Charlene Watterston1,2, Rami Halabi2,3, Sarah McFarlane2,3,4, Sarah J Childs1,2. 1. Department of Biochemistry and Molecular Biology, University of Calgary, Calgary, Canada. 2. Alberta Children's Hospital Research Institute, University of Calgary, Calgary, Canada. 3. Hotchkiss Brain Institute, University of Calgary, Calgary, Canada. 4. Department of Cell Biology and Anatomy, University of Calgary, Calgary, Canada.
Abstract
Vessel growth integrates diverse extrinsic signals with intrinsic signaling cascades to coordinate cell migration and sprouting morphogenesis. The pro-angiogenic effects of Vascular Endothelial Growth Factor (VEGF) are carefully controlled during sprouting to generate an efficiently patterned vascular network. We identify crosstalk between VEGF signaling and that of the secreted ligand Semaphorin 3fb (Sema3fb), one of two zebrafish paralogs of mammalian Sema3F. The sema3fb gene is expressed by endothelial cells in actively sprouting vessels. Loss of sema3fb results in abnormally wide and stunted intersegmental vessel artery sprouts. Although the sprouts initiate at the correct developmental time, they have a reduced migration speed. These sprouts have persistent filopodia and abnormally spaced nuclei suggesting dysregulated control of actin assembly. sema3fb mutants show simultaneously higher expression of pro-angiogenic (VEGF receptor 2 (vegfr2) and delta-like 4 (dll4)) and anti-angiogenic (soluble VEGF receptor 1 (svegfr1)/ soluble Fms Related Receptor Tyrosine Kinase 1 (sflt1)) pathway components. We show increased phospho-ERK staining in migrating angioblasts, consistent with enhanced Vegf activity. Reducing Vegfr2 kinase activity in sema3fb mutants rescues angiogenic sprouting. Our data suggest that Sema3fb plays a critical role in promoting endothelial sprouting through modulating the VEGF signaling pathway, acting as an autocrine cue that modulates intrinsic growth factor signaling.
Vessel growth integrates diverse extrinsic signals with intrinsic signaling cascades to coordinate cell migration and sprouting morphogenesis. The pro-angiogenic effects of Vascular Endothelial Growth Factor (VEGF) are carefully controlled during sprouting to generate an efficiently patterned vascular network. We identify crosstalk between VEGF signaling and that of the secreted ligand Semaphorin 3fb (Sema3fb), one of two zebrafish paralogs of mammalian Sema3F. The sema3fb gene is expressed by endothelial cells in actively sprouting vessels. Loss of sema3fb results in abnormally wide and stunted intersegmental vessel artery sprouts. Although the sprouts initiate at the correct developmental time, they have a reduced migration speed. These sprouts have persistent filopodia and abnormally spaced nuclei suggesting dysregulated control of actin assembly. sema3fb mutants show simultaneously higher expression of pro-angiogenic (VEGF receptor 2 (vegfr2) and delta-like 4 (dll4)) and anti-angiogenic (soluble VEGF receptor 1 (svegfr1)/ soluble Fms Related Receptor Tyrosine Kinase 1 (sflt1)) pathway components. We show increased phospho-ERK staining in migrating angioblasts, consistent with enhanced Vegf activity. Reducing Vegfr2 kinase activity in sema3fb mutants rescues angiogenic sprouting. Our data suggest that Sema3fb plays a critical role in promoting endothelial sprouting through modulating the VEGF signaling pathway, acting as an autocrine cue that modulates intrinsic growth factor signaling.
Sprouting angiogenesis is a process by which new vessels branch and grow from existing vessels, establishing the perfusion of tissues and organs. How sprouting angiogenesis is coordinated at the intrinsic and extrinsic levels is one of the most important questions in vascular biology. Vessel growth is highly dependent on Vascular Endothelial Growth Factor (VEGF) signaling, which functions as a master regulator to promote angiogenesis, and is often dysregulated in disease [1-4]. VEGF gradients within tissues are responsible for the initial triggering and guidance of the sprouting process signaling through the endothelial-expressed tyrosine kinase VEGF receptor 2 (VEGFR2) [5-7], activating downstream signaling including that of the MAPK-ERK pathway. The cellular response to VEGF must be carefully regulated to ensure the stereotypical patterning of vessels.During sprout formation, angioblasts adopt two distinct cellular states–termed tip and stalk- that respond to internal and external stimuli to promote and guide vessel growth [5,8,9]. Tip cells utilize filopodia to scan the environment for attractive and repulsive cues that dynamically control proliferation and migration [10,11]. In contrast, trailing stalk cells have limited filopodia, are quiescent, and contribute to forming the vascular lumen and phalanx [5,12]. Tip and stalk identity are determined competitively through a Delta-like 4 (Dll4)-Notch lateral inhibition pathway and VEGF signaling feedback loop. Dll4 expression is induced downstream of VEGF signaling in tip cells [13]. Dll4 positive cells activate the Notch receptor in stalk cells [14-16] to down-regulate VEGF receptor expression and limit the response of the stalk cell to environmental VEGF [17-19].The vertebrate-specific secreted Class 3 Semaphorins (Sema3s) including Sema3a, Sema3c, and Sema3f typically act as repulsive guidance cues to limit vessel growth. Sema3 control of angiogenesis is evolutionarily conserved across multiple species [20-23]. The exact role of these instructive cues can differ depending on the species and tissue expression of ligands and/or receptors. PlexinD1 is an endothelial-specific receptor conserved in zebrafish and mouse and integrates signals from multiple Sema3 ligands. During embryonic vessel growth, zebrafish Sema3a is expressed in a caudal-to-rostral gradient across each somite. Paracrine signaling from Sema3a to its receptor PlexinD1 in the endothelium acts to spatially restrict intersegmental vessels [22]. In mouse Sema3E guides intersegmental vessel growth via PlexinD1 [20,24]. In contrast, fish Sema3e shows endothelial expression and acts as an autocrine pro-angiogenic factor to antagonize PlexinD1 during intersegmental vessel growth [25]. PlexinD1 also limits responses to VEGF by increasing the expression of a soluble decoy Vegf receptor (sVegfr2/sFlt1) [26]. sFlt1 antagonizes Vegfr2 signaling by sequestering Vegf ligand thus providing a link between Sema-Plexin and Vegf signaling.Sema3F is highly expressed by cultured human and mouse endothelial cells [27-30] and in endothelial cells in scRNAseq databases [31,32]. SEMA3F typically signals through Neuropilin receptors (NRP) to modulate migration in cell culture models [30,33]. Exogenous human SEMA3F inhibits tumor progression and vascularization [21]. However, SEMA3F has a versatile role in regulating vessel growth depending on context; it functions either as a pro-angiogenic or anti-angiogenic cue. For instance, exogenously applied Sema3F limits aberrant growth of mouse retinal vessels [34], and we recently showed similar anti-angiogenic functions for sema3fa in the zebrafish retina [35]. At the same time, Sema3F is pro-angiogenic during placental development in mice [29,36]. There is still a limited understanding of how an endothelial cell can receive the same signal, yet coordinate different downstream molecular pathways driving angiogenic growth. Context-dependent and tissue specific expression can further influence cell behaviors, for example in the mouse brain Sema3E/PlexinD1 signaling switches from attractive to repulsive depending on NRP co-receptor expression [37].Here we investigate the role of zebrafish Sema3f in regulating angiogenic growth. We find that sema3fb is expressed within endothelial cells of the dorsal aorta and is necessary for promoting sprout migration in the trunk. We show that sema3fb regulates the expression of the VEGF receptor vegfr2 to promote angioblast migration, as well as regulating the expression of genes mediating feedback on Vegf signaling such as sflt1 and dll4. Together these data reveal a new autocrine role for a secreted ligand from endothelial cells in modulating VEGF pathway activity in angiogenic sprouting.
Results
sema3fb is expressed by developing blood vessels
To investigate the role of Sema3F in vascular angiogenesis, we use zebrafish. The zebrafish genome contains duplicated orthologs of human SEMA3F - sema3fa and sema3fb [38]. The stereotypic patterning of major trunk vessels in the zebrafish begins at around 20 hours post fertilization (hpf) when angioblasts (endothelial precursors) migrate collectively from the dorsal aorta (DA) and sprout laterally in between each pair of somites to form the intersegmental arteries (ISAs). The ISAs then migrate dorsally and connect to form the dorsal longitudinal vessel (DLAV) between 30–32 hpf [39]. Using whole mount in situ hybridization (ISH), we analyzed the expression of sema3fa and sema3fb and find non-overlapping patterns of expression in the trunk of developing embryos. sema3fb is expressed in the dorsal aorta at 26 hpf and in ISAs by 28–30 hpf (Figs 1A and S1), similar to the endothelial expression pattern of sema3e [25]. In contrast, its homolog sema3fa is absent from the trunk endothelium and is expressed laterally in somites (S1 Fig). These expression patterns are consistent with published zebrafish single-cell sequencing data showing expression of sema3fb (but not sema3fa) in pecam, tie1, and flt1-expressing endothelial cells of developing zebrafish embryos [40]. Endothelial expression of Sema3f in murine and human and of sema3fb in zebrafish vasculature is supportive of the conserved role for Sema3f in endothelial cells.
A) Lateral view of sema3fb expression at 30hpf by ISH. Inset shows expression in the dorsal aorta (DA) and intersegmental arteries (ISAs). B) Schematic representation of the zebrafish vasculature at 30 hpf. Inset: The ISAs sprout from the DA and connect to form the Dorsal Longitudinal Anastomotic Vessel (DLAV) by 30 hpf. C-E) Lateral confocal images of the trunk vasculature (black) of 30 hpf (C) wild type sibling (sib), (D) heterozygous (het) sema3fbca305/+ and (E) homozygous (hom) sema3fbca305 mutants. Gaps in the DLAV (blue asterisks) and truncated ISA sprouts (yellow arrowhead) are noted. Abbreviations: DA (Dorsal Aorta), and PCV (Posterior Cardinal Vein). Anterior, left; Dorsal, up. Scale bar, 100 μm. F) ISA Sprout length at 30 hpf in wild type (WT) sibs (mean length of 106±10 μm), het sema3fbca305/+ (92±19μm), and hom sema3fbca305 (91±18μm), ****p<0.0001. G) Percentage of ISA sprouts connecting to form DLAV at 30 hpf. WT sib (mean 83% connected), het sema3fbca305/+ (50% connected) and hom sema3fbca305 (42% connected), ****p<0.0001. H) Quantification of the cross-sectional diameter of ISA sprout at the level of the horizontal myoseptum (HM; dashed red line). WT sib (mean diameter of 6.9±2 μm), het sema3fbca305/+ (8.5±2.7 μm), and hom sema3fbca305 (9.2±2.9 μm)., **p<0.0016 and ***p = 0.0002. F-G) N = 3; WT sib = 11 embryos (n = 86 ISAs), het sema3fbca305/+ = 22 embryos (n = 163 ISAs), and hom sema3fbca305 = 9 embryos (n = 75 ISAs), 2-Way ANOVA Tukey’s multiple comparisons test. Error bars = ±SD.
A) Lateral view of sema3fb expression at 30hpf by ISH. Inset shows expression in the dorsal aorta (DA) and intersegmental arteries (ISAs). B) Schematic representation of the zebrafish vasculature at 30 hpf. Inset: The ISAs sprout from the DA and connect to form the Dorsal Longitudinal Anastomotic Vessel (DLAV) by 30 hpf. C-E) Lateral confocal images of the trunk vasculature (black) of 30 hpf (C) wild type sibling (sib), (D) heterozygous (het) sema3fbca305/+ and (E) homozygous (hom) sema3fbca305 mutants. Gaps in the DLAV (blue asterisks) and truncated ISA sprouts (yellow arrowhead) are noted. Abbreviations: DA (Dorsal Aorta), and PCV (Posterior Cardinal Vein). Anterior, left; Dorsal, up. Scale bar, 100 μm. F) ISA Sprout length at 30 hpf in wild type (WT) sibs (mean length of 106±10 μm), het sema3fbca305/+ (92±19μm), and hom sema3fbca305 (91±18μm), ****p<0.0001. G) Percentage of ISA sprouts connecting to form DLAV at 30 hpf. WT sib (mean 83% connected), het sema3fbca305/+ (50% connected) and hom sema3fbca305 (42% connected), ****p<0.0001. H) Quantification of the cross-sectional diameter of ISA sprout at the level of the horizontal myoseptum (HM; dashed red line). WT sib (mean diameter of 6.9±2 μm), het sema3fbca305/+ (8.5±2.7 μm), and hom sema3fbca305 (9.2±2.9 μm)., **p<0.0016 and ***p = 0.0002. F-G) N = 3; WT sib = 11 embryos (n = 86 ISAs), het sema3fbca305/+ = 22 embryos (n = 163 ISAs), and hom sema3fbca305 = 9 embryos (n = 75 ISAs), 2-Way ANOVA Tukey’s multiple comparisons test. Error bars = ±SD.
Loss of sema3fb results in angiogenic deficits
To investigate the endogenous role of Sema3fb in regulating vessel growth in an intact animal, we used the sema3fb CRISPR mutant with a 19 base pair deletion in exon1 that is predicted to produce a premature truncated protein (32 amino acids in length), deleting most of the Sema domain which is necessary for intracellular signaling [41,42]. To visualize real-time vascular development, we crossed sema3fb loss of function mutants to Tg(kdrl:mCherry) transgenic fish that fluorescently mark endothelial cells, and generated wild type, heterozygote, and mutant siblings. We analyzed angiogenic sprouting at 30hpf when ISA sprouts first connect to form the DLAV (Fig 1B) and observed angiogenic deficits in both sema3fb heterozygotes (Fig 1D) and sema3fb homozygous mutants (Fig 1E) as compared to wild type siblings (Fig 1C). Specifically, we note a significant reduction in the average length of the ISA sprouts at 30 hpf from 106 μm in wild type to 91 μm and 92 μm in heterozygote and homozygote mutant embryos, respectively (Fig 1F). Second, the percentage of ISAs connected at the DLAV is reduced from 80% in wild type to 50% in heterozygote and 40% in homozygote mutants (Fig 1G). Lastly, ventral sprout diameter is increased from 7 μm in wild type to 8.5 μm in heterozygotes and 9 μm in homozygotes (Fig 1H). These data suggest Sema3fb normally promotes angiogenic migration, resulting in stunted wider sprouts when lost.We observed that losing a single mutated allele of sema3fb results in highly penetrant vascular defects in the developing trunk, with a similar magnitude to homozygous loss of the gene. This could result if the loss of function of sema3fb is haploinsufficient. To induce a loss of function by an independent method, we injected 1-cell stage embryos with 1ng of a validated morpholino antisense oligonucleotide (morpholino, MO) against sema3fb [43]. sema3fb morphants have an identical phenotype to sema3fbca305 mutants at 30 hpf, with no additional defects in morpholino-injected sema3fbca305 mutants suggesting that the sema3fb mutant is a loss of function allele (S1 Fig). As a note, haploinsufficiency is also observed for members of the Vegf pathway including the Vegf and Dll4 genes, both critical for angiogenesis.As the sema3fb paralog sema3fa is not expressed in trunk vasculature (S1 Fig), we did not expect the loss of sema3fa to affect ISA growth. Indeed, sema3fa mutants display normal sprouting and connections (S1 Fig). There also does not appear to be genetic compensation by sema3fa, as sema3fa mutants injected with sema3fb morpholino show no additional defects over sema3fb mutants or morphants (S1 Fig). These results suggest that only one of the two zebrafish Sema3f orthologs, sema3fb, regulates angiogenic sprouting in the trunk at this developmental stage.Despite Semaphorin involvement in axon and angioblast guidance in other systems, we find no significant changes in sprout direction between sema3fb heterozygotes or homozygous mutants as observed by the position of sprouts with reference to laminin staining at the myotendinous junctions that separate somites (S2 Fig). Like other angiogenic mutants with stalled migration [44], sema3fb mutant vessels eventually recover, likely through compensation by unknown genes and pathways, with no noticeable differences in vessel patterning at 48 hpf (S3 Fig).We did not expect blood flow to contribute to sema3fb mutant ISA phenotypes as the migration of cells forming primary ISAs between 20–30 hpf occurs independently of blood flow [45,46]. However, as sema3fb mutants have a heart function defect [41] we next tested whether there were effects of blood flow on the phenotype. We injected 1ng of a commonly used translation blocking morpholino against cardiac troponin 2a (tnnt2aMO; [47]) in wild type and sema3fb mutants at the one-cell stage, to limit heart contractility and blood flow. In tnnt2 MO-injected wildtypes, ISA growth is unaffected by the loss of blood flow as previously reported. Similarly, there is no significant difference in vessel growth or numbers of connections in the tnnt2a MO-injected sema3fb mutants as compared to their uninjected counterparts (S2 Fig). These data demonstrate the angiogenic defects in sema3fb mutants at 30 hpf are not a result of modified blood flow. We note that uninjected sema3fb fish show a reduction in the DA diameter (S2 Fig), an effect also seen in tnnt2a morphants. This suggests that axial vessel diameter is sensitive to cardiac output at early time points while sprouting angiogenesis is not. Thus, our data to this point suggest that Sema3fb normally promotes ISA sprouting from the dorsal aorta, with no apparent role in spatial guidance.
Loss of sema3fb disrupts ISA migration and endothelial nuclei morphology
The stunted morphology of sema3fb ISA vessels at 30 hpf suggests there might be delays in EC sprout initiation and/or migration. To examine whether these are impacted by the loss of Sema3fb, we crossed sema3fb
Tg(kdrl:mCherry) fish to the Tg(fli1a:nEGFP) line, which labels endothelial nuclei (Fig 2A). Using time-lapse confocal imaging we tracked ISA vessel elongation between wild type and sema3fb embryos from 25–29 hpf (Fig 2A and 2B). We find no significant difference in sprout initiation from 25.0–25.5 hpf in either wild type or sema3fb mutant ISAs, both having an average length of 54 μm. However, as sprouts begin to elongate, the average ISA migration distance for mutants starts to fall behind wild type distances by 26. 5 hpf and vessels are shorter at all subsequent time points analyzed, with an average 5–9 μm difference in length between wild type and mutant (Fig 2B and S1 Table). ISA angioblast migration speed from 25–26 hpf averages 0.21 μm/min (S4 Fig) and slows to 0.15 μm/min between 26–27 hpf (Fig 2C) before increasing to 0.19 μm/min by 27–28 hpf (Fig 2D) and continues at 0.16 μm/min between 28–29 hpf (Fig 2E). In contrast, the average rate of migration for sem3fb vessels is significantly reduced to an average of 0.12–0.13 μm/min from 25–28 hpf when compared to wild type (Figs 2C, 2D and S4). We also measured the lead angioblast (tip cell) distance from the DA at hourly intervals as a measure of EC motility and similarly find no difference in the distance traveled between wild type and mutant vessels at 25–26 hpf (S4 Fig). There is a significant difference by 27hpf, with an average distance traveled of 55 μm for wild type at 27 hpf (Fig 2F) to 70 μm at 28 hpf (Fig 2G), while mutants only reach 47 μm and 55 μm respectively. By 29 hpf mutants migrate an average of 69 μm from the DA whereas wildtype angioblasts migrate significantly further and reach 85 μm (Fig 2H). Together these data suggest that sprout initiation is normal, but angioblast movement is significantly delayed with loss of sema3fb.Alongside the stunted morphology, we observed that loss of sema3fb resulted in wider vessels (Fig 1H). Previous studies in zebrafish have linked increased ISA width to changes in EC proliferation [48-50]. To determine whether changes in cell number could account for the change in vessel diameter, we assayed ISA sprout formation in the Tg(kdrl:mCherry); (fli1a:nEGFP) lines (Fig 2I). ISA growth follows a stereotypic series of angioblast movements initiated by the migration of an angioblast tip cell from the dorsal aorta followed by a second trailing stalk cell. Once the leading angioblast reaches the horizontal myoseptum, it typically divides and a single daughter cell migrates dorsally to form the DLAV [25,51,52]. This process results in an average of 3–4 endothelial cell nuclei per ISA sprout (Fig 2B). sema3fb mutants and heterozygotes have a similar number of endothelial cells per vessel as wild type animals (Fig 2J). sema3fb morphants also have the same number of endothelial nuclei per vessel as wild type (S4 Fig), suggesting that loss of sema3fb does not affect endothelial cell number.
Fig 2
Loss of sema3fb disrupts ISA migration.
A) Lateral confocal time-lapse images from 25–29 hpf double transgenic Tg(kdrl:mCherry;fli1a:nEGFP) endothelial cells (magenta) and nuclei (white). The location of the horizontal myoseptum (green dashed line) and DLAV (blue dashed line) are noted to highlight ISA growth over time. Scale bar, 50 μm. B) Average ISA Sprout Length at 30-minute intervals from 25–29 hpf: WT vs sema3fbca305 at 25.0 hpf, p = 0.474; at 25.5 hpf p = 0.262; at 26.0 hpf p = 0.081; at 26.5 hpf *p = 0.023; at 27.0 hpf *p = 0.020; at 27.5 hpf **p = 0.030; at 28.0 hpf **p = 0.008; at 28.5 hpf **p = 0.007; at 29.0 hpf *p = 0.024. C-E) Quantification of ISA migration speeds (μm/min). C) At 26–27 hpf WT = 0.15 μm/min and sema3fbca305 = 0.12 μm/min, p = 0.157. D) At 27–28 hpf WT = 0.19 μm/min and sema3fbca305 = 0.13 μm/min, *p = 0.020. E) At 28–29 hpf: WT = 0.16 μm/min and sema3fbca305 = 0.19 μm/min, p = 0.461. B-E) N = 2; WT = 7 embryos (n = 33 ISAs) and sema3fbca305 = 7 embryos (n = 35 ISAs), Unpaired t-test with Welch’s correction. F-H) Lead angioblast distance from DA at 1hr intervals. F) At 27 hpf mean distance from DA: WT = 55.12±14.06 μm and sema3fbca305 = 47.18±5.75 μm, *p = 0.030. G) At 28 hpf mean distance from DA: WT = 71.57±15.47 μm and sema3fbca305 = 55.47±9.65 μm, ***p = 0.0008. H) At 29 hpf mean distance from DA: WT = 85.19±18.03 μm and sema3fbca305 = 68.36±16.64 μm, **p = 0.008. F-H) N = 1: WT = 4 embryos (20 ISAs) and sema3fbca305 = 3 embryos (15 ISAs), Unpaired t-test with Welch’s correction. I) Lateral confocal images of 30hpf double transgenic Tg(kdrl:mCherry;fli1a:nEGFP) endothelial cells (ECs, magenta) and nuclei (white). EC nuclei clumps (blue arrows/arrowheads) are noted. Scale bar, 100 μm. Inset: Schematics show method for measuring distance between EC nuclei and highlight EC nuclei clumps in ISAs. J) Number of EC nuclei (angioblasts) per ISAs at 30 hpf. WT (mean of 3 nuclei/ISA), heterozygous (het) sema3fbca305/+ (3 nuclei/ISA), and homozygous (hom) sema3fbca305 (3 nuclei/ISA). K) Quantification of inter-endothelial nuclei spacing per ISA at 30 hpf. WT (mean 28±13 μm), het sema3fbca305/+ (23±13μm), and hom sema3fbca305 (22±14 μm), ***p = 0.0002 and ****p<0.0001. L) Quantification of Average Area EC fli1a:nEGFP positive nuclei (angioblasts) per ISAs at 30 hpf. WT (mean 49±18 μm2), het sema3fbca305/+ (mean 60±24 μm2), and hom sema3fbca305 (mean 56±23 μm2),**p = 0.0069 and ****p<0.0001. I-L) N = 3; WT = 14 embryos (n = 138 ISAs), het sema3fbca305/+ = 19 embryos (n = 190 ISAs), and homsema3fbca305 = 11 embryos (n = 110 ISAs),. 2-Way ANOVA Tukey’s multiple comparisons test Error bars = ±SD.
Loss of sema3fb disrupts ISA migration.
A) Lateral confocal time-lapse images from 25–29 hpf double transgenic Tg(kdrl:mCherry;fli1a:nEGFP) endothelial cells (magenta) and nuclei (white). The location of the horizontal myoseptum (green dashed line) and DLAV (blue dashed line) are noted to highlight ISA growth over time. Scale bar, 50 μm. B) Average ISA Sprout Length at 30-minute intervals from 25–29 hpf: WT vs sema3fbca305 at 25.0 hpf, p = 0.474; at 25.5 hpf p = 0.262; at 26.0 hpf p = 0.081; at 26.5 hpf *p = 0.023; at 27.0 hpf *p = 0.020; at 27.5 hpf **p = 0.030; at 28.0 hpf **p = 0.008; at 28.5 hpf **p = 0.007; at 29.0 hpf *p = 0.024. C-E) Quantification of ISA migration speeds (μm/min). C) At 26–27 hpf WT = 0.15 μm/min and sema3fbca305 = 0.12 μm/min, p = 0.157. D) At 27–28 hpf WT = 0.19 μm/min and sema3fbca305 = 0.13 μm/min, *p = 0.020. E) At 28–29 hpf: WT = 0.16 μm/min and sema3fbca305 = 0.19 μm/min, p = 0.461. B-E) N = 2; WT = 7 embryos (n = 33 ISAs) and sema3fbca305 = 7 embryos (n = 35 ISAs), Unpaired t-test with Welch’s correction. F-H) Lead angioblast distance from DA at 1hr intervals. F) At 27 hpf mean distance from DA: WT = 55.12±14.06 μm and sema3fbca305 = 47.18±5.75 μm, *p = 0.030. G) At 28 hpf mean distance from DA: WT = 71.57±15.47 μm and sema3fbca305 = 55.47±9.65 μm, ***p = 0.0008. H) At 29 hpf mean distance from DA: WT = 85.19±18.03 μm and sema3fbca305 = 68.36±16.64 μm, **p = 0.008. F-H) N = 1: WT = 4 embryos (20 ISAs) and sema3fbca305 = 3 embryos (15 ISAs), Unpaired t-test with Welch’s correction. I) Lateral confocal images of 30hpf double transgenic Tg(kdrl:mCherry;fli1a:nEGFP) endothelial cells (ECs, magenta) and nuclei (white). EC nuclei clumps (blue arrows/arrowheads) are noted. Scale bar, 100 μm. Inset: Schematics show method for measuring distance between EC nuclei and highlight EC nuclei clumps in ISAs. J) Number of EC nuclei (angioblasts) per ISAs at 30 hpf. WT (mean of 3 nuclei/ISA), heterozygous (het) sema3fbca305/+ (3 nuclei/ISA), and homozygous (hom) sema3fbca305 (3 nuclei/ISA). K) Quantification of inter-endothelial nuclei spacing per ISA at 30 hpf. WT (mean 28±13 μm), het sema3fbca305/+ (23±13μm), and hom sema3fbca305 (22±14 μm), ***p = 0.0002 and ****p<0.0001. L) Quantification of Average Area EC fli1a:nEGFP positive nuclei (angioblasts) per ISAs at 30 hpf. WT (mean 49±18 μm2), het sema3fbca305/+ (mean 60±24 μm2), and hom sema3fbca305 (mean 56±23 μm2),**p = 0.0069 and ****p<0.0001. I-L) N = 3; WT = 14 embryos (n = 138 ISAs), het sema3fbca305/+ = 19 embryos (n = 190 ISAs), and homsema3fbca305 = 11 embryos (n = 110 ISAs),. 2-Way ANOVA Tukey’s multiple comparisons test Error bars = ±SD.Analysis of the distance between endothelial nuclei, however, revealed a significant decrease in the spacing between endothelial cell nuclei in sema3fb mutants (Fig 2I and 2K). Reduced spacing gives the appearance of nuclear clumps. Clump location below the horizontal myoseptum correlates with an increased width of ISAs (Fig 1H). We also find that endothelial nuclei are significantly larger in mutants than in wild type controls, increased from an average of 49 μm2 in wild type to 60 μm2 heterozygous and homozygous mutants (Fig 2L). The increase in nuclear size is also observed in sema3fb morphants (S4 Fig). Taken together, this data suggests that sema3fb mutant sprouts have the correct number of cells, can migrate along the correct path, but do not migrate as far as wild type sprouts. By 30hpf, stalled growth disrupts ISA elongation resulting in aberrant cell and nuclear morphology.
sema3fb mutants display persistent filopodia
As Sema3F signaling controls actin dynamics, we reasoned that angioblast migration defects might also be accompanied by a change in filopodia activity. As ISAs begin to connect by 28 hpf, through a process termed anastomosis, actin-rich filopodia projections resolve to allow stable vessel connections forming a patent DLAV. In sema3fb mutants, a small proportion of ISAs can reach and connect to form the DLAV by 30 hpf (Fig 1G). To assay whether loss of sema3fb can impact the vessel connection process, we injected wild type and sema3fb mutants with an endothelial-specific F-actin reporter, Tol2(fli1Lifeact-EGFP), in which filamentous actin (F-actin), a major component of the cytoskeleton, is labeled with GFP to visualize filopodia on migrating endothelial cells (Figs 3A and S5). We selected GFP positive ISA sprouts that have reached the level of the DLAV, and assayed filopodia above the horizontal myoseptum but below the DLAV (S5 Fig) to capture filopodia projections along the upper segment of each ISA. These filopodia should rapidly disappear once the ISV is connected from around 28 hpf. Time-lapse confocal imaging of mosaically labeled sprouts from 28–30 hpf in stage-matched embryos revealed that wild type sprouts have filopodia when they first reach the DLAV but filopodial numbers gradually reduce over time as the cells lumenize and become quiescent once connected to neighboring vessels (Figs 3B and S5). At 28hpf, wild type and sema3fb mutants have the same number of filopodia per ISA (average of 9 filopodia). By 29hpf, wild type sprouts have an average of 5 filopodia, while sema3fb mutants have 7. By 30hpf, there is an average of 4 filopodia remaining in wild type, while sema3fb mutants maintain comparable numbers to the earlier time points (Fig 3B and 3C). These data suggest that in the few sprouts of sema3fb mutants that reach the DLAV, cells fail to restrict filopodia formation at the appropriate time.
Fig 3
sema3fb mutants display aberrant and persistent filopodia in the dorsal ISA.
A) Lateral images of the trunk vasculature with mosaic endothelial expression of the transgene fli1ep: Lifeact-EGFP highlighting actin (green) and endothelial cytoplasm using Tg(kdrl:mCherry; white) in ISAs at 30 hpf. DLAV gaps (blue asterisks) and truncated ISA sprouts (yellow arrowheads) are marked. Inset shows an enlarged view of single ISAs with Lifeact-EGFP expression that have reached the level of DLAV at 30hpf. Scale bar, 100 μm. B) Representative still images from time-lapse imaging from 28–30 hpf. Enlarged still images of stage-matched embryos with mosaic Lifeact-EGFP (green) in endothelial cells spanning the ISA and reaching the level of the DLAV by 28 hpf in both wild type and sema3fbca305 embryo. Endothelial cytoplasm is shown in red Tg(kdrl:mCherry). White arrowheads indicate filopodia present in connecting ISA sprouts within the boxed regions below the DLAV. C) Quantification of number Lifeact-EGFP positive filopodia on ISAs from 28–30 hpf from embryos of the indicated genotypes. N = 3: WT (14 EGFP positive ISAs/ 30 ISAs total, 6 embryos, mean of 4 filopodia/ISA) and homozygous sema3fbca305 (18 EGFP positive ISAs/35s ISAs total, 7 embryos, mean of 7 filopodia/ISA). Unpaired t-test with Welch’s correction,*p = 0.03 and ***p = 0.0002. Error bars = ±SD.
sema3fb mutants display aberrant and persistent filopodia in the dorsal ISA.
A) Lateral images of the trunk vasculature with mosaic endothelial expression of the transgene fli1ep: Lifeact-EGFP highlighting actin (green) and endothelial cytoplasm using Tg(kdrl:mCherry; white) in ISAs at 30 hpf. DLAV gaps (blue asterisks) and truncated ISA sprouts (yellow arrowheads) are marked. Inset shows an enlarged view of single ISAs with Lifeact-EGFP expression that have reached the level of DLAV at 30hpf. Scale bar, 100 μm. B) Representative still images from time-lapse imaging from 28–30 hpf. Enlarged still images of stage-matched embryos with mosaic Lifeact-EGFP (green) in endothelial cells spanning the ISA and reaching the level of the DLAV by 28 hpf in both wild type and sema3fbca305 embryo. Endothelial cytoplasm is shown in red Tg(kdrl:mCherry). White arrowheads indicate filopodia present in connecting ISA sprouts within the boxed regions below the DLAV. C) Quantification of number Lifeact-EGFP positive filopodia on ISAs from 28–30 hpf from embryos of the indicated genotypes. N = 3: WT (14 EGFP positive ISAs/ 30 ISAs total, 6 embryos, mean of 4 filopodia/ISA) and homozygous sema3fbca305 (18 EGFP positive ISAs/35s ISAs total, 7 embryos, mean of 7 filopodia/ISA). Unpaired t-test with Welch’s correction,*p = 0.03 and ***p = 0.0002. Error bars = ±SD.
VEGF signaling is altered in sema3fb mutants
To investigate the molecular mechanisms controlling migration downstream of sema3fb we assayed gene expression in FACS-sorted Tg(kdrl:mCherry) wildtype and sema3fb mutant endothelial cells by Taqman RT-qPCR. We analyzed the expression of a key set of endothelial cell markers that regulate angiogenic sprouting (Figs 4A and S6). Analysis of FACs-sorted endothelial cells reveals a 4.3-fold increase in vegfr2/kdrl and a 2.3-fold increase in dll4 in sema3fb mutant endothelial cells as compared to controls. Comparison of the fluorescence intensity of transgenic Tg(kdrl:mCherry) also revealed a significant increase in mCherry fluorescence in live sema3fbca305 mutants (S6 Fig). We find no significant difference in notch2 or jagged1a or the vegfr2 ligand vegfab expression (Fig 4A). Surprisingly, we also find a significant near 3-fold increase in the expression of the decoy receptor soluble vegfr1/soluble flt1 (sflt1) in mutants as compared to controls (Fig 4B). As an independent experiment, we confirmed upregulated vegfr2 and sflt1 expression in mutants using quantitative fluorescent ISH (FISH) (Fig 4B and 4C). We next assayed the expression of Phospho-ERK (pERK), a downstream effector of VEGF signaling in vascular sprouting. Although there is no difference in the number of ISAs with a positive pERK signal between wildtype and mutant (Fig 4D and 4E), we find that there is a significant increase in fluorescent intensity of pERK positive EC nuclei in mutant ISV angioblasts (Fig 4D and 4F), which is supportive of increased Vegfr2 pathway activity in ECs (Fig 4D and 4E). These data suggest the loss of Sema3fb results in upregulation of both VEGF-pathway promoting (vegfr2/dll4) and VEGF-inhibiting (sflt1) genes in endothelial cells, which could account for disrupted angioblast migration.
Fig 4
sema3fb mutants have increased VEGF receptor expression and activity.
A) RT-qPCR analysis of key endothelial markers in wild type and sema3fbca305 FACS isolated Tg(kdrl:mCherry) positive endothelial cells at 26hpf (inset). N = 2, 2-Way ANOVA Tukey’s multiple comparisons test, *p = 0.0184, **p = 0.0021, and ****p<0.0001 (Refer to S3 Table for fold-change details). B) Fluorescent HCR in situ of 30 hpf whole-mount wild type and embryos sema3fbca305 embryos. Representative images show punctate overlapping expression of vegfr2 (white) and sflt1 (red) mRNA transcripts within the DA and ISAs (dashed white outline). C) Quantification of HCR in situ pixel density in ISAs and DA, wild type (WT, n = 3 embryos, 15 ISAs) and sema3fbca305 (n = 3 embryos, 15 ISAs), Unpaired Student’s t-test with Welch’s correction WT vs. sema3fbca305: vegfr2 *p = 0.047 and sflt1 *p = 0.036. D) Whole-mount Immunostaining for phosphoERK (pERK) in WT and sema3fbca305 embryos fixed at 30 hpf. Representative images show Tg(kdrl:mCherry) positive ISAs (purple) and pERK positive ECs (green). Inset: pERK positive ISAs are traced using kdrl:mCherry expression (dashed white line) and dashed oval outlines highlight individual ECs with pERK staining within each ISA. E) Number of pERK positive ISAs at 30hpf. F) Quantification of average pERK fluorescence intensity in embryos at 30 hpf. D-E) N = 3, WT (n = 21 embryos, mean of 5 pERK positive ISAs), and homzygous sema3fbca305 (n = 19 embryos, mean of 5 pERK positive ISAs). 2-Way ANOVA Tukey’s multiple comparisons test, *p = 0.012. G) Schematic of Vegfr2 inhibition time course, embryos are treated at 20 hpf with either 0.1%DMSO or Vegfr2 inhibitors and removed from treatment for live imaging at 30hpf. H) Representative confocal images of trunk vasculature (black) of 30 hpf embryos treated with DMSO control or 0.2 μM SU5416. DLAV gaps (blue asterisks) and truncated ISA (yellow arrowheads) are marked. Scale bar, 100 μm. I) Length of ISA sprouts in treated embryos at 30 hpf: WT + DMSO (n = 25 ISAs, mean of 104±9 μm), WT + 0.2 μM SU5416 (n = 25 ISAs, mean of 92±17 μm), sema3fbca305 + DMSO (n = 30 ISAs, mean of 85±17 μm), and sema3fbca305 + 0.2μm SU5416 (n = 30 ISAs, mean of 98±11 μm) **p = 0.0039 and ****p<0.0001. J) Percentage of ISA sprouts connected at DLAV in treated embryos at 30 hpf. WT + DMSO (n = 25 ISA-DLAV, 5 embryos, mean 88±11%), WT + 0.2μM SU5416 (n = 25 ISA-DLAV, mean 32±11%), sema3fbca305 + DMSO (n = 30 ISA-DLAV, mean 46±16%), and sema3fbca305 +0.2 μm SU5416 (n = 30 ISA-DLAV, mean 73±10%), **p = 0.0084, ***p = 0.0002, and ****p<0.0001. I-J N = 2; WT+DMSO = 5 embryos, WT + 0.2 μM SU5416 = 5 embryos, sema3fbca305 + DMSO = 6 embryos, sema3fbca305 + 0.2 μm SU5416 = 6 embryos,. 2-Way ANOVA Tukey’s multiple comparisons test. Error Bars = ±SD.
sema3fb mutants have increased VEGF receptor expression and activity.
A) RT-qPCR analysis of key endothelial markers in wild type and sema3fbca305 FACS isolated Tg(kdrl:mCherry) positive endothelial cells at 26hpf (inset). N = 2, 2-Way ANOVA Tukey’s multiple comparisons test, *p = 0.0184, **p = 0.0021, and ****p<0.0001 (Refer to S3 Table for fold-change details). B) Fluorescent HCR in situ of 30 hpf whole-mount wild type and embryos sema3fbca305 embryos. Representative images show punctate overlapping expression of vegfr2 (white) and sflt1 (red) mRNA transcripts within the DA and ISAs (dashed white outline). C) Quantification of HCR in situ pixel density in ISAs and DA, wild type (WT, n = 3 embryos, 15 ISAs) and sema3fbca305 (n = 3 embryos, 15 ISAs), Unpaired Student’s t-test with Welch’s correction WT vs. sema3fbca305: vegfr2 *p = 0.047 and sflt1 *p = 0.036. D) Whole-mount Immunostaining for phosphoERK (pERK) in WT and sema3fbca305 embryos fixed at 30 hpf. Representative images show Tg(kdrl:mCherry) positive ISAs (purple) and pERK positive ECs (green). Inset: pERK positive ISAs are traced using kdrl:mCherry expression (dashed white line) and dashed oval outlines highlight individual ECs with pERK staining within each ISA. E) Number of pERK positive ISAs at 30hpf. F) Quantification of average pERK fluorescence intensity in embryos at 30 hpf. D-E) N = 3, WT (n = 21 embryos, mean of 5 pERK positive ISAs), and homzygous sema3fbca305 (n = 19 embryos, mean of 5 pERK positive ISAs). 2-Way ANOVA Tukey’s multiple comparisons test, *p = 0.012. G) Schematic of Vegfr2 inhibition time course, embryos are treated at 20 hpf with either 0.1%DMSO or Vegfr2 inhibitors and removed from treatment for live imaging at 30hpf. H) Representative confocal images of trunk vasculature (black) of 30 hpf embryos treated with DMSO control or 0.2 μM SU5416. DLAV gaps (blue asterisks) and truncated ISA (yellow arrowheads) are marked. Scale bar, 100 μm. I) Length of ISA sprouts in treated embryos at 30 hpf: WT + DMSO (n = 25 ISAs, mean of 104±9 μm), WT + 0.2 μM SU5416 (n = 25 ISAs, mean of 92±17 μm), sema3fbca305 + DMSO (n = 30 ISAs, mean of 85±17 μm), and sema3fbca305 + 0.2μm SU5416 (n = 30 ISAs, mean of 98±11 μm) **p = 0.0039 and ****p<0.0001. J) Percentage of ISA sprouts connected at DLAV in treated embryos at 30 hpf. WT + DMSO (n = 25 ISA-DLAV, 5 embryos, mean 88±11%), WT + 0.2μM SU5416 (n = 25 ISA-DLAV, mean 32±11%), sema3fbca305 + DMSO (n = 30 ISA-DLAV, mean 46±16%), and sema3fbca305 +0.2 μm SU5416 (n = 30 ISA-DLAV, mean 73±10%), **p = 0.0084, ***p = 0.0002, and ****p<0.0001. I-J N = 2; WT+DMSO = 5 embryos, WT + 0.2 μM SU5416 = 5 embryos, sema3fbca305 + DMSO = 6 embryos, sema3fbca305 + 0.2 μm SU5416 = 6 embryos,. 2-Way ANOVA Tukey’s multiple comparisons test. Error Bars = ±SD.To test whether the angiogenic defects in sema3fb mutants are the result of increased Vegfr2 activity, we treated wild type and sema3fb mutant embryos with 0.5 μM SU5416, a selective Vegfr2 inhibitor, from 20–30 hpf (Fig 4G). Inhibitor-treated wild type embryos have stunted sprouts as reported (104 μm in untreated wildtype vs. 50 μm in treated wild type embryos), but sema3fb mutants are unaffected with no significant changes in sprout length (average length 82 μm in both treated and untreated mutants; S6 Fig). This suggests that increased vegfr2 expression in sema3fb mutants renders them less sensitive to pharmacological Vegfr2 inhibition as compared to wild type embryos. However, we reasoned that this inhibitor dose severely disrupts VEGF signaling and vessel growth and may mask more subtle changes in sprout dynamics. Therefore, we lowered the SU4516 concentration to a sub-optimal dose that others have used (low-dose: 0.2μM SU5416) to induce minimal angiogenic deficits (Fig 4H) [53]. As expected, in wild type embryos low-dose treatment results in a mild reduction in sprout length from 104 μm to 92 μm and a 60% decrease in the number of ISA connections to the DLAV (Fig 4I and 4J). However, in sema3fb mutants, sub-optimal Vegf inhibition significantly rescues sema3fb mutant defects. The length of ISAs in treated sema3fb mutants increases to 98 μm from an average of 85 μm in untreated mutants, restoring them to an ISA length indistinguishable from wildtype (Fig 4I). Connections at the DLAV are also significantly increased from 46% in untreated mutants to 73% in treated embryos, which is comparable to untreated wild types and significantly increased beyond treated wildtypes. (Fig 4J). We also applied a second VEGF inhibitor, DMH4 at a low dose to partially block ISA growth [54,55]. Similar to SU4516 treatment, wild type vessels have decreased in length following treatment with DMH4. Interestingly, although treatment with 15 μM or 25 μM DMH4 also reduces vessel length in sema3fb mutants, ISAs are still able to sprout an average 23 μm or 35 μm further than the treated wild type vessels, at each dose respectively (S6 Fig). Thus, slight reductions in Vegfr2 activity can restore sema3fb endothelial migration. Our data shows that the increase in vegfr2 expression in sema3fb mutants has functional consequences on sprout migration.
Discussion
Vegf activity must be tightly regulated during embryonic development and homeostasis [18,56-59]. This control is exquisite, and the zebrafish model has uncovered many regulatory layers of Vegfr2 pathway activity in endothelial cells [14,48,60]. Here we find that sema3fb offers an additional layer of control to VEGF signaling. Zebrafish sema3fb mRNA is expressed by developing trunk angioblasts. Loss of sema3fb stalls vessel migration and disrupts ISA morphology, resulting in wider and shorter ISAs in which nuclei are clumped and larger. Expression analysis revealed upregulation of vegfr2 and dll4 and a significant increase in pERK staining intensity in mutant endothelial cells. We also observed upregulation of an inhibitory molecule svegfr1/sflt1 in mutant endothelium, suggesting sema3fb signaling also normally represses sflt1 expression. Taken together, our results from an intact animal model suggest Sema3fb acts in an autocrine manner to regulate Vegf-mediated angiogenesis (Model; Fig 5).
Fig 5
Model of sema3fb action in sprouting vessels.
Sema3fb is expressed by endothelial cells during angiogenic sprout formation and acts through an autocrine mechanism to suppress Vegfr2 expression and maintain endothelial cell dynamics via controlling Dll4 expression and Notch signaling in addition to modulation of pERK. Loss of sema3fb increases Vegfr2, pERK, Dll4, and sFlt1 expression. This results in aberrant cellular morphology with wider sprouts, persistent filopodia, and larger nuclei. The changes in nuclear size and disrupted sprouting suggest a possible role for Sema3b to limit Vegf-mediated induction of downstream pERK signaling.
Model of sema3fb action in sprouting vessels.
Sema3fb is expressed by endothelial cells during angiogenic sprout formation and acts through an autocrine mechanism to suppress Vegfr2 expression and maintain endothelial cell dynamics via controlling Dll4 expression and Notch signaling in addition to modulation of pERK. Loss of sema3fb increases Vegfr2, pERK, Dll4, and sFlt1 expression. This results in aberrant cellular morphology with wider sprouts, persistent filopodia, and larger nuclei. The changes in nuclear size and disrupted sprouting suggest a possible role for Sema3b to limit Vegf-mediated induction of downstream pERK signaling.In cultured endothelial cells, the anti-angiogenic effects of SEMA3F are primarily mediated through competitive binding of SEMA3F to NRP2 to antagonize VEGF-induced proliferation and migration, as observed in both cultured human umbilical vein endothelial cells (HUVECs) [61,62] and porcine aortic endothelial cells [63]. The SEMA3F-NRP pathway generally also opposes VEGF activity in tumor models, where a loss of SEMA3F leads to gross vessel overgrowth [29,63]. However, in our intact zebrafish sema3fb loss of function model, we were surprised to find reduced vessel growth despite upregulation of the vegfr2 gene and an increase in Vegfr2 activity. We find that inhibiting VEGF signaling rescued endothelial migration, suggesting that upregulation of Vegf signaling contributes to the observed phenotype. Intriguingly, the stunted sprout morphology of sema3fb mutants is also reflective of the phenotype reported for a gain of function for the inhibitory molecule sflt1 [58]. Plexin-Semaphorin signaling is complex, with multiple co-expressed ligands and receptors present in cells that can mediate either additive or opposing effects. The Plexin receptor for Sema3f in zebrafish is not yet known, but in cell culture, Sema3F binds to PlexinA family receptors. PlexinD1 is a major endothelial cell receptor for other Sema3’s (Sema3A, Sema3E) in mouse and has an exuberant angiogenic sprouting phenotype when lost. The fish sema3fb mutant phenotype appears opposite to that of plexind1 loss of function [22,52]. Further, both sema3fb and plexind1 regulate the expression of the decoy receptor sflt1, but in opposing, directions, suggesting their signaling has opposing action on common downstream pathways to fine-tune angiogenesis.Increases in VEGF activity are reported to paradoxically increase both pro-angiogenic signaling via Dll4 as well as the expression of anti-angiogenic molecules such as sFlt1 in cell culture models [53]. Where excessive VEGFR-2 stimulation is reported to increase sFLT1 expression in HUVECs to limit inappropriate vessel growth [64,65]. If this feedback regulation is also at play in zebrafish, reducing excessive Vegfr2 activity in sema3fb mutants would be expected to decrease levels of sFlt1, thus allowing sprouting to occur. It is not obvious from the results of our expression analysis whether the stalled vessel phenotype occurs from an increase in Vegf signaling (upregulated vegfr2 and pERK) or inhibited Vegf signaling (increased sflt1). Although we demonstrate that reducing Vegf signaling rescues the angioblast migration defect, we lack the tools to test protein levels of sFlt1, which might have distinct regulation, apart from the mRNA levels we could measure here. The sFlt1 protein might contribute to our observed phenotype in ways that we cannot assess in vivo. For instance, the relative abundance of ligands (Sema3f), receptors (Nrp and Plexin), and co-receptor (Nrp2, note this is also a Vegfr2 co-receptor) present in a sprouting endothelial cell may influence intrinsic signaling responses. Increased sflt1 mRNA may result in increased sFlt1 protein expression downstream of Vegfr2 upregulation, similar to what is observed in HUVEC cells [64]. However, increased mRNA may not result in increased protein, and protein subcellular localization may also play a role in the signaling. For instance, Vegf directly controls the expression of PlexinD1 to spatially restrict endothelial tip cell responses to Sema3e in retinal murine models [24]. Further, in cell culture models, there is higher SEMA3F expression on the leading edge of the cell that may influence directional tip cell migration of HUVECs [61,66].Semaphorins traditionally play guidance roles to control vessel patterning. Interestingly, loss of Sema3fb does not affect spatial guidance during early angiogenesis. This either suggests that Sema3f signals through a different receptor or is one of several ligands of PlexinD1 in zebrafish, with other ligands conveying spatial guidance information. Indeed the synergy between Sema3A and Sema3F in HUVECs [36], suggests a combination of ligands more effectively antagonizes VEGF-mediated migration, and thus multiple Sema3s may control both the growth and trajectory of a sprout in the zebrafish trunk [67]. Studies in mouse and zebrafish demonstrate that inhibition of VEGFR2 results in dysregulation of actinomycin contractility necessary for endothelial cell elongation and vessel connections [68,69], similar to the phenotype we observe in sema3fb mutants. Sequestration of VEGF by SFLT1 further diminishes cell responses to limit endothelial cell size and actin rearrangements [70-72].In cultured cells, exogenous SEMA3F controls F-actin/stress fiber formation, cell size, and elongation through disrupting the mTOR-RHOA/GTPase axis [30]. Although filopodia are dispensable for sprout initiation in zebrafish, assembly of F-actin into filopodia influences the speed, direction of migration, and anastomosis of endothelial cells into a connected vessel bed [73,74]. We observe that filopodia persist in sema3fb mutants (i.e., are abnormally stable). Loss of sema3fb may therefore hinder a pathway that destabilizes filopodia and vessel anastomosis may be impeded by underlying actin assembly defects. This is in line with the classic definition of Semas in regulating cell size and collapse of the cytoskeleton [11,75]. Our data applies to the role of Sema3fb in the initial formation and early elongation of ISA sprouts. In later development, RhoA- dependent mechanisms [76] control arterial lumen diameter and remodeling in response to changes in Vegf bioavailability and sFlt localization. Sema3fb may therefore have additional roles in regulating structural vessel adaptations; however, we were unable to assay late changes to vessel morphology in sema3fb mutants as they recover by this stage.Here we demonstrate an autocrine role for Sema3f to modulate Vegf function in vivo. Together, our data suggest that Sema3fb acts to limit both positive (Vegfr2) and negative (sFlt1) signals, allowing endothelial cells to adopt an appropriate level of signaling downstream of Vegfr2 (Fig 5). Our data highlights a delicate balance of stop-go signals that can toggle the endothelial migration activity necessary for vessel growth. Together this work offers insight into understanding how context-dependent Sema3F modulation of endothelial responses to Vegf can be used to treat vascular disorders.
Materials and methods
Ethics statement
All animal procedures were approved by the University of Calgary Animal Care Committee (AC17-0189). Anesthesia and euthanasia used MS-222 (Tricaine) at 10–40 mg/L. Raw data underlying all graphs in the manuscript can be found in S1 Data.
Zebrafish strains and maintenance
Wild type Tupfel longfin (TL) zebrafish or transgenic Tg(-6.5kdrl:mCherry), Tg(fli1a:nEGFP) [50], sema3fa [35], and sema3fb [43] were used for experiments. Embryos were collected within 10-minute intervals and incubated at 28.5°C in E3 embryo medium (E3) and staged in hours post-fertilization (hpf). Endogenous pigmentation was inhibited from 24 hpf by the addition of 0.003% 1-phenyl-2-thiourea (PTU, Sigma-Aldrich, St. Louis, MO) to E3.To genotype, tissue was collected from single 30 hpf embryos following blinded imaging. Genomic DNA was extracted in 50μl of 50mM NaOH, boiled for 10 minutes and buffered with 1/10 volume of 100mM Tris-HCl pH 7.4, as described in [77] and amplified by PCR (as described by [43]) using the following primers: sema3fb forward (5’-ATTGCCCCACAAAATAACATTC-3’) and sema3fb reverse (5’-GTCTACTCTGTGAATTTCCCGC-3’).
Morpholino and fli:lifeact injections
Morpholinos (MO) against the sema3fb start codon (sema3fbATG; ATG underlined) 5’- CATAGACTGTCCAAGAGCATGGTGC-3’ and against the tnnt2a start codon (tnnt2aATG, ATG underlined) 5’- CATGTTTGCTCTGATCTGACACGCA– 3’ were obtained from Gene Tools LLC (Corvallis, OR, USA). Morpholinos were injected into one- to four-cell stage embryos within recommended dosage guidelines at 1ng/ embryo [78,79]. For endothelial-specific expression of Lifeact, a Tol2 construct using the Fli1ep promoter driving the expression of Lifeact-EGFP, fli1Lifeact-EGFP [73], was injected into one-cell stage embryos at 20 ng/μl plasmid with 25 ng/μl Tol2 transposase RNA.
FAC sorting, RNA isolation, and RT-qPCR
For FACS analysis, 24 hpf Tg(kdrl:mCherry) wild type or mutant embryos were subjected to single-cell dissociation according to [80]. Briefly, embryos were washed once with calcium-free Ringers Solution and gently triturated 5 times before dissociation solution was added and incubated in a 28.5°C water bath with shaking and periodic trituration for 20–30 min. The reaction was stopped, centrifuged, and resuspended in Dulbecco’s Phosphate-Buffered Saline (GE Healthcare Life Sciences, Logan, Utah, USA), centrifuged and resuspended in fresh resuspension solution. The single-cell suspension was filtered with 75 μm, followed by 35 μm filters. Cells were sorted with a BD FACSAria III (BD Bioscience, San Jose, USA) and collected. Total RNA from 24hpf whole embryos or FACS sorted cells was isolated using the miRNeasy Mini Kit (Qiagen). 500 ng of total RNA from each sample was reverse transcribed into cDNA using SuperScript III First-Strand Synthesis SuperMix (18080–400; Invitrogen). cDNA in a 5ng/ 10ul final reaction was used in a TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific, Massachusetts, U.S). Reactions were assayed using a QuantStudio6 Real-time system (Thermo Fisher Scientific). Zebrafish specific Taqman assays (Thermo Fisher Scientific, Waltham, Massachusetts, USA) were used: vegfab (Cat# 4448892, Clone ID: Dr03072613_m1), kdrl(vegfr2) (4448892, Dr03432904_m1), dll4 (4448892,Dr03428646_m1), notch2 (4448892, Dr03436779_m1), jag1a (4448892, Dr03093490_m1), sflt1 (4331448, ADP47YD4) and normalized to β-actin (4448489, Dr03432610_m1). The ΔΔCt method was used to calculate the normalized relative expression level of a target gene from triplicate measurements. Experiments were repeated three times independently unless stated otherwise.
Drug treatments
For Vegfr2 inhibition, a 200 μM SU5416 (Sigma #S8442) stock solution in DMSO (Sigma #D8418) or a 100 μM DMH4 (Sigma #8696) stock solution in DMSO was diluted to working concentrations in fish water. For SU5416 final concentrations of 0.2 μM SU5416 and 0.5 μM in 0.1% DMSO were used as described in [53,56,81]. For DMH4 15 μM and 25 μM in 0.1% DMSO was used as described in [54,55]. Embryos were treated from 20 to 30 hpf to target both ISA and DLAV angiogenesis. WT and homozygous sema3fbca305 mutant embryos were manually dechorionated before receiving the SU5416 or DMH4 and control (0.1% DMSO) treatments using a common solution for both genotypes.
In situ hybridization and immunostaining
All embryos were fixed in 4% paraformaldehyde in PBS with 0.1% Tween-20 at 4°C overnight, followed by 100% methanol at −20°C.For colorimetric in situ hybridization (ISH) Digoxigenin (DIG)-labeled antisense RNA probes were synthesized using SP6 or T7 RNA polymerase (Roche, Basel, Switzerland). Digoxigenin RNA probes were generated from plasmid template (sema3fa—pCR4, linearized with PmeI) (sema3fb—pCR4, linearized with NotI). Wholemount and section in situ hybridization were performed as described by [82] with some minor modifications: steps with gradient changes in hybridization buffer: 2 x SSC: and 0.2 x SSC:PBST were carried out at 70°C and 0.2 x SSC at 37°C. NBT/BCIP was used at a 2.5/3.5μl/ml ratio, respectively. Stained embryos were transferred to microcentrifuge tubes, fixed in 4% paraformaldehyde (PFA), and washed in 1 x PBST before imaging. For transverse sections of the trunk, following wholemount ISH embryos were embedded in JB4 medium (PolySciences, Warrington, PA). Briefly, embryos were fixed in 4% PFA overnight at 4°C, washed in PBS, and dehydrated in 100% EtOH. Following dehydration, embryos were soaked in infiltration solution (2-hydroxyethyl methacrylate/benzoyl peroxide) until they sank to the bottom of the tube and then transferred and positioned in molds filled with embedding solution (infiltration with N-Dimethylaniline), allowed to harden overnight, and sectioned at 7 μm using a Leica microtome.For Hybridization Chain Reaction (HCR) in situ hybridization, custom probes were obtained from Molecular Instruments (Los Angeles, CA) for soluble Flt1 (targeted to the unique region of the gene) and VEGFR2. The in-situ staining reactions were as recommended by the manufacturer.For antibody staining, embryos were permeabilized in 50:50 acetone/methanol for 20 minutes, rehydrated at room temperature, and then blocked in 10% normal sheep serum in PBST with 1% triton, and incubated for at least 48 hours at 4°C in primary antibody. Immunostaining for Laminin (1:400, Sigma-Aldrich, Missouri, United States), mCherry (1:200, Developmental Studies Hybridoma Bank, Iowa City, United States), and phosphoERK (pERK) (1:500, Cell Signaling 43701:Danvers, MA, USA) were detected with mouse anti-mCherry antibody, (1:500, Clontech, Mountain View, California, USA) and detected with Alexafluor 555 or 488 secondary antibodies (1:500; Invitrogen), for 1 hour at RT in 5% NSS/PBST/0.1% triton.
Image acquisition and measurements
For wholemount imaging, embryos were immobilized in 0.004% Tricaine (Sigma) and mounted in 0.8% low melt agarose on glass-bottom dishes (MatTek, Ashland, MA). Confocal images were collected on a Zeiss LSM 700 inverted microscope. Slices 1–3 μm apart were gathered and processed in Zen Blue 2012 software and presented as maximal intensity projections (z-stacks, total of 10–15 slices per embryo/image), and analyzed using FIJI/ImageJ [83].For time-lapse, z-stacks were acquired every 10–30 min for 5 hours, from 25 hpf—29 hpf. ZEN Blue 2012 software was used to extract timepoints and image processing/measurements were performed using Fiji (ImageJ).Unless otherwise, ISA measurements were performed on at least 8 ISAs per embryo. ISA length measurements were made with a segmented line tool along the vessel from the edge of the aorta to the leading edge of the spout. To calculate the % connected, each ISA connection to its neighboring sprout was counted and expressed as a percentage of the total number of ISA counted. For ISA sprout diameter, 5 sprouts were measured at the boundary of the horizontal myoseptum. For DA and PCV measurements, 5 measurements were taken along the DA and PCV, directly below the ISAs above the yolk extension. For endothelial cell nuclei spacing, 2 measurements were taken from the middle of each nucleus to the next nucleus. To measure fluorescent kdrl:mCherry intensity, total fluorescence (TF) was calculated using the formula: TF = Integrated Density—(Area of selected cell X Mean fluorescence of background readings). The area for measurement was gated by tracing 5 ISVs above the yolk extension.For angioblast migration and ISA speed calculations, analysis was from images obtained at 30min intervals from 25 hpf– 29hpf. For ISA length over time, 5 ISAs were measured per embryo (as described above) at each extracted timepoint. For ISA migration speed, changes in ISA length were compared at 1hr intervals, 25 (T1)– 26(T2) hpf, 26 (T2)- 27(T3) hpf, 27(T3)– 28(T4) hpf, and 28 (T4)– 29 (T5) hpf, and distance traveled was calculated using the formula Distance = End Length (μm)–Start Length (μm). (e.g., Distance from 25–26 hpf = Length at T2 –Length at T1). The speed of ISA migration at each interval was calculated using the formula Speed = Distance (μm) /Time (min) (See S1 and S2 Tables) For lead angioblast migration, the distance of a fli1a:nEGFP positive nucleus from the DA was measured at 1-hour intervals from 25–29 hpf.
Statistics
All data sets for quantitation (qualitative scorings or absolute measurements) were analyzed blinded. Results are expressed as mean ± SD. All statistical analysis was performed using Prism 7 software (Graph Pad). Unpaired, nonparametric tests were used for all statistical tests, either the Student T-test with Welch’s correction for comparisons of two samples, or Two-Way ANOVA with a Kruskal-Wallis test for comparisons between multiple samples.
sema3f expression and sema3fa mutant phenotype.
A) Lateral view of whole-mount ISH from 26-30hpf shows sema3fa expression in the ventral lateral somites and sema3fb expression in the dorsal aorta (DA) and intersegmental arteries (ISAs). HM: Horizontal Myoseptum. B) Expression of sema3fa and sema3fb in transverse sections of the trunk at 28hpf. sema3fa is expressed in ventral and lateral somite (arrows) while sema3fb is strongly expressed in the DA (arrowhead), Neural tube (nt), notochord (nc). C) Lateral confocal images of trunk vasculature (black) of 30hpf control wild type (WT), homozygous sema3fa and sema3fb mutant embryos with and without injection of 1ng sema3fbATG-MO. Scale bar, 100 μm. n/N = number of embryos with angiogenic defects/Total number of embryos. D) Length of ISA sprouts in WT, sema3fbATG-MO morphants and sema3fb
knockdown embryos with sema3fbATG-MO at 30 hpf; N = 1, WT = 2 embryos (10 ISAs, mean 105±7 μm), sema3fbATG-MO = 5 embryos (25 ISAs, mean of 78±20 μm), and sema3fb + sema3fbATG-MO 5 embryos (25 ISAs, mean 87±15 μm), ****p<0.0001. E) Length of ISA sprouts in WT and sema3fa mutant and embryos with sema3fbATG-MO at 30 hpf; N = 2, 6 embryos per group: WT (30 ISAs, mean 109±7 μm), sema3fa (28 ISAs, mean of 106±9 μm), and sema3fa + sema3fbATG-MO (30 ISAs, mean 91±17 μm), ****p<0.0001. One-Way ANOVA Tukey’s multiple comparisons test. Error bars = ±SD.(TIF)Click here for additional data file.
Loss of sema3fb angiogenic deficits are independent of blood flow.
A) Confocal lateral images of laminin-stained embryos at 30hpf. Tg(kdrl:mCherry) endothelium (red) and laminin (green). Embryos derived from a heterozygous sema3fb incross. B) Quantification of the length of ISA sprouts at 30hpf, N = 1: wild type (WT) (40 ISAs, 4 embryos, mean of 102±1 μm2), sema3fb (120 ISAs, 12 embryos, mean of 90±8 μm2), and sema3fb (150 ISAs, 15 embryos, mean of 90±14 μm2). C) Confocal lateral images of the trunk endothelium (black) in blood flow-stopped tnnt2ATG-MO injected wild type siblings (WT) and sema3fb mutants. DLAV gaps (blue asterisks) and truncated ISAs sprouts (yellow arrowheads) are marked. Scale bar, 100μm. D) Length of ISA sprouts at 30 hpf, N = 3: WT (80 ISAs, 8 embryos, mean length of 106±3 μm), WT + tnnt2aATG-MO (100 ISAs, 10 embryos, mean 98±8.4 μm), sema3fb (80 ISAs, 8 embryos, mean 86±17 μm), and sema3fb + tnnt2aATG-MO (100 ISAs, 10 embryos, mean 85±22 μm). E) Percentage of ISAs connected at DLAV at 30 hpf, N = 3: WT (mean 82±9% connected), WT + tnnt2aATG-MO (mean 86±7% connected), sema3fb (80 ISAs, 8 embryos, mean 54±15% connected), and sema3fb + tnnt2aATG-MO (mean 54±16% connected). F) Quantification of width of DA in 30 hpf embryos, N = 3: WT (8 embryos, 5 measurements per embryo/n = 40 total, mean width of 18±3 μm), WT + tnnt2aATG-MO (10 embryos, 5 measurements per embryo/n = 50 total, mean 9±1 μm), sema3fb (8 embryos, 5 measurements per embryo/n = 40 total, mean 11±3 μm), and sema3fb + tnnt2aATG-MO (10 embryos, 5 measurements per embryo/n = 50 total, mean 10±1 μm). G) Quantification of width of PCV in 30 hpf embryos, N = 3: WT (n = 40, mean width of 22±3 μm), WT + tnnt2aATG-MO (n = 50, mean 19±4 μm), sema3fb (n = 40, mean 20±3 μm), and sema3fb + tnnt2aATG-MO(n = 50, mean 19±4 μm). 2-Way ANOVA Tukey’s multiple comparisons test, **** means p = <0.001. Error bars = ±SD.(TIF)Click here for additional data file.
Sema6b mutants recover by 48 hpf.
A) Representative Lateral confocal images of trunk vasculature (black) of 48 hpf control wild type (WT), heterozygous sema3fb and homozygous sema3fb mutant embryos with no obvious differences in vessel morphology or Segmental vessel (Se) connections. Scale bar, 100 μm. SIV = sub-intestinal vein (plexus), DA = Dorsal Aorta, PCV = Post Caudal Vein, CA = Caudal Artery, CV = Caudal Vein. N = 2, n: WT = 5, sema3fa = 5, and sema3fb = 7.(TIF)Click here for additional data file.
sema3fb morphant endothelial nuclei phenotype.
A) Lateral confocal timelapse images of time-lapse images in 25.5–28.5 hpf double transgenic Tg(kdrl:mCherry;fli1a:nEGFP) endothelial cells (magenta) and nuclei (white). The horizontal myoseptum (green dashed line) is noted to highlight ISA growth over time. Scale bar, 50 μm. B) During the 25–26 hpf interval there is no significant difference in speed between wild type and mutant embryos, see S2 Table for details. C) Lead angioblast mean distance from DA at 25 hpf: WT = 44.47±8.36 μm and sema3fbca305 = 43.14±6.84 μm, p = 0.609. D) Lead angioblast at 26 hpf mean distance from DA: WT = 55.12±14.06 μm and sema3fbca305 = 47.18±5.75 μm, p = 0.572. C-D) N = 1: WT = 4 embryos (20 ISAs) and sema3fbca305 = 3 embryos (15 ISAs), Unpaired t-test with Welch’s correction. E) Lateral confocal images of double transgenic Tg(kdrl:mCherry;fli1a:nEGFP) endothelium (red) and endothelial cell nuclei (green). DLAV gaps (blue asterisks) and truncated ISAs sprouts (white arrowheads) are noted. Embryos derived from a heterozygous sema3fb incross. Scale bar, 100 μm. G) Quantification of the number of endothelial cell nuclei per ISAs in 30 hpf embryos, N = 2: WT (6 embryos, mean of 3 nuclei/ISA)), and sema3fbMO (7 embryos, mean of 3 nuclei /ISA). Unpaired t-test with Welch’s correction, p = 0.17. G) Quantification of the average area of endothelial cell nuclei per ISAs in 30 hpf embryos, N = 3: WT (60 ISAs, 6 embryos, mean of 42±16 μm2), and sema3fbMO (70 ISAs, 7 embryos, mean 61±19 μm2). Unpaired t-test with Welch’s correction, ****p<0.0001. Error bars = ±SD(TIF)Click here for additional data file.
sema3fb mutants display aberrant and persistent filopodia.
A) Representative still images of single-cell expression of fli1ep: Lifeact-EGFP (green) in ISA endothelial cells from 28-30hpf wildtype and sema3fb embryo time-lapse imaging. A dashed white line represents the horizontal myoseptum and selected areas for filopodia counts are highlighted in white boxes. B) Quantification of number Lifeact-EGFP positive filopodia on ISA at 28hpf from embryos of the indicated genotypes. Unpaired t-test, p = 0.3566. C) Quantification of number Lifeact-EGFP positive filopodia on ISA at 29hpf from embryos of the indicated genotypes. Unpaired t-test, p = 0.0029. D) Quantification of number Lifeact-EGFP positive filopodia on ISA at 30hpf from embryos of the indicated genotypes. N = 3 for each quantification: WT (14 ISAs, 6 embryos, mean of 3 filopodia/ISA) and homozygous sema3fbca305 (18 ISAs, 7 embryos, mean of 8 filopodia/ISA). Unpaired t-test, p = 0.0002.(TIF)Click here for additional data file.
Interactions between VEGFR inhibitor and sprouting in sema3fb mutants.
A) A model of signaling pathways that regulate angiogenic sprouting, highlighting key genes controlling tip and stalk cell identity. B) Quantification of Tg(kdrl:mCherry) transgene expression levels in wild type and sema3fbca305 ISAs at 30hpf. N = 3: wild type (n = 13 embryos, average of 6500 a.u.) and sema3fbca305 (n = 14 embryos, average of 8400 a.u.). T-test with Welches correction, *p = 0.0186, a.u. = arbitrary unit of intensity. C). B) Fluorescent HCR in situ for vegfr2 and sflt1 RNA transcripts in whole-mount wild type and embryos sema3fbca305 embryos fixed at 30 hpf. D) Whole-mount Immunostaining for phosphoERK (pERK) in WT and sema3fbca305 embryos fixed at 30 hpf. E) Lateral confocal images of the trunk vasculature Tg(kdrl:mCherry) (white) in embryos treated with 0.5 μM SU5416 from 20hpf-30hpf. DLAV gaps (blue asterisks) and ISA truncated sprouts (yellow dashed line at the level of horizontal myoseptum are indicated. Scale bar, 100 μm. F) Quantification of ISA sprout length in 30 hpf embryos treated with 0.5 μM SU5416, N = 1: WT + DMSO (25 ISAs, 5 embryos, mean of 107±8 μm), WT + 0.5μM SU5416 (25 ISAs, 5 embryos, mean of 50±14 μm), sema3fb + DMSO (30 ISAs, 6 embryos, mean of 82±17 μm), and sema3fb +0.5μM SU5416 (30 ISAs, 6 embryos, mean of 82±19 μm). G) Percentage of ISA sprouts connected at DLAV in 30 hpf embryos treated with 0.5 μM SU5416, N = 1: WT + DMSO (25 ISA-DLAV, 5 embryos, mean 78% of ISA-DLAV/embryo), WT + 0.5 μM SU5416 (25 ISA-DLAV, 5 embryos, mean of 78%), sema3fbca305 + DMSO (30 ISA-DLAV, 6 embryos, mean of 51%), and sema3fbca305 + 0.5 μM SU5416 (30 ISA-DLAV, 6 embryos, mean of 82±19%). Error bars = ±SD. H) Lateral confocal images of the trunk vasculature Tg(kdrl:mCherry) (white) in embryos treated with low doses of DMH4 μM SU5416 from 20hpf-30hpf. ISA truncated sprouts (yellow dashed line at the level of horizontal myoseptum are indicated. Scale bar, 50 μm. I) Quantification of length of ISA sprouts in 30 hpf embryos treated with 15 μM DMH4, J) Quantification of length of ISA sprouts in 30 hpf embryos treated with 25 μM DMH4. I-J) N = 1; WT+ DMSO n = 3, 15 ISAs, average (ave.) 102±9 μm; WT+ μM DMH4 n = 2, 10 ISA, ave. 17±17 μm; WT+ 25 μM DMH4 n = 3, 15 ISAs, ave. 7±8 μm. sema3fbca305 + DMSO = 3, 15 ISA, ave. 87±18 μm, sema3fbca305 + 15 μM DMH4 n = 2, 10 ISA, ave. 40±16 μm; sema3fbca305 + 25 μM DMH4 n = 3,15 ISA, 32±13 μm. One-Way ANOVA Tukey’s multiple comparisons test, * means ¬¬p = 0.012, *****p = <0.0001. Error bars = ±SD.(TIF)Click here for additional data file.
ISA length at different time intervals.
(DOCX)Click here for additional data file.
Angioblast migration distance and speed.
(DOCX)Click here for additional data file.
Quantitative PCR mean fold change data.
(DOCX)Click here for additional data file.
Raw data underlying all graphs in the manuscript.
(XLSX)Click here for additional data file.19 Mar 2021Dear Dr Sarah,Thank you very much for submitting your Research Article entitled 'Endothelial Semaphorin 3fb regulates Vegf pathway-mediated angiogenic sprouting' to PLOS Genetics. I apologize for the delay in returning this decision.The manuscript was fully evaluated at the editorial level and by twi independent peer reviewers. The reviewers agreed that the study was well performed and novel, but raised some substantial concerns about the current manuscript. They would like you to consider alternative explanations for some of your findings, and for you to validate your model with further experiments. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a much-revised version. We cannot, of course, promise publication at that time.Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsPlease be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.[LINK]We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.Yours sincerely,Cecilia MoensAssociate EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS GeneticsReviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1: In this manuscript Watterston and colleagues investigate the function of the sema3fb gene in zebrafish vascular development. Using a sema3fb mutant that is predicted to express a truncated transcript, they reveal that intersegmental artery elongation is stunted and filopodia persist for longer in heterozygous and homozygous mutant embryos. These observations are associated with an increase in gene expression of angiogenesis inducing and repressing factors. Finally, Watterston et. al. nicely demonstrates that disruption intersegmental artery elongation in sema3fb mutants is reversed by 0.2µM SU5416, suggesting that excessive Vegfr2 activity underpins this mutant defect. The study is well presented and I am positive about this work, however there are number of remaining important questions that need to be addressed before publication.(1) Is Vegfr2 signaling truly increased in sema3fb mutants?At several points in the text it is suggested that the observed phenotype is due to increased vegfr2 expression resulting in an assumed increase in Vegfr2 activity in sema3fb mutants. However, increased vegfr2 expression does not confirm increased Vegfr2 activity, especially when sflt1 expression is also increased. The suggestion of increased Vegfr2 activity in sema3fb mutants needs to be confirmed to support the author’s model. Others have used pErk immunostaining or Erk reporters to characterize Vegfr2 activity during intersegmental artery elongation. These would be important tools to use to confirm the author’s hypothesis that increased vegfr2 expression leads to increased Vegfr2 activity.(2) Could defects in vessel branching be due to a delay in sema3fb mutant development?Many aspects of the observed phenotype of sema3fb heterozygous and homozygous mutant embryos could be due to an embryonic delay or transient disruption to vessel branching. For example, does vessel elongation fully recover at later time points? Importantly, can the authors confirm that sema3fb mutant do not experience an overall developmental delay by quantifying classic embryonic stage markers, such as head-trunk angle and embryo length.(3) Are persistent filopodia in sema3fb mutant a consequence of delayed anastomosis?The authors reveal that sema3fb mutants retain intersegmental artery filopodia for longer than wild type siblings. However, earlier in the manuscript they also show that sema3fb mutant intersegmental arteries often fail to connect with each other by anastomosis to form the DLAV. As this anastomosis event is responsible for repressing filopodia, it seems possible that the persistent filopodia observed in sema3fb mutants could be an indirect consequence of this delayed anastomosis rather than a specific effect of sema3fb on actin remodeling. To clarify this point, the authors should confirm that they only quantified filopodia numbers on intersegmental arteries in sema3fb mutants that connected to form the DLAV at the exact same time point as in wild type sibling embryos (and not in slightly delayed vessels). If not, it would be important to reanalyze the data to take this into account.(4) Is endothelial cell motility disrupted in sema3fb mutants?The short intersegmental arteries observed are likely a consequence of reduced endothelial cell motility, but this is not tested. Likewise, changes to endothelial cell nuclei spacing and shape are also potentially a consequence of reduced endothelial cell movement. It would be important to image intersegmental artery elongation in live embryos and quantify endothelial cell motility to confirm the cause of these vessel defects.(5) Does sema3fb truly form part of a “feedback mechanism”?At several points in the text the authors indicate that sema3fb forms part of a feedback mechanism that regulates Vegfr activity. This concept is interesting, but is not directly tested. The authors should determine if sema3fb gene expression is regulated by Vegfr signaling using mutants or chemical inhibitors of the Vegf pathway. If Vegf induces sema3fb expression, which then feeds back to inhibit excessive Vegfr activity, this might provide evidence of a bona fide feedback loop.(6) What is the role of sflt1 in sema3fb-mediated control of intersegmental artery elongation?On line 286, the authors propose that “reducing excessive Vegfr2 activity in sema3fb mutants would be expected to decrease levels of sFlt1, thus allowing sprouting to occur”. This is somewhat counterintuitive as high Vegfr2 activity is considered to induce sprouting. Moreover, it is unclear in this model how endothelial cells can maintain high levels of Vegfr2 activity if sFlt1 levels are so high that they repress this Vegfr2 activity. To support this proposed model, the authors should determine by qPCR if sflt1 levels return to normal in sema3fb mutants upon treatment with 0.2µM SU5416 or other Vegfr2 inhibitors.Minor points:- It would be important to confirm the specificity of the sema3fb morpholino tool (as well as sema3fb haploinsufficiency) by injecting this morpholino into heterozygous and homozygous sema3fb mutant embryos to confirm that no additional phenotype is observed.- SU5416 is not a specific inhibitor of Vegfr2 signaling and impacts many unrelated tyrosine kinases. The authors should confirm the important findings in Fig 4 using a more specific inhibitor of Vegfr2 (or if available, kdr or kdrl heterozygous and homozygous mutant embryos).- Lines 314 to 319. The discussion (and Fig 5) introduces the concept that PI3K signaling downstream of VEGFR2 may be disrupted in sema3fb mutants. However, this statement is unclear and the case for an involvement of PI3K is weak. For example, how would this account for the increased vegfr2, dll4 and sflt1 levels seen in sema3fb mutants? Fig 5 would benefit from removal of PI3K from the illustration, as this is confusing, and a clearer case for PI3K involvement should be added to the discussion (or this section removed altogether).Reviewer #2: The manuscript by Watterston et al focuses on the role of Semaphorin 3fb in vascular development in zebrafish embryos. The authors have made zebrafish mutants in sema3fa and sema3fb genes. Sema3fb (and not sema3fa) show vascular sprouting defects and misregulated expression of genes associated with VEGF signaling. Remarkably, reduced ISV sprouting is rescued by low dose treatment of VEGF chemical inhibitor. The authors conclude that Sema3fb functions by modulating VEGF pathway in angiogenic sprouting.Overall, the study is well performed, the images are clear, the results are novel and describe a new role for a zebrafish Sema3F homolog in promoting angiogenesis. However, the analysis of the phenotype is mostly descriptive and leaves many questions unanswered, such as, how loss of Sema3fb expression results in increased kdrl and flt1.Specific points:1. There are multiple references to the doctoral dissertation by Halabi R. For example, data regarding the sema3fb mutant generation (which specific nucleotides are deleted in the gene), or the presence of cardiac defect are not shown and the reference by Halabi R is cited instead. It is not sufficient to cite data reported in the doctoral dissertation because it is not considered a peer-reviewed publication. Any data that is relevant to the manuscript and has not been published in a peer-reviewed journal should be included in this manuscript so that it can be reviewed.2. Similarly, it is said that sema3fb morpholino has been validated and the dissertation by Halabi R is cited. All data for morpholino validation need to be shown in this manuscript. Does MO cause a similar inhibition of ISV sprouting and DLAV connections as observed in sema3fb mutant?3. More complete description of the phenotype observed in sema3fb mutants is needed. Do sprouting defects recover at later stages? Are there any other vascular defects observed? Are there any obvious morphological defects observed? Cardiac defect has been mentioned; please include a description. Are homozygous mutants viable?4. It is important to include analysis of sema3fb MO embryos alone in Suppl. Fig. 1D and E to shown that the phenotype in double inhibited embryos is the same as in sema3fb mutants / morphants alone.5. The text says that sema3fb fish show a slight reduction in both the DA and PCV width. Yet there is no statistically significant difference in PCV width between wt and sema3fb mutants (Suppl. Fig. 2G). Also, please explain how DA and PCV were measured; is it a single measurement per embryo? It says N=3 in the figure legend for Suppl. Fig. 2F and 2G; does it mean 3 embryos; there are multiple data points in the figure? Please check the reference to panel F in the figure legend.6. It would be very informative to perform fluorescent in situ (or RNA-Scope) for kdrl, dll4 and sflt1 in sema3fb mutants. qPCR data cannot show differences in spatial localization, and these transcripts are supposed to be expressed differently in tip and stalk cells. This would allow to assay which cells (tip, stalk) show differences in transcript expression.7. SU5416 is not specific to vegfr2, and can inhibit other tyrosine kinase receptors including vegfr3 / flt4. It would be beneficial to confirm the SU5416 rescue experiment using genetic approaches that reduce VEGF signaling. Would ISV sprouting be restored in sema3fb mutants crossed into kdrl mutant background (or kdrl morpholino can be used instead)?8. Because opposing results (increased kdrl and sflt1 expression) are observed it is unclear how VEGF signaling is affected in forming sprouts. Direct readout of VEGF signaling can be measured by quantifying pERK expression (from immunostaining or a live reporter line) which would help to confirm changes in VEGF signaling in sema3fb mutants.**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #1: YesReviewer #2: No: There are multiple references to the doctoral dissertation by Halabi R. For example, data regarding the sema3fb mutant generation (which specific nucleotides are deleted in the gene), or the presence of cardiac defect are not shown and the reference by Halabi R is cited instead. It is not sufficient to cite data reported in the doctoral dissertation because it is not considered a peer-reviewed publication.**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: No22 Jun 2021Submitted filename: Watterston PLOS Genetics reply to reviewers v3.docxClick here for additional data file.26 Jul 2021Dear Sarah,Thank you very much for submitting your Research Article entitled 'Endothelial Semaphorin 3fb regulates Vegf pathway-mediated angiogenic sprouting' to PLOS Genetics.The manuscript was fully evaluated at the editorial level and by independent peer reviewers. Two reviewers who reviewed the first version of the manuscript appreciate your effort to address their criticisms and now recommend acceptance pending minor revisions that you can easily make. However the third reviewer, who saw the manuscript for the first time, had more significant concerns. They would like to see a better effort to address what they see as contradictions between your work and the existing literature. They also ask for additional experiments. I propose that you do the former but dispense with the further experiments that they propose unless you feel that they would strengthen this already-strong manuscript.In addition we ask that you:1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsPlease review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.[LINK]Please let us know if you have any questions while making these revisions.Yours sincerely,Cecilia MoensAssociate EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS GeneticsReviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1: The authors have addressed almost all of my comments appropriately with new experimental data or text clarifications. I have just one point that I would like clarified prior to acceptance for publication:New data addressing the impact of sema3fb mutation on pERK levels (Fig. 4F) indicates that only homozygous null embryos exhibit an increase in pERK, whereas heterozygous embryos are unaffected. However, this is not consistent with other presented data that indicates that sema3fb is haploinsufficient. A full discussion of this discrepancy and a potential explanation is required prior to publication.Reviewer #2: In the revision authors have satisfactorily addressed all of my major concerns. There are only a few minor issues that still need to be addressed.1. It would be very helpful to refer to specific panels when referencing supplemental figures. Currently in most cases the reference is made to the entire figure (such as S2 Fig.) without referencing individual panels.2. Supplemental figures show in either gray background or no background (depending which application is used to open them) which can be distracting and makes it harder to see the text. I would strongly suggest inserting white background and saving all supplemental files as .pdf (instead of .png) to make them more compatible to different readers.3. It would be helpful to include supplemental table legends next to each table (not in a separate document).4. Text on page 9 says that DMH4 at low dose rescued mutant vessel length. This statement is inaccurate because addition of DMH4 in sema3fb mutants resulted in shorter sprouts than sema3fb + DMSO embryos, thus addition of DMH4 made the phenotype more pronounced. This statement should be revised.5. Test should be checked carefully for grammar and errors. There are several errors throughout the text (‘23µ’ should be ‘23 µm’ on page 9, ‘ha’ should be ‘has’ on page 11, ‘find there is a significant increase fluorescent intensity’ should be ‘find that there is a significant increase in fluorescence intensity’ on page 9).6. S6 Fig. is described in the Discussion section. However, it shows original experimental results that were not discussed previously, therefore it would be more appropriate to move it to the Results section and describe it there.Reviewer #3: Comments to authors:This manuscript is conveying a “confusing message”. On the one hand the authors propose that the loss of Sema3fb augments Vegf signaling. On the other hand, the authors provide evidence for upregulation of sFlt1 (Vegf-trap), which would argue for reduced Vegf bio-availability and kdrl signaling.In my view the phenotype observed upon loss of sema3fb is subtle, a slight reduction (or delay) in the expansion of developing arterial ISVs. The described phenotype is not necessarily a phenocopy of Vegf loss - or gain of function. Zebrafish embryos with increased vegfaa expression show normal aISV development and filopodia numbers on aISV tip cells (Wild et al, Nat Comms, 2017). Conversely, sflt1 gain of function results in truly shorter aISVs, that in general do not grow beyond the horizontal myoseptum. Therefore, in my opinion, the data with the R2 receptor inhibitor restoring aISV progression are puzzling. I agree with reviewer 2 that the authors should try low dose vegfaa targeting morpholino of examine vegfaa+/- or kdrl+/- heterozygous mutants instead of the pharmacology tools. In the same line, the authors could examine the impact of reducing sflt1 expression levels (using low dose flt1 targeting morpholino of flt1+/- mutant) on vascular morphology, in the sema3fb mutant. The claim that increased Vegf signaling augments sflt1 expression can be substantiated in other appropriate vegf – kdrl gain of function settings (like vhl-/- mutants). The authors may want to consider the TgBAC(flt1:YFP) reporter to study the flt1 expression patterns.The authors try to link changes in endothelial nuclear cell morphology with vessel width. It has recently been shown that endothelial R2 signaling promotes endothelial cell enlargement, resulting in aISVs with a larger lumen diameter in zebrafish embryos (Klems, Nat Comms 2020). As the authors propose increased endothelial R2 signaling in sema3fb mutants, the authors should check changes in endothelial cell shape as an explanation for changes in vessel width.The authors speculate that Sema3fb may control F-actin and cell elongation through disruption of the RhoA/GTPase pathway (based on reference 30). The authors can test this in their scenario – there are appropriate small Rho-GTPase inhibitors that can be used in zebrafish.**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #1: YesReviewer #2: YesReviewer #3: Yes**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoReviewer #3: No3 Aug 2021Submitted filename: Reply to reviewers v4.docxClick here for additional data file.10 Aug 2021Dear Sarah,We are pleased to inform you that your manuscript entitled "Endothelial Semaphorin 3fb regulates Vegf pathway-mediated angiogenic sprouting" has been editorially accepted for publication in PLOS Genetics. Congratulations!Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!Yours sincerely,Cecilia MoensAssociate EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS Geneticswww.plosgenetics.orgTwitter: @PLOSGenetics----------------------------------------------------Comments from the reviewers (if applicable):----------------------------------------------------Data DepositionIf you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-21-00136R2More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.----------------------------------------------------Press QueriesIf you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.18 Aug 2021PGENETICS-D-21-00136R2Endothelial Semaphorin 3fb regulates Vegf pathway-mediated angiogenic sproutingDear Dr Childs,We are pleased to inform you that your manuscript entitled "Endothelial Semaphorin 3fb regulates Vegf pathway-mediated angiogenic sprouting" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!With kind regards,Agnes PapPLOS GeneticsOn behalf of:The PLOS Genetics TeamCarlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdomplosgenetics@plos.org | +44 (0) 1223-442823plosgenetics.org | Twitter: @PLOSGenetics
Authors: Jijun Hao; Joshua N Ho; Jana A Lewis; Kaleh A Karim; R Nathan Daniels; Patrick R Gentry; Corey R Hopkins; Craig W Lindsley; Charles C Hong Journal: ACS Chem Biol Date: 2010-02-19 Impact factor: 5.100
Authors: J K Park; J W Jeong; M Y Kang; J C Baek; J K Shin; S A Lee; W S Choi; J H Lee; W Y Paik Journal: Placenta Date: 2010-05-21 Impact factor: 3.481
Authors: Jesús Torres-Vázquez; Aaron D Gitler; Sherri D Fraser; Jason D Berk; Mark C Fishman; Sarah Childs; Jonathan A Epstein; Brant M Weinstein Journal: Dev Cell Date: 2004-07 Impact factor: 12.270
Authors: Frances A High; Min Min Lu; Warren S Pear; Kathleen M Loomes; Klaus H Kaestner; Jonathan A Epstein Journal: Proc Natl Acad Sci U S A Date: 2008-02-01 Impact factor: 11.205
Fig 1
Fig 2
Fig 3
Fig 4
Fig 5