Phylogeography of Baryancistrus xanthellus (Siluriformes: Loricariidae), a rheophilic catfish endemic to the Xingu River basin in eastern Amazonia.

Baryancistrus xanthellus (Loricariidae) is an endemic fish species from the Xingu River basin with its life history in the shallow rapid waters flowing over bedrock substrates. In order to investigate the genetic diversity and demographic history of B. xanthellus we analyzed sequence data for one mitochondrial gene (Cyt b) and introns 1 and 5 of nuclear genes Prolactin (Prl) and Ribosomal Protein L3 (RPL3). The analyses contain 358 specimens of B. xanthellus from 39 localities distributed throughout its range. The number of genetically diverged groups was estimated using Bayesian inference on Cyt b haplotypes. Haplotype networks, AMOVA and pairwise fixation index was used to evaluate population structure and gene flow. Historical demography was inferred through neutrality tests and the Extended Bayesian Skyline Plot (EBSP) method. Five longitudinally distributed Cyt b haplogroups for B. xanthellus were identified in the Xingu River and its major tributaries, the Bacajá and Iriri. The demographic analysis suggests that rapids habitats have expanded in the Iriri and Lower Xingu rivers since 200 ka (thousand years) ago. This expansion is possibly related to an increase in water discharge as a consequence of higher rainfall across eastern Amazonia. Conversely, this climate shift also would have promoted zones of sediment trapping and reduction of rocky habitats in the Xingu River channel upstream of the Iriri River mouth. Populations of B. xanthellus showed strong genetic structure along the free-flowing river channels of the Xingu and its major tributaries, the Bacajá and Iriri. The recent impoundment of the Middle Xingu channel for the Belo Monte hydroelectric dam may isolate populations at the downstream limit of the species distribution. Therefore, future conservation plans must consider the genetic diversity of B. xanthellus throughout its range.

Introduction

Loricariidae (sucker-mouth armored catfishes) is easily the most diverse family of catfishes (Siluriformes) with approximately five [1] or six [2] subfamilies, 115 genera and over 1000 species widely distributed throughout the freshwaters of South and Central America [3, 4]. The largest loricariid subfamily, Hypostominae, contains about 45 genera and 491 species [3, 4]. Although species of Hypostominae are morphologically conserved, pigmentation patterns are often highly variable and have been used to distinguish numerous forms at and below the species level. Such variation is often geographically tied to a specific river basin, or sometimes longitudinal stretches within a river basin (e.g., [5]).

Large clearwater river systems draining shield terrains in the Amazon and Orinoco basins hold the highest diversity of Hypostominae. Such rivers have naturally transparent waters due to low suspended sediment loads [6, 7]. The three largest clearwater rivers in the Amazon Basin, the Tocantins, Xingu and Tapajós, respectively, support the largest faunas of Hypostominae (e.g., [8]). Those three basins largely drain the Brazilian Shield uplands. Only their downstream portions lie on the sedimentary terrains of the lowland Amazon, where each river’s channel becomes naturally flooded and forms an estuary-like channel named as “fluvial ria” [9]. Among those three clearwater tributaries, the Xingu River stands out due to the extremely complex and unique channel morphology when flowing over the fractured bedrocks of the Brazilian Shield. Known as Volta Grande do Xingu, this broadly zig-zag sinuous stretch is divided into a network of bedrock channels with numerous rocky rapids [10, 11].

The genus Baryancistrus includes eight described species with three occurring in the Xingu Basin, the endemics Baryancistrus chrysolomus and Baryancistrus xanthellus and the more widely distributed Baryancistrus niveatus. Baryancistrus xanthellus is restricted to where the channels of the Xingu River and its major tributaries, the Iriri and Bacajá, flow over Precambrian igneous and metamorphic rocks [12] of the Brazilian Shield (Fig 1). Commonly known as golden-nugget pleco, this species is recognized by having gold-colored spots on the body and conspicuous yellow bands along the distal margins of the caudal and dorsal fins [13]. Because of its attractive color pattern, this species is highly popular as an ornamental fish [14]. In certain parts of the Xingu Basin, local communities consume B. xanthellus due to its abundance and relatively large adult size (up to 300 mm SL).

Fig 1

Different color patterns present in Baryancistrus xanthellus.

Photographs of live specimens taken right after collection. Not all color morphs are represented in the figure.

Baryancistrus xanthellus is usually found in rapids over rocky substrates that vary in composition and heterogeneity. Specimens have been collected at depths greater than 20 m in flows of moderate to strong velocity. Like most loricariids, B. xanthellus is a nocturnal fish and classified as detritivore, feeding mostly on algae and aufwuchs [13, 15].

It is observed a large variation in pigmentation between populations of B. xanthellus from distinct localities in the Xingu, Iriri and Bacajá rivers. Several colour patterns are distinguished based on the relative size, intensity and distribution of yellow spots and distal bands on dorsal and caudal fins (Fig 1).

This remarkable polychromatism within B. xanthellus may be influenced by local changes in environmental conditions. The role of environmental changes in the diversification of Amazonian biota is critical to understanding the origin of immense tropical biodiversity [16]. Most studies on the genetic diversity of Amazonian biota have focused on forest taxa (e.g., [17-20]) with relatively few studies targeting aquatic taxa (e.g., [21]). Studies of population genetics and phylogeography are needed to infer historical events and processes that account for the current-day distribution of lineages and partitioning of genetic diversity within species [22, 23]. Thus, the phylogeographic patterns of B. xanthellus are studied here and compared to climate changes that affected habitats of eastern Amazon rivers during the late Quaternary in order to shed light on the processes influencing the diversification of rheophilic fishes in the rapids of large clearwater rivers.

Furthermore, considering its endemicity, commercial value, and importance as a protein source, detailed studies are needed on the population genetics and phylogeography of B. xanthellus. Those data can help design proper management plans and effective conservation strategies for this species in the Xingu River and its tributaries. Such studies are further compelled by the recent construction of the Belo Monte Dam Complex in the middle Xingu River [10, 24, 25].

This study evaluates genetic differentiation within B. xanthellus based on one mitochondrial gene (Cyt b) and introns 1 and 5 of nuclear genes Prolactin (Prl) and Ribosomal Protein L3 (RPL3), respectively. The main goal of this work is to understand the phylogeography and population structure throughout most of the species’ range in the Xingu River basin. Our results are used to infer underlying historical factors and to discuss the conservation of B. xanthellus with respect to hydrological and fluvial landscape changes imposed by the Belo Monte Dam Complex. Such changes include the loss of rocky rapids due to the flooding of the Xingu channel above the impoundment dam and the severe dewatering and suppression of the flood pulse below the dam.

Materials and methods

Fieldwork

Analyzed specimens were collected at 39 localities in the Xingu Basin, including 24 sites in the main channel from Vitória do Xingu to São Félix do Xingu upstream, 13 sites in the Iriri River, the largest Xingu tributary, and two sites in the Bacajá River, another major tributary that flows into Volta Grande stretch of the middle Xingu (Fig 2 and Table 1). No experimentation was conducted on live specimens. All material was collected in accordance with Brazilian law, under scientific collection licence (SISBIO 31089–1) and was in accordance with the precepts of the ethics committee for animal use in research “Comissão de Ética no Uso de Animais (CEUA)” of Universidade Federal do Pará (UFPA), protocol number 3032120919.

Fig 2

Map of collection sites of Baryancistrus xanthellus in the Xingu River basin; stretch of channel impounded by Belo Monte Dam (between site 8 and 10) not shown.

1: Vitória do Xingu; 2: Belo Monte; 3: Jericoá; 4: Percata; 5: Pariaxá; 6: Seca Farinha; 7: Ilha da Fazenda; 8: Igarapé Itatá; 9: Cotovelo; 10: Gorgulho da Rita; 11: Boa Esperança; 12: Cachoeira Grande; 13: Boa Esperança (Resex); 14: Cachoeira das Minhocas; 15: Ilha do Papagaio; 16: Cachoerinha; 17: Ressaca da Califórnia; 18: Lajeiro; 19: São Lucas; 20: Bené; 21: Pousada; 22: Porto Zé Carlos; 23: Zéfa; 24: Irineu; 25: Acima da confluência; 26: Balisa; 27: Pedra Preta (Resex); 28: Estragado; 29: Morro Grande; 30: Bela Vista; 31: Bom Jardim; 32: São Gonçalo; 33: Serra do Pardo; 34: Travessão do Nazaré; 35: Araraquara; 36: Remansinho; 37: Xadai; 38: Pedra Preta; 39: Onça.

Table 1

Number of individuals of Baryancistrus xanthellus sampled at each site.

Sites numbered according to the map in Fig 1; first letter of site abbreviation corresponds to river (i.e., “X” Xingu, “I” Iriri, “B” Bacajá).

Locality		No. of individuals
1	Vitória do Xingu (XVX)	1
2	Belo Monte (XBM)	37
3	Jericoá (XJC)	22
4	Percata (BPT)	1
5	Pariaxá (BPX)	13
6	Seca Farinha (BSF)	10
7	Ilha da Fazenda (XIF)	30
8	Igarapé Itatá (XII)	4
9	Cotovelo (XCT)	23
10	Gorgulho da Rita (XGR)	8
11	Boa Esperança (XBE)	14
12	Cachoeira Grande (ICG)	25
13	Boa Esperança/Iriri (IBE)	1
14	Cachoeira das Minhocas (ICL)	4
15	Papagaio Island (IIP)	5
16	Cachoeirinha (ICA)	5
17	Ressaca da Califórnia (IRC)	1
18	Lajeiro (ILJ)	10
19	São Lucas (ISL)	4
20	Bené (IBN)	6
21	Pousada (IPD)	1
22	Porto Zé Carlos (IPC)	8
23	Zefá (IZF)	6
24	Irineu (IIU)	1
25	Acima da Confluência (XCC)	5
26	Balisa (XBL)	2
27	Pedra Preta/Resex (XRP)	8
28	Estragado (XED)	5
29	Morro Grande (XMG)	1
30	Bela Vista (XBV)	2
31	Bom Jardim (XBJ)	2
32	São Gonçalo (XSG)	5
33	Serra do Pardo (XSP)	5
34	Travessão do Nazaré (XTZ)	2
35	Araraquara (XAR)	16
36	Remansinho (XRE)	5
37	Xadai (XXA)	15
38	Pedra Preta (XPP)	15
39	Onça (XON)	30
	TOTAL	358

From 2012 to 2016, a total of 358 specimens of B. xanthellus were collected from throughout its range in the Xingu (n = 257), Iriri (77) and Bacajá (24) rivers. All specimen identifications were performed in the field and later confirmed using the original published description [13]. A small portion of muscle tissue or pelvic fin were removed from each individual and stored in cryogenic tubes of 96–99% ethanol. Voucher specimens were individually tagged, fixed in 10% formaldehyde, stored in ethanol 70% and cataloged into the zoological collections of the following institutions: Laboratório de Ictiologia de Altamira, Universidade Federal do Pará (LIA-UFPA), Brazil; Fish Collection of the Instituto Nacional de Pesquisas da Amazônia (INPA-ICT), Brazil, and The Academy of Natural Sciences of Philadelphia (ANSP), USA.

Labwork

Total DNA was isolated using the Wizard Genomic kit (Promega) according to manufacturer instructions. To access the quality of DNA, samples were run on a 1% agarose gel using a mixture of 2 μL of DNA and 2 μL of Gel RedTM (Biotium). After electrophoresis at 60 Volts for 30 minutes, DNA samples were visualized under ultraviolet light and photo-documented.

Three genomic regions were amplified via Polymerase Chain Reaction (PCR), including one mitochondrial gene, cytochrome b (Cyt b) and introns 1 and 5 of nuclear genes Prolactin (PRL) and Ribosomal Protein L3 (RPL3), respectively. Primers and annealing temperatures used for each marker are shown in Table 2.

Table 2

Primer sequences and PCR annealing temperatures used for each marker in the present study.

Marker	Primers	Sequence (5’- 3’)	Reference	Annealing (oC)
Cyt b	FishCytbF	ACCACCGTTGTTATTCAACTACAAGAAC	[26]	55
	TrucCytbR	CCGACTTCCGGATTACAAGACCG
RPL 3	RPL35F	AAGAAGTCYCACCTCATGGAGAT	[27]	54
	RPL36R	TTRCGKGGCAGTTTCTTTGTGTGCCA
Prl	Prl1F	GACAARCTKCACTCBCTCAGCCA	[28]	64
	Prl1R	TGNAGDGAGGABGTGTGRCAC

PCR products were purified in PEG (Polyethylene Glycol) according to [29] and sequenced using the dideoxy-terminal method [30] with Big Dye kit reagents (ABI PrismTM Dye Terminator Cycle Sequencing Reading Reaction) and an ABI 3500 automatic sequencer (Life Technologies, Foster City, CA, USA).

Data preparation

Sequences were manually edited in BioEdit [31] and aligned using the CLUSTALW method [32] available in that software. In the case of nuclear markers, the algorithm Phase v.2.0 [33] available in DNAsp v.5.10 [34] was applied to score the gametic phases of each individual. Five runs of PHASE consisted of 1,000 burn-in iterations and 1,000 principal iterations, with a thinning interval of 1. Output files from Phase were converted using the software SeqPhase [35]. Only haplotypes with probability values >0.6 were used in further analyses. Recombination events were estimated according to the pairwise homoplasy index (PHI) of [36] available in SplitsTree v.4.14.4 [37].

The number and frequency of haplotypes was evaluated in the software DNAsp v.5.10 [34], which was also used to prepare the input files for the software Arlequin [38].

Population and phylogeographic analyses

Descriptive parameters for each marker, such as number of polymorphic sites, and nucleotide (π) and haplotype (h) diversities, were established using the software Arlequin v.3.5.1.2 [38]. To verify the spatial and genealogic relationship of haplotypes for each marker, a haplotype network was built in the software Haploviewer [39] based on a Maximum Likelihood tree obtained in the PhyML package [40].

We applied the method implemented in BAPS 6 [41] to assign individuals to genetic clusters. With this method, the number of groups (i.e., genetically diverged lineages) is defined according to a Bayesian algorithm that estimates the distribution of allele frequencies in the tested populations [41]. Each analysis was performed 20 times for every level of K (1–20), with five replicates for each K. The K with the highest posterior probability (HPP) was chosen as the correct clustering.

Analysis of molecular variance (AMOVA) [42] was used to evaluate the genetic differentiation the population groups of B. xanthellus indicated by BAPS. AMOVA was carried out in Arlequin v.3.5.1.2 [38]. The significance level was calculated by conducting 10,000 permutations.

A geographic representation of the distribution and frequency of haplotypes was performed using the software GenGIS v2.2.0. [43].

To test for deviations from neutrality due to evolutionary processes within populations of B. xanthellus, the Fs [44] and D [45] values were estimated in Arlequin v.3.5.1.2 [38] based on 10,000 permutations.

Demographic history of B. xanthellus was inferred using the Extended Bayesian Skyline Plot (EBSP) method available in the software BEAST v.1.8 [46]. EBSP analysis was based on 100 million generations with genealogies sampled each 10,000 steps, according to the evolutionary model suggested by Kakusan v.4 [47] (i.e., HKY+G). A strict molecular clock was assumed based on a mutation rate of 0.76%/site/million of years within lineages, as suggested by Zardoya and Doadrio [48] for cytochrome b.

We checked convergence by visually inspecting and computing the effective sample size higher than 200) for each parameter in two independent runs using the program Tracer v.1.6 (available at http://beast.bio.ed.ac.uk/tracer), setting the burn-in to 10%. The remaining parameters and priors were used with the default values. EBSPs were plotted using R [49].

Results

Dataset and levels of genetic diversity

Sequence data for the 717-bp fragment of Cyt b revealed 169 polymorphic sites and 135 haplotypes among 358 individuals; 69% of those haplotypes were unique. BAPS analysis of the Cyt b fragment clustered individuals of B. xanthellus into five genetically diverged groups lettered A through E (Fig 1). The most frequent haplotype (H41) was shared by 69 individuals from Group C, followed by H4, shared by 19 individuals from Group A.

PHI tests assigned non-significant p-values to both introns, RPL3 (p = 0.9059) and Prl (p = 0.1623), indicating an absence of recombination events. For the RPL3 intron, 60 haplotypes were identified in a 225-bp fragment sequenced for 221 individuals. Haplotype H1 was shared by 123 individuals, followed by H4, present in 42 individuals. For the Prl intron, 203 haplotypes were found in a final fragment of 479 bp obtained from 224 individuals. The most frequent haplotypes for the Prl intron were H1 and H5, shared by 59 and 32 individuals, respectively (Table 3).

Table 3

Values of genetic diversity and neutrality Fs and D tests in Baryancistrus xanthellus based on the five genetically diverged groups (A–E) previously identified by BAPS analysis of Cyt b marker (N = number of individuals, Nh = number of haplotypes, S = polymorphic sites, h = haplotype diversity, and π = nucleotide diversity.

Population	N	Nh	S	h±dp	π±dp	Tajima (D)	Fu (FS)
Cyt b
A	71	26	28	0.891 +/- 0.025	0.0033 +/- 0.0020	-1,875*	-20,025**
B	21	12	14	0.910 +/- 0.048	0.0023 +/- 0.0016	-2,059**	-8,681**
C	159	57	67	0.806 +/- 0.033	0.0027 +/- 0.0017	-2,585**	-27,356**
D	92	37	45	0.944 +/- 0.012	0.0076 +/- 0.0041	-1,219	-18,205**
E	15	3	15	0.275 +/- 0.148	0.0030 +/- 0.0020	-2,225**	2,795
RPL3
A	106	12	9	0.809 +/- 0.023	0.0061 +/-0.0042	-0,513	-4,171*
B	42	8	7	0.453 +/- 0.094	0.0031 +/- 0.0027	-1,563*	-4,922*
C	162	25	17	0.799 +/- 0.026	0.0059 +/- 0.0041	-1,484*	-21,532**
D	122	11	6	0.244 +/- 0.052	0.0014 +/- 0.0016	-1,571*	-13,493**
E	10	4	4	0.533 +/- 0.180	0.0054 +/- 0.0043	-0,521	-0,459
PRL
A	100	57	40	0.966 +/- 0.009	0.0071 +/- 0.0041	-1,701*	-26,219**
B	42	23	22	0.962 +/- 0.013	0.0075 +/- 0.0043	-0,986	-14,194**
C	170	84	34	0.971 +/- 0.006	0.0053 +/- 0.0032	-1,675*	-26,839**
D	124	31	18	0.930 +/- 0.010	0.0048 +/- 0.0030	-0,847	-23,352**
E	12	8	9	0.894 +/- 0.078	0.0060 +/- 0.0038	-0,118	-2,683

**p < 0.01.

*p < 0.05.

The sample number (N) for introns is duplicated due to heterozygosity.

For the five genetically diverged groups (A–E) inferred from the BAPS analysis, Cyt b haplotype diversity (h) ranged from 0.944 ± 0.012 (Group D) to 0.275 ± 0.148 (E) and nucleotide diversity (π) varied between 0.0023 ± 0.0016 (B) and 0.0076 ± 0.0041 (D). For the RPL3 nuclear intron, values of haplotype and nucleotide diversity ranged from h = 0.809 ± 0.023 (A) to 0.244 ± 0.052 (D) and π = 0.0061 ± 0.0042 (A) to 0.0014 ± 0.0016 (D). In the case of Prl nuclear intron, h values varied from 0.971 ± 0.006 (C) to 0.894 ± 0.078 (E) while π values ranged from 0.0075 ± 0.0043 (B) to 0.0048 ± 0.0030 (D) (Table 3).

Population genetic structure

Based on the mitochondrial marker (717-bp fragment of Cyt b), the BAPS analysis discriminated five genetically diverged groups within B. xanthellus (K = 5; logML = -3688.8922; Posterior Probability = 1) (Fig 3). Group A, named Resex of Iriri River, comprised 71 specimens from 12 sites along the Iriri and three sites in the Xingu channel, one immediately above and the first two sites downstream the Iriri-Xingu confluence. Group B (Resex of Xingu River) included 21 individuals from nine sites in the Xingu channel, all but one distributed from the first two sites downstream the Iriri-Xingu confluence upstream to about the midpoint between that confluence and São Felix do Xingu. Group C (Volta Grande do Xingu) included the largest number of individuals (159) and dominated the downstream-most limit of the species range, specifically the upper Xingu Ria, Middle Xingu channel downstream the mouth of the Iriri, and Bacajá River. Group D (São Félix do Xingu) comprised 92 individuals and dominated the upstream-most sites sampled in the Xingu channel. Group E (Ecological Station of Terra do Meio) included the fewest number of individuals (15) and was restricted to the upstream-most sites sampled in the Iriri River.

Fig 3

Estimation of genetically diverged groups in Baryancistrus xanthellus in the Xingu River basin inferred from the Bayesian analysis (BAPS) of 717-bp Cyt b fragment in 358 individuals.

The five groups are indicated by green (A), orange (B), magenta (C), blue (D) and yellow (E). The numbers represent the collection sites. 1: Vitória do Xingu; 2: Belo Monte; 3: Jericoá; 4: Percata; 5: Pariaxá; 6: Seca Farinha; 7: Ilha da Fazenda; 8: Igarapé Itatá; 9: Cotovelo; 10: Gorgulho da Rita; 11: Boa Esperança; 12: Cachoeira Grande; 13: Boa Esperança (Resex); 14: Cachoeira das Minhocas; 15: Ilha do Papagaio; 16: Cachoerinha; 17: Ressaca da Califórnia; 18: Lajeiro; 19: São Lucas; 20: Bené; 21: Pousada; 22: Porto Zé Carlos; 23: Zéfa; 24: Irineu; 25: Acima da confluência; 26: Balisa; 27: Pedra Preta (Resex); 28: Estragado; 29: Morro Grande; 30: Bela Vista; 31: Bom Jardim; 32: São Gonçalo; 33: Serra do Pardo; 34: Travessão do Nazaré; 35: Araraquara; 36: Remansinho; 37: Xadai; 38: Pedra Preta; 39: Onça.

Genetically diverged groups B, C and D of B. xanthellus were restricted to the Xingu channel. Their frequency of occurrence formed a longitudinal gradient with the downstream range of the species dominated by Group B individuals, the middle portion dominated by Group C, and the upstream range, above São Felix do Xingu, exclusively Group D. Groups A and E were restricted to the Iriri channel except for a few Group A individuals found in the Xingu channel short distances upstream and downstream the mouth of the Iriri. Group E individuals had the smallest distribution and were limited to the furthest upstream sites in the Iriri River.

For Cyt b, the AMOVA (Table 4) showed that most of the genetic variation was found between the five genetically diverged groups (81.64%) instead of within groups (18.36%) (ɸST = 0.816). A different scenario was revealed from the analysis of nuclear regions. For both RPL3 and Prl introns, the AMOVA indicated that most of the variation is found within (90.38% and 87.86%, respectively) instead of among groups (Table 4).

Table 4

Analysis of Molecular Variance (AMOVA) to evaluate the genetic differentiation among and within the five genetically diverged groups of B. xanthellus indicated by BAPS.

Source of variation	Variance components	Variation %	Statistic ɸ
Cyt b
Among Groups	6.50929 Va	81.64	ɸST = 0.816*
Within Groups	1.46341 Vb	18.36
RPL3
Among Groups	0.05293 Va	9.62	ɸST = 0.096*
Within Groups	0.49746 Vb	90.38
PRL
Among Groups	0.20710 Va	12.14	ɸST = 0.12*
Within Groups	1.49900 Vb	87.86

Asterisks indicate significant values (p < 0.01).

Substructure indices in populations of B. xanthellus from the Xingu River basin were corroborated by the allocation of Cyt b haplotypes to five clusters in the haplotype network. Group C comprised most of specimens from the region identified as Volta Grande do Xingu. The other groups discriminate the samples from São Félix do Xingu, Xingu Resex, Iriri Resex and the Ecological Station of Terra do Meio, revealing longitudinally structured populations along Xingu and Iriri rivers (Figs 4 and 5).

Fig 4

Haplotype network showing the distribution of 134 haplotypes in Baryancistrus xanthellus based on the mitochondrial Cyt b marker.

Each color represents the 39 sampled sites in this study grouped accordingly: Iriri Resex (Group A–greenish), Xingu Resex (B–reddish), Volta Grande do Xingu (C–purplish), São Félix do Xingu (D–bluish), and Ecological Station of Terra do Meio (E–yellowish).

Fig 5

Distribution of Cyt b haplotypes of Baryancistrus xanthellus assigned to Group A (Iriri Resex–green), Group B (Xingu Resex–orange); Group C (Volta Grande do Xingu–magenta); Group D (São Félix do Xingu–blue), and Group E (Ecological Station of Terra do Meio–yellow).

The lack of genetic substructure in nuclear markers was evident in the haplotype network, since no correlation was observed between haplotype and geographic distribution (Figs 6 and 7).

Fig 6

Haplotype network showing the distribution of 60 haplotypes in Baryancistrus xanthellus based on the nuclear RPL3 marker.

Each color represents the 39 sampled sites in this study. The colors by group are: Iriri Resex (Group A–greenish), Xingu Resex (B–reddish), Volta Grande do Xingu (C–purplish), São Félix do Xingu (D–bluish), and Ecological Station of Terra do Meio (E–yellowish).

Fig 7

Haplotype network showing the distribution of 156 haplotypes in Baryancistrus xanthellus based on the nuclear PRL marker.

Each color represents the sampled sites in this study. The colors by group are: Iriri Resex (Group A–greenish), Xingu Resex (B–reddish), Volta Grande do Xingu (C–purplish), São Félix do Xingu (D–bluish), and Ecological Station of Terra do Meio (E–yellowish).

Demographic history

Negative and significant values were obtained in the Fs and D tests using both mitochondrial and nuclear markers for nearly all five population groups of B. xanthellus, indicating deviations from neutrality (Table 3).

The demographic history of each identified group (A–E) was inferred by Extended Bayesian Skyline Plots. The graphs obtained for groups A and C indicated a population expansion initiated 200 ka (thousand years ago). On the other hand, the effective population sizes (Ne) of groups B and D remained stable, while group E experienced a recent population expansion estimated at 5 ka (Fig 8).

Fig 8

Bayesian Skyline Plot for the five lineages (Groups A–E) of Baryancistrus xanthellus from the Xingu River basin.

The curves correspond to the concatenated markers. The y axis corresponds to the effective population size (Ne) and the x axis corresponds to the mean period estimated in million years (Ma).

Discussion

Genetic diversity, population structure and phylogeography

High levels of haplotype diversity (h) and low variation in nucleotide diversity (π) were observed in Cyt b sequences for three of the five groups analyzed: Iriri Resex (group A), Xingu Resex (B) and Volta Grande do Xingu (C). Reduced π values associated with high h values usually indicate bottleneck events followed by population expansion, thereby leading to accumulation of new mutations [50, 51]. A similar pattern suggestive of population expansion was reported in another species of Loricariidae, Hypostomus ancistroides, [52], as well as in other families of Siluriformes [53-55].

On the contrary, the group from São Félix do Xingu (group D) in the upper Xingu presented both high h and π values, typical of large and stable populations over long periods of evolutionary history [51]. For the group from the Ecological Station of Terra do Meio (group E) in the upper Iriri, both h and π diversity values were relatively low. This result might be explained by the reduced sample size of B. xanthellus from this region, as also inferred for some lineages of other Siluriformes, such as Bagre bagre (Ariidae) [56].

When compared to the other groups, the lowest haplotype diversity was detected in the groups from Volta Grande do Xingu at the downstream limit of the distribution of B. xanthellus. The Volta Grande do Xingu hosts the largest rapids and bedrock channels within the Xingu basin. This particular physiography may provide higher habitat availability and continuity for populations of B. xanthellus, favoring gene flow. Moreover, Volta Grande do Xingu supports most of colour morphs observed in B. xanthellus, making this stretch popular among ornamental fishermen over the last 40 years. Another commercially important loricariid species, Hypancistrus zebra, is endemic to Volta Grande and classified as Critically Endangered by the Brazilian Ministry of Environment [57] due to overfishing and habitat loss attributed to the Belo Monte dam complex. Accordingly, the group from this region also presented the highest number of shared haplotypes among individuals, suggesting the occurrence of population bottleneck.

The construction of the Belo Monte hydroelectric power plant, which began operations in the first quarter of 2016, might promote a spatial and temporal loss of genetic diversity in B. xanthellus. The population from Volta Grande do Xingu is directly affected by the loss of large rapids and availability of food resources due to sediment accumulation on rocky substrates in the reservoir and in the channel downstream of the impoundment dam [10, 11]. The change from lotic to lentic environments can cause drastic declines in populations of rheophilic and lithophilic fish species and eventually lead to local extinctions [24, 58].

The population structure inferred from Cyt b data revealed five haplogroups of B. xanthellus distributed along the Xingu River basin. These lineages were characterized by higher levels of intraspecific variation that indicate a strong population genetic substructure pattern.

In fact, the Xingu and Iriri rivers encompass high variety of aquatic environments, including powerful rapids with rocky substrates interspersed with backwaters with bottoms of sand or gravel [59]. Both rivers are often split into multiple channels with variable depths and levels of connectivity, the latter including steep drops that form waterfalls. This extreme variation in hydrodynamics and riverbeds promotes the fragmentation of aquatic habitats in the Xingu River, where rocky rapids are separated by slackwater stretches with substrates dominated by sediments.

Baryancistrus xanthellus is highly adapted to rocky rapids and, like most loricariid species, is phylopatric with no significant migration over breeding periods. These features might restrain gene flow among populations along a single bedrock river stretch [8]. Considering the longitudinal distribution of the five haplogroups herein identified, our observations of large backwater areas with deep channels and sediment-laden bottoms between rocky rapids might contribute to the limited dispersal of local populations. In other words, the isolation of shallow rocky rapids by large stretches of not so complex river channel with more calm waters leading to flow expansion and sediment accumulation combined with the biological particularities of B. xanthellus likely influenced genetic differentiation among populations of this species.

Nonetheless, some haplotyes of the Cyt b marker were shared between both neighboring and more distant populations. Putatively, this pattern points to a dynamic environment, wherein sediment accumulation and erosion would drive the fragmentation and expansion of rocky substrates. The sediment accumulation within rivers across space and through time depends on the interaction between channel morphology and water discharge. In the local scale, zones of channel widening and flow expansion are susceptible to sediment accumulation [60]. This would drive the distribution of riverbeds with exposed rocks or covered by sediments under a specific hydrological regime. Zones susceptible for sediment accumulation are also formed by the backwater effect of the trunk river in its tributaries. In this case, rocky riverbeds would be more fragmented or less persistent in the downstream reach of tributaries, difficulting the contact between populations of the trunk river (Xingu) and its tributaries (Iriri and Bacajá). In a thousand years timescale, periods of higher precipitation in eastern Amazonia increase the water discharge of the Xingu and Iriri rivers, favoring lateral or vertical channel erosion, sediment bypass and the expansion of zones of rocky rapids. This condition would promote some degree of gene flow among populations of B. xanthellus. On the other hand, dry periods would induce fluvial aggradation through accumulation of sediment within river channels [61], increasing the fragmentation of rocky rapids.

The rainfall in the Amazon region is driven by the South American monsoon system (SAMS) [62]. Eastern Amazonia, including the Xingu River basin, experienced remarkable variation in rainfall during the late Quaternary [63, 64]. For example, rainfall in eastern Amazonia was reduced during the last glacial maximum (~21–23 ka); conversely, rainfall may have increased during the middle Holocene (~6 ka) [64]. Abrupt climatic changes, such as the Heinrich Stadial 1 (HS1; ~18–15 ka), also promoted dramatic changes in rainfall and the water discharge of Amazonian rivers [65, 66].

Hydrology significantly impacts sediment transport and accumulation along river channels and consequently promotes changes in the continuity (or fragmentation) of rocky substrates. For eastern Amazonian rivers, periods of higher rainfall during the middle Holocene and HS1, would have increased the connectivity of fluvial channels and rocky rapids. On the other hand, the shift to a drier climate during last glacial maximum would have favoured the accumulation of sediments and the fragmentation of rocky rapids, isolating populations of species adapted to these habitats, such as B. xanthellus. Besides the climate variations reported since the last glacial maximum, the rainfall across Amazonia was modulated by insolation cycles with ~25 ka periodicity during the last 250 ka [63, 67]. These variations in hydrology and their effect on the sedimentary budget imply dynamic long-term distribution of rocky and sediment substrates of the Xingu River.

Similar patterns of population structure have been reported in other loricariid catfishes, such as Hypostomus. Based on the mitochondrial ATPase 6/8 marker, Hollanda et al. [52] identified 12 highly structured and genetically divergent populations of H. ancistroides from Paraná River basin. According to these authors, this pattern was related to the biological features of the species and to changes in environmental conditions. Also using ATPase 6/8 sequences, Borba et al. [68] performed phylogeographic and phylogenetic analyses on populations of Hypostomus strigaticeps from four sub-basins of the Paraná River. Their results confirmed that populations could be discriminated into two cryptic lineages within the single species.

Unlike those based on mtDNA, analyses based on nuclear markers often fail to detect subdivisions between populations, as was the case for B. xanthellus. Nuclear markers have lower rates of evolution when compared to mitochondrial markers, and are therefore less sensitive to recent events of population division [69].

Results obtained for nearly all samples by both D and Fs statistic tests suggest deviation of neutrality. Negative values may be interpreted as population expansion as suggested by the haplotype network star-like shape and by EBSP results [44]. In addition, the EBSP curves corroborated the neutrality tests, suggesting that population expansions in the A and C groups initiated about 200 ka. In contrast, the B and D groups seem remained stable over this period.

As previously discussed, rainfall in eastern Amazonia combined with channel hydrodynamics (zones of flow expansion and confluences) drives the capacity of clearwater rivers to trap (low rainfall) or transport (high rainfall) sediments to the Amazon River channel. Shield areas have very low rates of surface erosion [70], which point to relatively stable relief in the thousand years timescale. Thus, historical changes in rainfall and their consequent effect on fluvial sedimentation thereby have higher impact to the size and connectivity of rocky rapids during the late Quaternary.

Population expansion in groups A and C of B. xanthellus estimated over the last 200 Kya points to an increased availability of rocky rapids in the Iriri River and downstream stretch of the Xingu River. On the other hand, population stability in groups B and D suggests that aquatic environments in the Xingu River responded differently to regional climate changes, possibly due to hydrodynamic controls on the spatial distribution of sediment accumulation zones. These environmental dynamics in response to changes in rainfall could account for the high genetic diversity and population expansion or stability of B. xanthellus from different portions of the Xingu River basin. This hypothesis implies that similar phylogeographic patterns should be present in other loricariid catfishes sharing equivalent biological features and generation intervals.

Final remarks

This is the first study to characterize the phylogeographic pattern in B. xanthellus using mitochondrial and nuclear markers and encompassing a wide sampling over the entire species geographic range. Analyses of the Cyt b marker inferred five longitudinally distributed haplogroups with high genetic diversity in B. xanthellus. Those haplogroups are putatively associated with the philopatric nature of this species and the historical isolation of its preferred habitat (rocky rapids) driven by fluvial hydrodynamics and hydrological changes in eastern Amazonia over the late Quaternary. Analyses of the nuclear markers did not reveal a similar pattern due the recent nature of such diversification.

The demographic inferences indicated that some haplogroups have undergone population expansion while others have experienced population stability, both probably associated with spatial variation in aquatic habitats due to late Quaternary climate changes. Changes in water discharge driven by long-term changes in rainfall shifted the riverine landscape via sediment transport or accumulation in the main channels. Consequently, rocky rapids have expanded (via sediment bypass) or retracted and fragmented (via sediment accumulation) along different stretches of the Xingu and Iriri Rivers during the last 200 ka.

Conservation strategies for B. xanthellus must take this phylogeographic pattern into account. The building and operation of the Belo Monte hydropower plant have significantly impacted the availability and connectivity of rocky rapids in the Volta Grande stretch of the Xingu channel and will likely reduce levels of genetic diversity and gene flow among resident populations. Furthermore, the ornamental fish trade of loricariids such as B. xanthellus should be monitored to avoid overfishing at sensitive localities.

16 Jun 2021

PONE-D-21-10171

Phylogeography of Baryancistrus xanthellus (Siluriformes: Loricariidae), a rheophilic catfish endemic to the Xingu River basin in eastern Amazonia

PLOS ONE

Dear Dr. Sousa,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Both reviewers had relatively few comments and suggestions and they agree that the manuscipt should be published in this journal.

Please submit your revised manuscript by Jul 31 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Juan Marcos Mirande

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript deals with a variable catfish species in a proper way, analyzing genetically different subpopulations and concluding about their phylogeographic history. This study was long needed and is presently beautifully. The manuscript is generally well researched and well written, and include very good, highly illustrative figures.

I only have a few corrections before acceptance, which are listed below, by line number:

Lines 7, 9, 10, 12 and 14: Please add the postal code (CEP) to all Brazilian addresses before the city name, and without a separating comma.

Line 51: It is numerous but obviously countable… so countless is not a good adjective. Replace by numerous or other similar word.]

Line 57: Those three basins .. drain the …

Line 58: ... their downstream portions lie on the …

61: Xingu River

81: color (stick to American English)

104: middle Xingu River (middle is not part of the name)

109: Xingu River basin (basin is not part of the name)

117 and 246: I think “ria” is not an English word. It is usually translated as estuary, despite a “ria” opens to another river. Perhaps you should explain the meaning of “ria” at first usage in M&M, or chose a different way of saying ria.

119: middle Xingu

314: Demographic

347: xanthellus

351: Critically Endangered, without quotes and with capital initials (as recommended by IUCN).

419: add space after rapids,

454: responded

463-4: over the entire species geographic range.

Congratulations on the very good figures!

R. E. Reis

Reviewer #2: Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) (Limit 200 to 20000 Characters)

Could you please see my attached review, I have added all my comments to the Author in an attachment.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: rev_plos_Bxant.pdf

Click here for additional data file.

27 Jul 2021

COMMENTS

Comments from Reviewer 1

The manuscript deals with a variable catfish species in a proper way, analyzing genetically different subpopulations and concluding about their phylogeographic history. This study was long needed and is presently beautifully. The manuscript is generally well researched and well written, and include very good, highly illustrative figures.

I only have a few corrections before acceptance, which are listed below, by line number:

Response: We have incorporated the suggestions throughout the manuscript.

• Comment: Lines 7, 9, 10, 12 and 14: Please add the postal code (CEP) to all Brazilian addresses before the city name, and without a separating comma.

Response: Done.

• Comment: Line 51: It is numerous but obviously countable… so countless is not a good adjective. Replace by numerous or other similar word.]

Response: Done.

• Comment: Line 57: Those three basins .. drain the …

Response: Done.

• Comment: Line 58: ... their downstream portions lie on the …

Response: Done.

• Comment: Line 61: Xingu River

Response: Done.

• Comment: Line 81: color (stick to American English).

Response: Done.

• Comment: Line 104: middle Xingu River (middle is not part of the name).

Response: Done.

• Comment: Line 109: Xingu River basin (basin is not part of the name).

Response: Done.

• Comment: Line 117 and 246: I think “ria” is not an English word. It is usually translated as estuary, despite a “ria” opens to another river. Perhaps you should explain the meaning of “ria” at first usage in M&M or chose a different way of saying ria.

Response: The term is explained in Introduction, line 61.

• Comment: Line 119: middle Xingu.

Response: Done.

• Comment: Line 314: Demographic.

Response: Done.

• Comment: Line 347: xanthellus.

Response: Done.

• Comment: Line 351: Critically Endangered, without quotes and with capital initials (as recommended by IUCN).

Response: Done.

• Comment: Line 419: add space after rapids,

Response: Done.

• Comment: Line 454: responded.

Response: Done.

• Comment: Line 463-4: over the entire species geographic range.

Response: Done.

Comments from Reviewer 2

• Comment: 164 - 173: I’m not familiar with Phase algorithms but I know that it offers a number of parameters. It is important that these parameters are given on the text.

Response: Done. In the new version of the manuscript a sentence about PHASE parameters is included (lines 185-190).

• Comment: Parameters of BAPS6 are also poorly described. I strongly recommend the authors to have a look at other papers to see how methods are explained. Number of replications and K values are fundamental and need to be explained. How did K was estimated? Was it based on the haplotype network results?

Response: Done. In the new version of the manuscript BAPS section was improved in material and methods (lines 201-206).

• Comment: Did authors use other software to build the output like Distruct or Clumpp?

Response: BAPS does not require the use of extra packages for graphically displays results of runs.

• Comment: Finally, I never used BAPS and I was unable to install or see its documents and for these reasons I cannot assure what are the parameters that should figure on the text. Though I believe it might be close to Structure package. If this is the case, authors should keep in mind that this is an analysis of attribution that is dependent of K calculation, where K is the number of populations. Different numbers of K should have been compared in order to find the best population structure given the current dataset. So, its of paramount importance to let the reader know how K was found.

Response: We tested different levels of K (1-20). The number of K was chosen based on highest posterior probability value. See BAPS section in material and methods and Results/Population genetic structure section (lines 201-206).

• Comment: 185 - 192: AMOVA was employed in a manner that I do not agree and consequently its results are not worthy to be discussed. In fact, AMOVA is usually used in two ways. The first as an exploratory analysis to help the formulation of hypothesis given a data set. The second is to test and compare different hypotheses, i.e. different scenarios of population structure. In this work, an analysis of attribution is performed by BAPS6 and its result is considered to be the most plausible population structure. Hence, AMOVA should be used to go further on BAPS proposed structure and to show in more detail how genetic variation is partitioned among populations. I also believe that FST was used as an exploratory analysis and its results are not relevant. Since FST is also calculated in AMOVA I believe that this analysis could be removed from the paper.

Response: Done. We employed AMOVA based on BAPS structure. Text explained was added (lines 207-210). We also removed FST.

• Comment: 196: Parameters and priors of EBSP should also be stated.

Response: Done. Lines 217-219.

• Comment: 228: Table 3 caption should state what are one or two asterisks.

Response: Done.

• Comment: 265-267: This is not correct. Results for cytb are distinctly different.

Response: Corrected. We inserted the result of AMOVA based on BAPS structure.

• Comment: 276: This whole table of results is unnecessary (as stated above - see comments on the use of FST and AMOVA).

Response: We decided to keep this table as we are still using AMOVA (but removed FST, as explained above).

• Comment: 279: AMOVA, and not FST, should have been used to test the hypothesis of existing five population hypotheses (as stated above - see comments on the use of FST and AMOVA)

Response: Addressed above.

• Comment: 301: “The lack of genetic substructure ‘in’ nuclear markers...” Is this sentence correctly written?

Response: Yes.

• Comment: Genetic diversity: Maybe this subsection could be merged with Population Structure and Phylogeography as in the very beginning it refers to the main result of population structure (“...for three of the five groups analyzed...”). This is just a suggestion. Demographic history.

Response: Done.

• Comment: 439-441: Results of D and Fs can be interpreted further than only deviation from neutrality. Negative values may be interpreted as population expansion as suggested by the haplotype network star-like shape and endorsed by EBSP results.

Response: Done. See Demographic history section on Discussion.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

10 Aug 2021

PONE-D-21-10171R1

Phylogeography of Baryancistrus xanthellus (Siluriformes: Loricariidae), a rheophilic catfish endemic to the Xingu River basin in eastern Amazonia

PLOS ONE

Dear Dr. Sousa,

All the suggestions from the reviewers were followed and I find the manuscript ready to be published.

I just found one word that went back to British English in the latest review, that should be kept in American English to be congruent. In Line 114, please change back "Analysed" to "Analyzed". As the journal hasn't copy-editing, it should be done by the authors.

After that, the manuscript will be sent to production.

Sincerely, Marcos Mirande

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

11 Aug 2021

As asked in the latest Decision Letter (copied below), the word "Analysed" was changed to "Analyzed".

Dear Dr. Sousa,

All the suggestions from the reviewers were followed and I find the manuscript ready to be published.

I just found one word that went back to British English in the latest review, that should be kept in American English to be congruent. In Line 114, please change back "Analysed" to "Analyzed". As the journal hasn't copy-editing, it should be done by the authors.

After that, the manuscript will be sent to production.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

13 Aug 2021

Phylogeography of Baryancistrus xanthellus (Siluriformes: Loricariidae), a rheophilic catfish endemic to the Xingu River basin in eastern Amazonia

PONE-D-21-10171R2

Dear Dr. Sousa,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Juan Marcos Mirande

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

20 Aug 2021

PONE-D-21-10171R2

Phylogeography of Baryancistrus xanthellus (Siluriformes: Loricariidae), a rheophilic catfish endemic to the Xingu River basin in eastern Amazonia

Dear Dr. Sousa:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Juan Marcos Mirande

Academic Editor

PLOS ONE