA-free Kit (Ambion) to remove contaminants from genomic DNA. cDNA was synthetized from 5 μg of RNA with the Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Scientific) and oligo (dT)18 primer. cDNA was used as a template for quantitative PCR reactions using the FastStart Essential DNA Green Master (Roche) and transcript-specific primer pairs (S1 Table) on the LightCycler 96 System (Roche). The ΔΔCt method was used to calculate the relative quantification of transcripts [71]. MON1 (AT2G28390) was used as reference gene, and transcript levels for each genotype were normalized to wild type controls.

Live imaging of pRPS5A::TagRFP:TUB4 tubulin marker during the first and second meiotic division in wild a type plant.

(MP4) Click here for additional data file.

Live imaging of pRPS5A::TagRFP:TUB4 tubulin marker during regular meiotic divisions and two postmeiotic spindle reassembly cycles in smg7-6 mutants.

(MP4) Click here for additional data file.

Live imaging of pRPS5A::TagRFP:TUB4 tubulin marker from the 3rd to 6th cycle of spindle reassembly in smg7-6 mutants.

(MP4) Click here for additional data file.

Live imaging of HTA10:RFP chromatin marker during mitosis in a root tip of a wild type plant.

(AVI) Click here for additional data file.

Live imaging of HTA10:RFP chromatin marker during mitosis in a root tip of a cenh3-2 mutant.

(AVI) Click here for additional data file.

Live imaging of HTA10:RFP chromatin marker during mitosis in a oryzalin treated root tip of a wild type plant.

(AVI) Click here for additional data file.

Live imaging of HTA10:RFP chromatin marker during mitosis in a oryzalin treated root tip of a cenh3-2 mutant.

(AVI) Click here for additional data file.

Allelic series of Arabidopsis smg7 mutants.

(A) Five week-old Arabidopsis mutants homozygous for the indicated alleles. (B) Quantitative RT-PCR analysis of SMG7 mRNA from the region located upstream of the T-DNA insertions and of transcripts targeted by NMD in smg7-1 and smg7-6 mutants. Two mRNA splice variants, one containing a premature termination codon (PTC+), were quantified for the AT2G45670 locus. Error bars indicate standard deviations from three biological replicas. (TIF) Click here for additional data file.

Female fertility in smg7-6 mutants.

(A) Siliques from wild type and smg7-6 plants produced by pollination with wild type pollen. Scale bar = 0.5 cm. (B) Box-plot diagrams showing quantification of seed count per silique from wild type (N = 14) and smg7-6 plants pollinated with wild type pollen. Yield from siliques at positions 1 to 15 (N = 136) and 20 to 35 (N = 153) is indicated for smg7-6 mutants. (C) Box-plot diagram showing quantification of seeds in siliques at indicating positions along the main inflorescence bolt with 1 indicating the lowest position. 5 to 14 siliques were counted per position. (TIF) Click here for additional data file.

Genetic complementation of smg7-6 mutation with the endogenous pSMG7::SMG7 gene construct.

Anthers from 10 independent T1 smg7-6 transformants carrying the pSMG7::SMG7 construct with viable pollen detected by Alexander staining. All T1 lines show a restoration of viable pollen. (TIF) Click here for additional data file.

Epistatic analysis of smg7-6 and tdm1-4 mutations.

(A) Anthers of the indicated mutants after Alexander staining. Viable pollen stain red. (B) Meiotic progression in PMCs of smg7-6 tdm1-4 double mutants. Spindles are stained with anti-α-tubulin antibody (red), DNA is counterstained with DAPI. Scale bar corresponds to 5 μm. (TIF) Click here for additional data file.

Association mapping of de novo mutations with the smg7-6 suppressor trait in EMS30 and EMS155 lines.

(A) Genome-wide distribution of de novo mutations and their frequency in fertile B2plants generated from backcrosses of EMS30 and EMS155 lines with parental smg7-6 plants. (B) De novo mutations at the left arm of chromosome 1 in the EMS30 and EMS155 lines. Coordinates of these mutations in TAIR10 annotation are indicated. (TIF) Click here for additional data file.

Immunodetection of CENH3 in prophase I using the same imaging conditions.

CENH3 is visualized with CENH3 antibody; DNA is counterstained with DAPI (blue). Scale bar represents 5 μm. (TIF) Click here for additional data file.

Immunodetection of CENH3 in leaf (A) and root (B) nuclei.

CENH3 is visualized with CENH3 antibody; DNA is counterstained with DAPI (blue). Scale bar represents 5 μm. (TIF) Click here for additional data file.

Haploid plant obtained from the cross between cenh3-2 and gl1-1 Col-0.

(A) The haploid plant (indicated by arrowhead) was recognized based on its trichomeless phenotype. (B) Nuclear content of inflorescence nuclei from the haploid and a parent plant determined by flow cytometry. (TIF) Click here for additional data file.

Primers used in this study.

(XLSX) Click here for additional data file.

Numerical data underlying presented graphs.

(XLSX) Click here for additional data file. 5 May 2021 Dear Prof. Riha, Thank you very much for submitting your Research Article entitled 'A CENH3 mutation promotes meiotic exit and restores fertility in SMG7-deficient Arabidopsis' to PLOS Genetics. The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem and were in agreement that your paper is worthy of consideration, but they raised a number of questions and issues about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a much-revised version. We cannot, of course, promise publication at that time. Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org. If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist. To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool.  PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process. To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder. [LINK] Please do not hesitate to contact us if you have any concerns or questions. Yours sincerely, Ian Henderson Associate Editor PLOS Genetics Claudia Köhler Section Editor: Plant Genetics PLOS Genetics Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: This manuscript describes a mutation in Arabidopsis that has extended mitotic dividions after meiosis in a leaky fashion. When a suppressor screen was performed, what was recovered was a hypomorphic allele of CENH3 due to problems with splicing. Immunostaining of this material showed a reduced amount of CENH3 at centromeres. It was postulated that this circumstance delayed mitotic spindle formation and thus allowed the formation of more tetrads at the end of meiosis than occurs in the original mutation. Tests of haploid induction resulted in only a single individual out of many, which could potentially just be the spontaneous rate in contrast to engineered copies of CENH3 that give higher rates of haploid induction. Others have postulated that haploid induction occurs because of smaller centromere size in the engineered versions but this case is not consistent with that view. The conclusions in the paper follow from the experiments. Minor point: Line 281. The chromosome mentioned in citation 51 does indeed have only 110 kb of canonical centromere sequences. This work was performed before the realization of the epigenetic nature of plant centromeres became known. Subsequent work on this chromosome (Liu et al 2015, PNAS 112: E1263-1271) found that it actually has a de novo centromere elsewhere and the canonical site is not active. The de novo centromere has a CENH3 domain of 288 kb, so that chromosome does indeed have a small centromere. Thus, the point of the authors is still correct. Because this is not a major consideration for the manuscript as a whole, the authors might consider citing instead Jin et al., 2005, Plant Cell 17: 1412-1423. The same chromosome was analyzed in that paper as well and that was also before the realization of epigenetic aspects of plant centromeres. However, a number of small centromeres were examined in this latter manuscript and the amount of CENH3 was semi quantified. Those centromeres all work albeit some have reduced transmission. Reviewer #2: Capitao et al. describe the course of meiosis in the smg7-6 mutant (identified and initially described by them in their previous work). In this mutant, PMCs undergo additional rounds of chromosome condensation and spindle assembly, resulting in meiosis exit problems. The authors then use the smg7-6 mutant in the suppressor screen, using the infertility of the first 20 flowers as a phenotype. This screen resulted in finding two lines that turned out to carry an identical mutation in the CENH3 gene. This mutant allele (called cenh3-2) causes inefficient splicing and retention of the third intron, which translates into a 10-fold decrease in the amount of protein. The authors concluded that this in turn results in a reduction in binding of kinetochore proteins CENP-C and KNL2. The course of meiosis is slightly disturbed in the cenh3-2 mutant, in particular the prometaphase is prolonged, but the fertility (measured as pollen number per anther) remains practically unchanged. Apart from slow root growth and increased sensitivity to oryzalin, a microtubule inhibitor, no changes in the vegetative development of the mutant were observed, which are usually pronounced in lines with a reduced amount of CENH3. This allele was also unable to stimulate the formation of haploid plants, which is also a typical effect of CENH3 level reduction. Overall it is an interesting work worth considering a publication in PLoS Genetics. The work broadens our understanding of the role of CENH3 and centromeres in chromosome segregation and also sheds some light on SMG7 function in meiosis. Elegant microscopic analyses, including experimental assays of the course of meiosis, are also worth noting. However, there are several elements that require further confirmation before the work is published. Major concerns: 1. The suppressor screen used in the study is based on the infertility of the first 20-25 flowers (later flowers are partially fertile) in the smg7-6 mutant. However, the authors admit that pollen production shows a similar reduction in all flowers. The authors suggest that this is due to " unknown physiological factors that affect pollination or fertilization" (line 155). However, differences in the course of male and female meiosis in this mutant are also possible. Pollination influencing factors can come from the stigma or the pollen itself. Therefore, I suggest carrying out a simple experiment with the analysis of seed setting in siliques pollinated with pollen from wild plants and smg7-6 in the first 20 and later flowers. 2. It is not understandable for me why the cenh3-2 mutant does not show any more serious developmental disorders. Decreasing the CENH3 level to the level of 20-30% causes significant phenotypic effects (Lermontova et al. Plant J. 2011), while the authors indicate that the protein level in cenh3-2 corresponds to about 10% of the protein in wild type (and this is confirmed in RT-PCR of which corresponds to the level of the transcript). The authors should check the expression level more carefully by analysing it in vegetative tissues such as rosette leaves (at transcript and/or protein level). 3. In connection with the previous point, it seems necessary to check whether a reduction of CENH3 expression (e.g. in RNAi lines) will also suppress the smg7-6 phenotype. Alternatively, suppression can be checked for other weak CENH3 mutant lines. I assume this team has access to such mutants. 4. Analysis of CENP-C and KNL2 proteins is a nice extension of the proposed hypothesis, however microscope images can hardly be considered as quantitative. Authors should mitigate the conclusions unless they present alternative quantitative analysis of the levels of these proteins bound to centromeres in the cenh3-2 mutant. 5. In line 293 the authors present the hypothesis that smg7-6 phenotype suppression in cenh3-2 is caused by inefficient formation of centromere-microtubule interactions which hinder spindle reassembly. To confirm this hypothesis, it should be enough to reduce the amount of one of the kinetochore proteins, eg KNL2, and see if it also allows for suppression. Can the authors perform such an experiment? Minor points: Line 125: Please specify what genotype the description in this line refers to. Line 182: Please specify: was the double suppressor carrying the two independent suppressor mutations? Please rephrase. Fig. 6: Could you please add colours, especially to fig. B, so the figure is more readable? Reviewer #3: The paper by Capitao et al consists of two parts. In the first, the authors characterize the effect of a hypomorphic mutation at SMG7. In the second part, they isolate and characterize a smg7-6 suppressor that results in low expression of CENH3 and smaller chromosomes. The authors’ conclusion is that smaller centromeres reduce the probability of capturing spindle fibers, thus lengthening the time to bipolar spindle attachment and delaying and hindering the deleterious additional divisions. This is a plausible explanation. Overall, the characterization of mutant and suppressor are done and explained competently. The isolation and characterization of the suppressor is the more interesting part of this paper. The data demonstrate that a ~90% loss of CENH3 expression reduces the centromere size by several folds, but has negligible effects on the growth phenotype of arabidopsis under standard conditions. Conveniently, this reduction has a very weak haploid inducer phenotype and may be inconsistent with the hypothesis that a difference in centromere size will result in haploid induction after hybridization (however, see below). The interaction of cenh3-2 with a spindle function mutation is also very interesting. In conclusion, the topic, the specific findings, and their analysis have both the quality and impact to make this manuscript interesting to a broad audience. Some fixes and improvements are needed. Criticism Major points The smg7-6 phenotype is complex and incompletely characterized. This is not a mortal flaw, but it complicates the analysis of the reduced CENH3 effect. By the way, the reported 1:3 live:dead ratio is unexpected. The figure seems to suggest that this is a frequent event. It needs statistical quantification: are there ever 2:2 events? The 1 viable: 3 dead pollen trait in the tetrad could be due to one spore capturing 5+n chromosomes and depleting the others to be 5-n. Alternatively, the live spore could be the only one that has 5 different chromosomes. Does the progeny display aneuploidy? It makes sense to number the cenh3 mutants progressively with publication. Kuppu (2015) described a cenh3 mutant (A86V), although they did not number it. The cited biorXiv paper by Marimuthu [60] describes a knock-out mutation in CENH3 and calls it 3-3. This should make the mutation described in this manuscript cenh3-4, or alternatively 3-3 if that is 3.-4. L212. The reduced root growth trait could be caused by independent linked mutations. Has the trait been confirmed for both independent instances of the cenh3-2 allele, or for the transheterozygote (cross of two mutants)? Alternatively, it should be complemented by transformation with a wild-type CENH3. The delayed timing explanation for suppression of smg7-6 by cenh3-2 could be better supported if analyzed as shown in Fig.3B,C. I wonder if another explanation for the suppression of smg7-6 is that cenh3-2 centromeres capture fewer spindle fibers and are less likely to be missegregated to a wrong pole or cell. Fig.6. I found the figure unclear. In A, the splice products of wild type and mutant should be described. Have the cDNA’s been sequenced and is the structure of the resulting CENH3 the same as in the wild type? In B, the log relative expression is useful when comparing regulation, but in this case it is not clear, particularly because the text in Results uses a fold estimate. Why not use % mRNA standardized on WT? Why are both mutant and wild-type spliced forms measured in B? Spliced-CENH3-A. Why is a log used in B and not in D and E? Figure 7 and Sup. FigS5. It would be helpful to quantify CENH3 the signals (Fig7 and Sup. FigS5) Figure 8: The KNL2 signals do not show 10 spots as expected in the wild-type. Why? For CENP-C, the cenh3-2 mutant there are more than 10? Why? Discussion: Some may agree with the author’s conclusion that the results provide no support for the Dawe model of centromere size causing haploid induction. However, others may instead conclude that this paper supports such a model because haploid induction was demonstrated. I suppose “it depends” on the definition of haploid induction. To some, 0.2% is nearly background level. To others, it may be a significant signal. So, what is the background level? Is the control result significantly different from the reported rate? Minor points Abstract: the statement of no haploids is contradicted by the data in Results L103: ...mutants, which contain a T-DNA…. domain, grow normally… L107 and other places: accepted usage is “wild-type” as single adjective (the wild-type strain), “wild type” as adjective + noun (the wild type grows tall) L136: metaphase I – telophase II, interkinesis, and metaphase II telophase II in wild type are measured as 46, 38, and 39 min: was this meant to be “metaphase I -to telophase I” or telophase II? If the latter applies, the timing does not make sense. L217: Prometaphase/metaphase duration in cenh3-2 is twice as WT yet the plant inflorescence displays normal growth: this needs an explanation. Table 1. Please define NEB. The legend states that “none of the examined cells….that entered the metaphase formed a metaphase plate”. How would one know that a cell entered metaphase if a metaphase plate was not formed? Fig.2B. Comparison to wild-type pictures should be added. Fig.4. For clarity, it would be better to label the EMS30 and 155 lines with the genotype (smg7-6, cenh3-2). Figure 4B. It shows silique length, but no data on the female fertility (this is in the context of cenh3-2, mutant characterization). Fig.6. There is no doubt that this mutation results in a decreased amount of CENH3. It is not clear, however, how much lower. Is it 20, 10 or 5% of the wild-type amount? The western seems to indicate a quantity of CENH3 lower than that found in the ChIP. The assay and tissue is of course different, but one wonders what is the concentration. Fig.7. A normal young cell in the anther maternal tissue would be more informative than the tapetum, which is typically endopolyploid. Some of the panels in Fig.S5 would be useful to convey the effect of longer exposure time. Panel B did not show up in my download. I saw what could be the same panel in the authors biorXiv preprint. Fig.7. 180bp FISH coupled with CENH3 immuno (immuno-FISH) may be more complete. Discussion: Worth mentioning: the centromere reduction may have a distinct deleterious effect on fitness in nature. Method: did the ChIP analysis include a nuclease treatment? In other words, was it based on nucleosomes? This is an important detail for quantification and should be indicated in the method in addition to the reference [69]. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: Yes Reviewer #2: None Reviewer #3: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No 3 Aug 2021 Submitted filename: Response to Reviewers.docx Click here for additional data file. 16 Aug 2021 Dear Dr Riha, We are pleased to inform you that your manuscript entitled "A CENH3 mutation promotes meiotic exit and restores fertility in SMG7-deficient Arabidopsis" has been editorially accepted for publication in PLOS Genetics. Congratulations! Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made. Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org. In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics! Yours sincerely, Gregory P. Copenhaver Editor-in-Chief PLOS Genetics Claudia Köhler Section Editor: Plant Genetics PLOS Genetics www.plosgenetics.org Twitter: @PLOSGenetics ---------------------------------------------------- Comments from the reviewers (if applicable): Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: I am satisfied with the revision. Reviewer #2: The authors provided additional experiments to answer my and other reviewers’ comments. The manuscript has been significantly improved in comparison to its original version. I have no further suggestions. Reviewer #3: I am satisfied with the authors' response to my criticism and to that of the other reviewers. I wish to add my opinion to the issue of CENH3 depletion and effects. Reviewer 2 raises an interesting question about the apparent discrepancy between Lermontova RNAi experiment and the effect of this mutation, and to the matter of what CENH3 depletion level is compatible with regular mitosis. I am not sure, however, whether adding RNAi experiments to this work would address the matter. RNAi experiments, in my opinion, while they can be very useful, are more difficult to interpret than genetic mutations. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No ---------------------------------------------------- Data Deposition If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website. The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-21-00504R1 More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support. Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present. ---------------------------------------------------- Press Queries If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org. 21 Sep 2021 PGENETICS-D-21-00504R1 A CENH3 mutation promotes meiotic exit and restores fertility in SMG7-deficient Arabidopsis Dear Dr Riha, We are pleased to inform you that your manuscript entitled "A CENH3 mutation promotes meiotic exit and restores fertility in SMG7-deficient Arabidopsis" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work! With kind regards, Agnes Pap PLOS Genetics On behalf of: The PLOS Genetics Team Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom plosgenetics@plos.org | +44 (0) 1223-442823 plosgenetics.org | Twitter: @PLOSGenetics
  69 in total

Review 1.  Un ménage à quatre: the molecular biology of chromosome segregation in meiosis.

Authors:  Mark Petronczki; Maria F Siomos; Kim Nasmyth
Journal:  Cell       Date:  2003-02-21       Impact factor: 41.582

Review 2.  Meiosis: cell-cycle controls shuffle and deal.

Authors:  Adèle L Marston; Angelika Amon
Journal:  Nat Rev Mol Cell Biol       Date:  2004-12       Impact factor: 94.444

3.  Defining the developmental program leading to meiosis in maize.

Authors:  Brad Nelms; Virginia Walbot
Journal:  Science       Date:  2019-04-05       Impact factor: 47.728

4.  Point mutation impairs centromeric CENH3 loading and induces haploid plants.

Authors:  Raheleh Karimi-Ashtiyani; Takayoshi Ishii; Markus Niessen; Nils Stein; Stefan Heckmann; Maia Gurushidze; Ali Mohammad Banaei-Moghaddam; Jörg Fuchs; Veit Schubert; Kerstin Koch; Oda Weiss; Dmitri Demidov; Klaus Schmidt; Jochen Kumlehn; Andreas Houben
Journal:  Proc Natl Acad Sci U S A       Date:  2015-08-20       Impact factor: 11.205

5.  Cetyltrimethyl ammonium bromide (CTAB) DNA miniprep for plant DNA isolation.

Authors:  Joseph D Clarke
Journal:  Cold Spring Harb Protoc       Date:  2009-03

6.  Hypoxia triggers meiotic fate acquisition in maize.

Authors:  Timothy Kelliher; Virginia Walbot
Journal:  Science       Date:  2012-07-20       Impact factor: 47.728

7.  Cloning and characterization of MS5 from Arabidopsis: a gene critical in male meiosis.

Authors:  J Glover; M Grelon; S Craig; A Chaudhury; E Dennis
Journal:  Plant J       Date:  1998-08       Impact factor: 6.417

Review 8.  The evolution of meiotic sex and its alternatives.

Authors:  Ghader Mirzaghaderi; Elvira Hörandl
Journal:  Proc Biol Sci       Date:  2016-09-14       Impact factor: 5.349

9.  The Cdk1/Cdk2 homolog CDKA;1 controls the recombination landscape in Arabidopsis.

Authors:  Erik Wijnker; Hirofumi Harashima; Katja Müller; Pablo Parra-Nuñez; C Bastiaan de Snoo; Jose van de Belt; Nico Dissmeyer; Martin Bayer; Monica Pradillo; Arp Schnittger
Journal:  Proc Natl Acad Sci U S A       Date:  2019-06-04       Impact factor: 11.205

10.  OSD1 promotes meiotic progression via APC/C inhibition and forms a regulatory network with TDM and CYCA1;2/TAM.

Authors:  Laurence Cromer; Jefri Heyman; Sandra Touati; Hirofumi Harashima; Emilie Araou; Chloe Girard; Christine Horlow; Katja Wassmann; Arp Schnittger; Lieven De Veylder; Raphael Mercier
Journal:  PLoS Genet       Date:  2012-07-26       Impact factor: 5.917

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.