Lung cancer remains notorious for its poor prognosis. Despite the advent of tyrosine kinase inhibitors and immune checkpoint inhibitors, the probability of curing the disease in lung cancer patients remains low. Novel mechanisms and treatment strategies are needed to provide hope to patients. Advanced strategies of next generation sequencing (NGS) and bioinformatics were used to analyze normal and lung cancer tissues from lung cancer patients. Amine oxidases have been linked to leukocyte migration and tumorigenesis. However, the roles of amine oxidases in lung cancer are not well‑understood. Our results indicated that amine oxidase, copper containing 3 (AOC3) was significantly decreased in the tumor tissue compared with the normal tissue, at both the mRNA and protein level, in the included lung cancer patients and public databases. Lower expression of AOC3 conferred a poorer survival probability across the different cohorts. Epigenetic silencing of AOC3 via miR‑3691‑5p caused tumor promotion and progression by increasing migration and epithelial‑mesenchymal transition (EMT). Furthermore, knockdown of AOC3 caused less CD4+ T‑cell attachment onto lung cancer cells and reduced transendothelial migration in vitro, as well as reducing CD4+ T‑cell trafficking to the lung in vivo. In conclusion, the present study revealed that downregulation of AOC3 mediated lung cancer promotion and progression, as well as decrease of immune cell recruitment. This novel finding could expand our understanding of the dysregulation of the tumor immune microenvironment and could help to develop a novel strategy for the treatment of lung cancer.
Lung cancer remains notorious for its poor prognosis. Despite the advent of tyrosine kinase inhibitors and immune checkpoint inhibitors, the probability of curing the disease in lung cancer patients remains low. Novel mechanisms and treatment strategies are needed to provide hope to patients. Advanced strategies of next generation sequencing (NGS) and bioinformatics were used to analyze normal and lung cancer tissues from lung cancer patients. Amine oxidases have been linked to leukocyte migration and tumorigenesis. However, the roles of amine oxidases in lung cancer are not well‑understood. Our results indicated that amine oxidase, copper containing 3 (AOC3) was significantly decreased in the tumor tissue compared with the normal tissue, at both the mRNA and protein level, in the included lung cancer patients and public databases. Lower expression of AOC3 conferred a poorer survival probability across the different cohorts. Epigenetic silencing of AOC3 via miR‑3691‑5p caused tumor promotion and progression by increasing migration and epithelial‑mesenchymal transition (EMT). Furthermore, knockdown of AOC3 caused less CD4+ T‑cell attachment onto lung cancer cells and reduced transendothelial migration in vitro, as well as reducing CD4+ T‑cell trafficking to the lung in vivo. In conclusion, the present study revealed that downregulation of AOC3 mediated lung cancer promotion and progression, as well as decrease of immune cell recruitment. This novel finding could expand our understanding of the dysregulation of the tumor immune microenvironment and could help to develop a novel strategy for the treatment of lung cancer.
Lung cancer is the leading cause of cancer-related deaths worldwide with a high annual incidence and a 5-year survival rate of <20% regardless of its stage at diagnosis (1,2). However, when it metastasizes, the 5-year survival rate is less than 5% (3). Non-small cell lung cancer (NSCLC) is the most common type of lung cancer, representing ~80% of all cases (4,5). The two most prevalent NSCLC subtypes are lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC), which constitute 35 and 25% of all cases, respectively (5). There have been notable advances in our understanding of lung cancer and its underlying mechanisms of action, which have been clearly elucidated and exemplified (6). There have also been marked improvements recently in the treatments available for lung cancer. The current treatment protocol consists of a platinum doublet, tyrosine kinase inhibitors for epithelial growth factor receptor (EGFR), echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK) fusion protein and immune checkpoint inhibitors (3). However, the prognosis for lung cancer remains poor and a more detailed mechanism and treatment options are needed. In addition to the malignant cells, the surrounding microenvironment is also critical for tumorigenesis (7,8). Amine oxidases refer to a class of enzymes that catalyze the deamination of amine groups to produce aldehydes, ammonia and hydrogen peroxide (9). There are a variety of amine oxidases consisting of four classes of monoamine oxidases (MAOs), including MAO-A and MAO-B, polyamine oxidases, lysyl oxidases, and copper-containing amine oxidases (CAOs) (10). CAOs have been revealed to participate in the regulation of a variety of pathological and physiological processes, such as cell proliferation, differentiation, glucose uptake and immune regulation (11). Changes in CAO activity are correlated with a variety of human diseases, including diabetes mellitus, Alzheimer's disease, and inflammatory disorders (12,13). The four complete genes for CAOs are amine oxidase, copper containing (AOC)1-4. AOC1 consists of a homodimeric glycoprotein with an apparent molecular mass of 186 kDa; it is secreted as a diamine oxidase to generate hydrogen peroxide (14,15). AOC1 is strongly expressed in the kidneys, placenta, intestine and lungs (14). Little is known about the molecular mechanisms regulating AOC1 gene expression. The AOC2 gene encodes retina-specific amine oxidase (16), which was originally identified in ganglion cells. Its functions remain unclear but it may play a role in hereditary retinal diseases (16). The AOC4 gene encodes a soluble plasma amine oxidase in cows as bovine AOC4 (17) but not in humans, mice or rats. The AOC3 gene encodes vascular adhesion protein-1, which is primarily expressed on the endothelial cell surface but also in smooth muscle cells and adipocytes (18). In addition to its amine oxidase activity, AOC3 functions as a non-classical inflammation-inducible endothelial molecule which is linked to leukocyte-subtype specific rolling under physiological shear (18). It has been revealed that the enzymatic activity of AOC3 is functionally important, and leukocyte recruitment is impaired if its activity is abolished (10).The surrounding microenvironment of cancer contributes to its promotion and progression (19). Due to its unique tumor microenvironment (TME), cancer promotes and strengthens its own progression as a result of its interactions. The cells inside the TME include cancer-associated fibroblasts, endothelial cells and immune cells (20), which form the tumor immune microenvironment (TIME). The functions and densities of different tumor-infiltrating immune cells in the TIME are closely associated with prognosis and prediction of the treatment response (7). Therefore, there is an urgent need for improved understanding of immune dysfunction inside the TIME and the mechanisms by which the tumor modifies its environment to remove the functional immunity of the body. The present study aimed to verify the role of AOC3 in lung cancer progression and the relevant anticancer immunity.
Materials and methods
Cell lines and reagents
Murine Lewis lung carcinoma (LLC) cell line and human umbilical vein endothelial cells (HUVECs) were purchased from American Type Culture Collection (ATCC). Human lung cancer CL1-5 cells were kindly provided by Dr Pan-Chyr Yang of National Taiwan University (Taipei City, Taiwan) and were cultured in RPMI-1640 medium (Lonza Group, Ltd.) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 µg/ml streptomycin (Thermo Fisher Scientific, Inc.; Waltham, MA, USA) at 37°C. Recombinant human and mouse AOC3 were obtained from R&D Systems, Inc. Knockdown of AOC3 in CL1-5 cells was performed using either pLKO_005 plasmid as a control or AOC3-shRNA plasmid (14 µg shRNA plasmid for 5×105 cells in a 6-well plate) obtained from the National RNAi Core Facility (Academia Sinica, Taipei, Taiwan). The plasmid was transfected into cells using Lipofectamine 2000™ Thermo Fisher Scientific, Inc.) for 2 days, and the stable clone of AOC3-knockdown cells were established by puromycin selection (5 µg/ml). All cells were authenticated by short tandem repeat (Promega Corporation) and examined for mycoplasma contamination using a MycoAlert™ mycoplasma detection kit (Lonza Group, Ltd.) according to the manufacturer's protocol every three months.
Next generation sequencing (NGS) and bioinformatics analysis
All of the participants selected from January 2018 to December 2019, provided written informed consent prior to inclusion in the present study. The patients who agreed and received surgical intervention were enrolled in this study. The adjacent non-tumor lung and tumor tissues of ten patients (7 from LUAD and 3 from LUSC) were obtained from the Division of Thoracic Surgery and Division of Pulmonary and Critical Care Medicine, Kaohsiung Medical University Hospital (Kaohsiung, Taiwan). The protocol of the present study was reviewed and approved (approval no. KMUH-IRB-20130054 and KMUH-IRB-G(II)-20180021) by the Institutional Review Board of Kaohsiung Medical University Hospital. The deep RNA-seq was carried out at a biotechnology company (Welgene, Inc.) using the Solexa platform. RNA and small RNA library construction was carried out using a sample preparation kit (Illumina, Inc.) following the protocol of the TruSeq RNA or Small RNA Sample Preparation Guide.The expression of AOCs in lung cancer and normal specimens (cancer vs. normal) were extracted from the Oncomine® database (http://www.oncomine.org; Compendia Biosciences) (21) and The Cancer Genome Atlas (TCGA) cohort of UALCAN (http://ualcan.path.uab.edu/analysis.html) (22). The 16 cohorts from Oncomine® database included Su et al (23), Okayama et al (24), Landi et al (25), Beer et al (26), Stearman et al (27), Selamat et al (28), Garber et al (adenocarcinoma and squamous) (29), Hou et al (adenocarcinoma, squamous and large cell) (30), Wachi et al (squamous) (31), Bhattacharjee et al (adenocarcinoma, squamous, carcinoid and small cell) (32). Criteria in the analysis were fold change >2 and P-value <10−4, which was calculated using the Oncomine® database through two-sided Student's t-test. The data of AOC mRNA, copy number and overall survival in TCGA database, and AOC protein were analyzed by UALCAN website (http://ualcan.path.uab.edu/analysis-prot.html) (22). The immunohistochemical staining for AOC3 in lung cancer and normal lung tissue samples were acquired from The Human Protein Atlas (33). The association between gene expression and clinical outcome of lung cancer patients was evaluated by publicly available data using Kaplan-Meier (K-M) plotter and log-rank testing (https://kmplot.com/analysis/) (34), UALCAN and PROGgeneV2 (35). The post-transcriptional regulation was predicted using miRWalk (version 3.0) (36), miRanda (37) and miRDB (38) with restriction of >95% confidence.
Measurement of AOC3
All of the participants provided written informed consent prior to inclusion in the present study. The sera of 40 healthy donors and 40 lung cancer patients (healthy donors: Age range, 40–80 years old; M/F 31%/69%; lung cancer donors: Age range 30–90 years old; M/F 46/54%) were collected from the Division of Thoracic Surgery and Division of Pulmonary and Critical Care Medicine, Kaohsiung Medical University Hospital (Kaohsiung, Taiwan) from January 2018 to December 2019. The patients who agreed with written informed consent were enrolled in this study before starting definite treatment. These samples were assessed using Quantikine Human VAP-1 Immunoassay (R&D Systems, Inc.). The protocol of the present study was reviewed and approved (approval no. KMUH-IRB-20130054) by the Institutional Review Board of Kaohsiung Medical University Hospital.
Reverse transcription-quantitative (RT-q) PCR
Total RNAs were extracted from CL 1–5 lung cancer cells with TRIzol reagent (Thermo Fisher Scientific, Inc.) and reverse transcribed into cDNA using an oligo (dT) primer and reverse transcriptase (PrimeScript RT Reagent Kit; Takara Bio, Inc.) following the manufacturer's protocols. The reaction conditions were as follows: Priming for 5 min at 25°C, reverse transcription for 20 min at 46°C, and final inactivation of reverse transcriptase for 1 min at 95°C (40). The expression levels of specific genes were determined by a StepOne-Plus PCR instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.), using real-time analysis with SYBR-Green (Thermo Fisher Scientific, Inc.). The following primers were used: AOC1 forward, 5′-AOC1_H_F2GTGATGGAGGCCAAGATGCA-3′ and reverse, 5′-AOC1_H_R2TCTGCAGTGTCTGGAAGCTG-3′; AOC2 forward, 5′-AOC2_H_F2GCCTTCCACTTCAAGCTGGA-3′ and reverse, 5′-AOC2_H_R2GCTCTCAGGTCCTCCTTTCC-3′; AOC3 forward, 5′-AOC3_H_F2GTGGGGCCATAGAAATACGA-3′ and reverse, 5′-AOC3_H_R2CAGACCCAGTTCTCCAGTCC-3′; and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) forward, 5′-TTCACCACCATGGAGAAGGC-3′ and reverse, 5′-GGCATGGACTGTGGTCATGA-3′. The RT-qPCR was performed at 95°C for 20 sec, followed by 40 cycles at 95°C for 5 sec and 60°C for 35 sec (39). Relative expression levels of the cellular mRNA were normalized to GAPDH. The relative standard method (2−ΔΔCq) was used to calculate relative RNA expression (40).
Cell proliferation and 5-bromo-2-deoxyuridine (BrdU) incorporation
Cells (3×103 cells/well) were seeded in a 96 well plate, and then cultured for 48 or 72 h. Cell proliferation was determined by cell proliferation reagent WST-1 proliferation assay kit (Takara Bio, Inc.) after 2-h incubation and measured at a 450-nm wavelength according to the manufacturer's instructions. Cells were labelled with BrdU (10 µM) at day 2 after seeding followed by fixation. In the BrdU incorporation assay, cells were fixed at room temperature for 30 min with 200 µl/well of the Fixing Solution (included in the kit undermentioned) and incubated at room temperature for 30 min. Integrated BrdU was assessed by ELISA-based method according to the manufacturer's protocol (BrdU Cell Proliferation Assay Kit; cat. no. 2750; EMD Millipore).
Wound healing analysis
CL 1–5 cells were seeded into a 12 well-pate at 90% confluence and cultured in 1% of FBS-containing medium for exogenous AOC3 (control, 10, 20 and 50 ng/ml) and 10% of FBS-containing medium (since cell proliferation was not affected by AOC3 knockdown, in order to mimic the physiologic conditions, 10% of FBS-containing medium was used and cells were not serum starved) for AOC3-shRNA knockdown at 37°C as previously described by Shao et al (41), and the cell migration was evaluated by measuring the migration of cells into the acellular region formed by a sterile yellow tip. The wound closure was observed after 8 h. The wound healing assay was closely observed via a Nikon inverted microscope (Nikon Corporation).
CD4+ T-cell isolation
Peripheral blood mononuclear cells (PBMCs) of healthy donors (eight healthy donors: Age range, 35–45 years old; male only) were obtained from the Division of Pulmonary and Critical Care Medicine, Kaohsiung Medical University Hospital (Kaohsiung, Taiwan) from January 2020 to December 2020. The protocol of the present study was reviewed and approved (approval no. KMUH-IRB-20130054) by the Institutional Review Board of Kaohsiung Medical University Hospital and the donors provided written informed consent. PBMCs were isolated using 7.5 ml Ficoll-Hypaque gradient reagent (EMD Millipore) in 1 ml blood mixing with 5 ml PBS, and human CD4+ T cells were isolated form PBMC using CD4+ T-cell Isolation Kit (MACS MicroBeads; Miltenyi Biotec GmbH) according to the manufacturer's instructions.
Cell adhesion and transendothelial migration
For transendothelial migration, HUVECs (5×104) were seeded onto inserts with polyester membranes of 3-µm pore size (EMD Millipore) and cultured at 37°C for 48 h to form a 100% confluent monolayer. CL1-5 (1×105) or AOC3-knockdown CL1-5 (1×105) cells were seeded in the bottom of a 24-well plate containing RPMI-1640 culture medium. PKH26-labeled (EMD Millipore) CD4+ T-cells were seeded onto HUVEC-coated inserts, which were placed in the wells of the 24-well plate and then incubated for 24 h at 37°C. The migratory cells were visualized in four randomly selected fields using a Nikon fluorescence microscope (Nikon Corporation).
Western blot analysis
Total proteins from primary tissues and cell lines were extracted using RIPA lysis buffer (Thermo Fisher Scientific, Inc.). An equal amount of total protein (2 µg) was quantitated by bicinchoninic acid (BCA) analysis and separated by SDS-PAGE (6-8%). After transferring, the PVDF membranes containing bound proteins were blocked at room temperature for 2 h using 5% milk containing TBST buffer (0.02% Tween-20) and then incubated overnight at 4°C with primary antibodies against a specific target protein. After incubation with HRP-coupled secondary antibodies (1:5,000; anti-mouse, 7076; anti-rabbit, 7074; Cell Signaling Technology) at room temperature for 1 h, the protein bands were visualized using ECL (EMD Millipore) and detected using a FluorChem HD2 System (ProteinSimple). The following primary antibodies were used: E-cadherin (1:500; cat. no. 610182) N-cadherin (1:500; cat. no. 610921) and vimentin (1:500; cat. no. 550513; all from BD Biosciences), Slug (1:500; product no. 9585S; Cell Signaling Technology, Inc.), and GAPDH (1:5,000; cat. no. MAB374; EMD Millipore). The quantitation of the results of the western blotting was performed using AlphaImager software (Version 6.0.0; ProteinSimple).
miRNA mimics transfection
CL1-5 cells were transfected with microRNA (miR)-3691-5p (AGUGGAUGAUGGAGACUCGGUAC; at a concentration of 100 nM; GE Healthcare Dharmacon, Inc.) or scrambled control (negative control 1; UCACAACCUCCUAGAAAGAGUAGA; at a concentration of 100 nM; GE Healthcare Dharmacon, Inc.) by using Dharmafect reagent 4 (GE Healthcare Dharmacon, Inc.) according to the manufacturer's instructions. The transfection efficacy was monitored by transfecting siGLO fluorescent oligonucleotides (catalog ID: D-001630-02-05; GE Healthcare Dharmacon, Inc.) concurrently after 24 h of transfection at 37°C according to the manufacturer's protocol. The expression of AOC1-3, cell migration and CD4+ T-cell migration as well as adhesion were assayed after a 48-h transfection.
Mouse studies
All mice procedures were approved by and conducted in accordance with the Institutional Animal Care and Use Committee at Kaohsiung Medical University (IACUC Approval No. 107104; Kaohsiung, Taiwan). C57BL/6 mice (12 males in total; weight, 18±2 g; 5 weeks old) were obtained from the Taiwan National Laboratory Animal Center (Taipei City, Taiwan). The mice were housed in a specific pathogen-free environment with the room temperature being maintained at ~20°C, the humidity at ~45% and a 12-h light/dark cycle. Each mouse had free access to food and water. The mice were subjected to implantation of LLC cells (1×106 cells) via tail vein and tumor growth in the lungs was allowed for 7 days. Mice were treated with PBS or recombinant mouse (rm) AOC3 twice (10 µg/mouse; on days 7 and 14) by intra-tracheal route. At the end of the experiment, the mice were euthanized by CO2 asphyxiation during which the CO2 gas flow rate displaced 10 to 30% of the cage volume per minute. CD4+ T cells of the lungs of mice were isolated by mouse CD4+ T cell isolation kit (MACS MicroBeads; Miltenyi Biotec GmbH) according to the manufacturer's instructions and counted after 21 days of LLC implantation. Lung tissue was collected and minced and incubated in RPMI-1640 medium with collagenase type 1 (400 U/ml; Worthington Biochemical Corporation) at 37°C for 1 h. The digested tissues were filtered through a 70-µm cell strainer and washed with RPMI-1640 medium. CD4+ T cells of the lung filtered solution were isolated by mouse CD4 isolation kit and counted after 21 days of LLC implantation.
Statistical analyses
Each experiment was repeated at least three times. Data are expressed as the mean ± standard deviation (SD) using GraphPad Prism version 7.04 (GraphPad Software, Inc.). Two treatment groups were compared by unpaired Student's t-test. Multiple group comparisons were performed by two-way analysis of variance with Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.
Results
AOC3 mRNA expression is reduced in lung cancer
The controversial roles of AOCs have been reported in various cancer types (41–44), therefore their effect in lung cancer was investigated. Tumor tissue and adjacent normal tissue specimens from 10 lung cancer patients (7 LUAD and 3 LUSC) were analyzed via NGS (Table I). The expression of AOC2 (7 out of 10) and AOC3 (8 out of 10) was lower in most of the tumor tissue of patients compared with their normal tissue, however lower AOC1 in tumor tissue was observed in only 2 out of 10 patients with lung cancer (Fig. 1A-C). Using Oncomine® datasets, it revealed that AOC3, but not AOC1 or AOC2, was expressed at lower levels in tumor tissue compared with normal tissue in 16 lung cancer cohorts (Fig. 1D). Further analysis of these 16 cohorts revealed that the expression of AOC3 mRNA was lower in the tumor tissue for both the LUAD and non-adenocarcinoma patients (Fig. 1E). The expression of AOC2 and AOC3 in LUAD and LUSC was also retrieved from TCGA cohorts. Overall AOC2 (Fig. 1F) and AOC3 (Fig. 1G) expression was significantly lower in the tumor tissue compared with the adjacent normal tissue, even though this trend was not observed for all stages. Moreover, the expression of AOC3 was significantly lower in the N1 group (with lymph node metastasis) compared with the N0 group (without lymph node metastasis), implying that AOC3 may contribute to cancer metastasis (Fig. 1F and G).
Table I.
Characteristics of patients.
Group
Number
Sex
Age
Pathological diagnosis
Stage
T
N
M
I
01
M
70
Adenocarcinoma grade 3
2B
3
0
0
02
M
66
Adenocarcinoma grade 3
4B
2a
0
1c
03
F
51
Adenocarcinoma grade 3
1B
2a
0
0
04
M
53
Adenocarcinoma grade 3
3A
3
2
0
05
F
60
Adenocarcinoma grade 2
1A
1b
0
0
06
M
67
Adenocarcinoma grade 1
1A
1a
0
0
07
M
60
Adenocarcinoma grade 3
4A
4
1
1a
II
08
M
84
Squamous cell carcinoma grade 2
2B
3
0
0
09
F
65
Squamous cell carcinoma grade 2
3A
4
0
b
10
M
69
Squamous cell carcinoma grade 2
2B
2b
1
0
Figure 1.
AOC mRNA expression in lung cancer. The expression of AOCs in the normal and tumor tissue was obtained from 10 lung cancer patients (7 LUAD and 3 LUSC). The expression of (A) AOC1, (B) AOC2 and (C) AOC3 between the tumor and normal tissue in lung cancer patients. (D) Based on the Oncomine® datasets, there was lower expression of AOC3 in the tumor tissue compared with the normal tissue in 16 cohorts. (E) AOC3 expression was lower in the tumor tissue compared with the normal tissue in the adenocarcinoma and non-adenocarcinoma cohorts. Furthermore, data from The Cancer Genome Atlas cohort revealed that there was lower (F) AOC2 and (G) AOC3 expression in the tumor tissue compared with the normal tissue in both LUAD and LUSC cohorts. Furthermore, there was lower expression of AOC3 in the N1 group compared with the N0 group but not in all stages of lung cancer. AOC, amine oxidase, copper containing 3; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma.
AOC3 protein expression is inversely associated with lung cancer grade
AOC protein expression was extracted from the National Cancer Institute Clinical Proteomic Tumor Analysis Consortium (CPTAC). AOC1 protein expression did not vary between the tumor and normal tissue for the different types of LUAD, grades or stages (Fig. 2A-D). However, AOC3 protein expression was lower in the tumor tissue compared with the normal tissue in every cell type (Fig. 2E and F). Moreover, AOC3 expression was negatively associated with the grades and stages (early and late) of LUAD (Fig. 2G and H). The soluble form of AOC3 has been detected in other cancer types such as colorectal cancer (41). To evaluate the role of soluble AOC3 in lung cancer, serum from lung cancer patients was collected. Soluble AOC3 in the sera from lung cancer patients was lower than in healthy donors (Fig. 2I). In addition, the public datasets for the expression of AOC3 in lung cancer were utilized. Compared with normal tissue, both LUAD and LUSC expressed lower levels of AOC3 from The Human Protein Atlas (Fig. 2J). The combination of these results and the mRNA expression results indicated that AOC3 could be a promising tumor suppressor in lung cancer.
Figure 2.
AOC protein expression in lung cancer. The protein expression of the AOCs was extracted from the National Cancer Institute Clinical Proteomic Tumor Analysis Consortium. Only AOC1 and AOC3 were available in this dataset. (A) The protein expression of AOC1 in lung cancer tissue vs. normal tissue was not different in lung cancer (regardless of lung cancer type), (B) lung adenocarcinoma only, (C) different grades of lung adenocarcinoma, or (D) different stages of lung cancer. (E) Conversely, the expression of AOC3 was lower in tumor tissue compared with the normal tissue in lung cancer (regardless of lung cancer type), (F) in different types of adenocarcinoma cohorts, (G) different grades of lung adenocarcinoma and (H) different stages of lung cancer. To further validate the soluble form of AOC3 in lung cancer, the sera from 40 lung cancer patients and 40 normal controls were analyzed. (I) Soluble AOC3 expression was lower in the lung cancer patients compared with the normal controls. (I) The AOC3 protein expression was also retrieved from the Human Protein Atlas. (J) The protein expression of AOC3 was attenuated in both adenocarcinoma and squamous cell carcinoma compared with normal lung tissue. ****P<0.0001. AOC, amine oxidase, copper containing 3.
Lower expression of AOC3 confers a poorer survival time
Since the tumor tissue of lung cancers expressed lower levels of AOC3, its prognostic vaule in patients was evaluated by survival analysis. There are several public websites that evaluate survival analysis, including the K-M plotter, UALCAN and PROGgeneV2. According to the K-M plotter, low AOC1 expression did not confer a poorer survival time, and it actually conferred a longer survival time in LUAD but not in LUSC patients (Fig. 3A; upper panel). AOC2 revealed the same pattern in both types of lung cancer (Fig. 3A; middle panel). However, analysis of AOC3 expression revealed that the lower the AOC3 expression was, the shorter the survival time was in LUAD patients but not in LUSC patients (Fig. 3A, lower panel). Moreover, the clinical implication of AOC3 expression as detemined by survival rates was validated by cohorts extracted from the UALCAN and PROGgeneV2 websites; low expression of AOC3 conferred a shorter surivival time but this was not observed for AOC1 (ABP1) or AOC2 (Fig. 3B and C). These results confirmed that AOC3 was strongly associated with clinical outcomes in lung cancer patients (Fig. 3A and B, lower panel; Fig. 3C).
Figure 3.
Survival analysis of AOCs in lung cancer. The survival time for lung cancer patients from cohorts with different levels of AOC1, 2 and 3 expression were further analyzed. In the Kaplan-Meier plotter, survival time was analyzed for ‘both, LUAD and LUSC’, ‘LUAD’ and ‘LUSC’ (from left to right). (A; upper panel) For AOC1, the high-expression group was associated with a shorter survival time compared with the low-expression group. (A; middle panel) For AOC2, the high-expression group was not associated with a longer survival time compared with the low-expression group. (A; lower panel) However, for AOC3, the low-expression group was associated with a shorter survival time in lung adenocarcinoma. (B) In addition, UALCAN cohorts also indicated that low expression of AOC3 but not AOC2 was associated with a shorter survival time compared with high expression. (C) The low expression of AOC3 also conferred shorter survival time in different lung adenocarcinoma (GSE26919 and GSE31210) and lung cancer (GSE30219) cohorts in the PROGgeneV2. AOC, amine oxidase, copper containing 3; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma.
Mechanism regulating the expression of AOC3
Since AOC3 was revealed to be critical in the prognosis of lung cancer patients, the dysregulation of AOC3 required investigation. Genetic modifications, as DNA copy number variation, DNA methylation, and post-transcriptional regulation by miRNAs were utilized. As determined by the TCGA cohort, variation in the DNA copy number of AOC3 was not correlated with the expression of AOC3 mRNA (R=−0.121; Fig. 4A). In addition, DNA methylation of AOC3 was not significantly associated with the expression of AOC3 mRNA (R=−0.034; Fig. 4B). Concerning post-transcriptional regulation, the miRNAs that epigenetically regulate AOC3 mRNA were predicted using miRWalk version 3.0 with miRanda and miRDB restrictions of >95% confidence. There was a total of 27 miRNAs listed as potential regulators of the AOC3 (Fig. 4C). This list of miRNAs was validated using the TCGA cohort and the ones with the highest probability were miR-3190 and miR-3691 since both of them had significantly increased expression in the tumor tissue compared with the normal tissue (Fig. 4D and E). Both of the predicted and highly probable miRNAs were verified in 10 lung cancer patients. The most likely miRNA to contribute to the regulation of AOC3 mRNA was miR-3691-5p because there was an undetectable read number in most specimens for miR-3190 in our samples (Fig. 4F and G).
Figure 4.
Regulation of AOC3 mRNA expression. The expression of AOC3 mRNA was regulated by genetic modifications. The TCGA cohort was used to investigate these modifications. (A) The DNA copy number of AOC3 was not correlated with AOC3 mRNA expression. (B) Moreover, epigenetic regulation, such as AOC3 DNA methylation was not associated to AOC3 mRNA expression. (C) MiRNA regulation of AOC3 mRNA was predicted using miRWalk 3.0, and the 27 possible candidate miRNAs are listed. The present study validated the possibility of each miRNA using the TCGA cohort. The most likely candidate miRNAs included (D) miR-3190 and (E) miR-3691. Furthermore, the expression levels of indicated miRs were associated with the stages respectively. (F and G) These 2 miRNAs were further verified by data from 10 patients (including 7 lung adenocarcinoma and 3 lung squamous cell carcinoma). AOC, amine oxidase, copper containing 3; TCGA, The Cancer Genome Atlas; miR, microRNA; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma.
Low AOC3 expression mediates epithelial-mesenchymal transition (EMT) in lung cancer
Low levels of AOC3 expression conferred poor clinical outcomes in lung cancer patients. Therefore, the present study set out to verify the mechanisms by which AOC3 mediated lung cancer progression. AOC3 expression was knocked down in the LUAD cell line (CL1-5) via the shRNA method with >50% efficiency (Fig. 5A). The cells were then studied to evaluate the effect of AOC3 knockdown on proliferation. Neither the WST-1 nor the BrdU assay indicated that AOC3 affected cell proliferation in lung cancer (Fig. 5B and C, respectively). Cell migration as evaluated via wound healing analysis, revealed enhanced healing (increased migration ability) after AOC3 knockdown (Fig. 5D). In addition, AOC3 knockdown enhanced the mesenchymal characteristics as N-cadherin, vimentin and Slug were increased (Fig. 5E). The rmAOC3 protein (rhAOC3) was added to confirm the observed changes in proliferation and migration. The proliferation did not change even at a high dose (50 ng/ml) of rhAOC3 as evaluated by either WST-1 or BrdU assays (Fig. 5F and G, respectively). Cell migration was reduced after the addition of rhAOC3 in a dose-dependent manner as revealed in the wound-healing assay (Fig. 5H). The mesenchymal characteristics transitioned to epithelial features as E-cadherin was increased and N-cadherin, vimentin and Slug were decreased in a dose-dependent manner (Fig. 5I). The aforementioned results indicated that reduced AOC3 expression played a role in lung cancer progression by increasing cell migration and EMT but not proliferation.
Figure 5.
AOC3 mediates EMT in lung cancer. The present study investigated the mechanisms by which low AOC3 expression conferred a poor lung cancer prognosis. (A) AOC3 shRNA was used to knockdown AOC3 expression in CL1-5 cells. The knockdown efficiency was >50%. Cell proliferation was not altered as determined by (B) WST-1 and (C) BrdU incorporation assays. (D) Migration potential as determined via a wound-healing assay was enhanced after AOC3 knockdown. (E) The EMT phenomenon shifted towards the mesenchymal characteristics as indicated by increased N-cadherin, vimentin and Slug and decreased epithelial characteristics as indicated by E-cadherin. Conversely, using rhAOC3, the present study confirmed that AOC3 did not reduce cellular proliferation as revealed by (F) WST-1 and (G) BrdU incorporation assays. (H) The wound healing assay also revealed a reduction in migration potential in a dose-dependent manner after the addition of rhAOC3. (I) Concurrently, the EMT characteristics were reversed to epithelial characteristics as E-cadherin was increased and N-cadherin, vimentin and Slug were decreased. All experiments were performed independently at least three times. *P<0.05. AOC, amine oxidase, copper containing 3; EMT, epithelial-mesenchymal transition; sh-, short hairpin; BrdU, 5-Bromo-2-deoxyuridine; rh-, recombinant human.
Lung cancers with low levels of AOC3 fail to recruit CD4+ T cells to the tumor in vitro and in vivo
CD4+ T-cell infiltration is a critical factor for determining the TIME against cancer (26). The role of AOC3 in the recruitment of CD4+ T cells remains unclear in lung cancer. To validate the role of AOC3 in mediating the TIME in lung cancer, in vitro and in vivo studies were performed. CD4+ T-cell migration and attachment to lung cancer cells were evaluated. As determined by a cell adhesion assay, CD4+ T-cell attachment to lung cancer cells (CL1-5) was decreased after AOC3 knockdown (Fig. 6A). Before CD4+ T cells arrive at tumor sites, they must traverse the endothelia. A transendothelial migration assay was utilized to reveal the transit of CD4+ T cells through the vascular endothelia. When AOC3 was silenced in cancer cells, CD4+ T-cell migration was reduced, (Fig. 6B) indicating that the lower the AOC3 expression, the fewer CD4+ T cells were recruited. Conversely, when rhAOC3 was added, more CD4+ T cells attached to the lung cancer cells (Fig. 6C). The addition of rhAOC3 increased CD4+ T-cell migration through the vascular endothelial cells (Fig. 6D). These results indicated that AOC3 increased the recruitment of CD4+ T cells to lung cancer sites. AOC3 facilitation of CD4+ T-cell recruitment was validated using an animal model. The in vivo study investigated the number of CD4+ T cells in the lungs of mice with tumors and revealed that the number of CD4+ T cells was increased after rmAOC3 was instilled two times (10 µg/mouse) (Fig. 6E). These results indicated that AOC3 promoted CD4+ T-cell recruitment into the TIME.
Figure 6.
AOC3 attracts CD4+ T cells to lung cancer sites. The present study attempted to clarify the role of AOC3 in the recruitment of CD4+ T cells in lung tumors. The in vitro study used ‘cell adhesion’ of CD4+ T cells on lung cancer cells. After AOC3 knockdown, PKH26-stained CD4+ T cells were added to the fully-recovered lung cancer cells (CL1-5). (A) When compared with the control, the AOC3-knockdown lung cancer cells were less likely to be attached to by CD4+ T cells. (B) Moreover, the transendothelial migration assay revealed that less CD4+ T cells were attracted to AOC3-knockdown lung cancer cells compared with the control group. However, rhAOC3 increased CD4+ T-cell (C) attachment and (D) migration. Furthermore, the in vivo study utilized a mouse model to verify the in vitro findings. Lewis lung carcinoma cells were injected into mice via their tail vein. Concurrently, rmAOC3 (10 µg/mouse) was instilled into the trachea of mice twice, 7 days apart (on day 7 and day 14) (intratracheal instillation). After 14 days (day 21), the mice were sacrificed and the lungs were minced. The CD4+ T cells were then isolated. (E) The CD4+ T cells in the mice instilled with rmAOC3 were increased compared with the controls. All experiments were performed independently at least three times. *P<0.05. AOC, amine oxidase, copper containing 3; rm, recombinant mouse; LLC, Lewis lung carcinoma.
miR-3691-5 regulates EMT and cancer migration via epigenetic downregulation of AOC3
To further verify the possible regulatory role of miR-3691-5p in AOC3 expression, miR-3691 mimics were transfected to CL1-5 cells and then their biological functions were assessed. The transfection efficacy of miRNA mimics was monitored by Dharmacon™ siGLO™ transfection indicators and the results revealed that >90% efficacy was achieved (Fig. 7A). miR-3691-5p downregulated expression of AOC3 but not of AOC1 and AOC2 (Fig. 7B). The transfected lung cancer cells were then adopted for wound healing analysis and revealed enhanced healing process in a dose-dependent manner (increased migration ability) (Fig. 7C). Moreover, with miR-3691-5p transfection, AOC3 protein expression was decreased whereas the expression of the mesenchymal markers N-cadherin, vimentin and Slug were increased (Fig. 7D). These results indicated that miR-3691-5p affected cell migration and EMT through AOC3. Furthermore, to evaluate the miR-3691-5p-AOC3 axis in mediating the TIME in lung cancer, in vitro studies were performed. CD4+ T-cell migration and adhesion to lung cancer cells were evaluated. As determined by a cell adhesion assay, CD4+ T-cell attachment to lung cancer cells (CL1-5) was decreased after miR-3691-5p transfection in a dose-dependent manner (Fig. 7E). A transendothelial migration assay revealed that migration of CD4+ T cells through endothelia was reduced in a dose-dependent manner with miR-3691-5p transfection (Fig. 7F). These results indicated that miR-3691-5p attenuated the recruitment of CD4+ T cells. Collectively, it was indicated that miR-3691-5p regulated AOC3 expression to perform its biological functions.
Figure 7.
miR-3691 inhibits EMT through downregulation of AOC3. As predicted in Fig. 4E, miR-3691-5p was used to evaluate its effect on AOC3. (A) The transfection efficacy. (B) Low expression of AOC3 but not AOC1 nor AOC2 after miR-3691-5p mimics transfection. (C) The miR-3691-5p-transfected CL1-5 cells were increased as indicated by wound-healing assay. (D) The EMT phenomenon shifted towards the mesenchymal characteristics as N-cadherin, vimentin and Slug were increased and epithelial characteristic indicated by E-cadherin was decreased after AOC3 knockdown. (E) The in vitro cell adhesion of CD4+ T cells on lung cancer cells was decreased after introduction of miR-3691-5p. (F) Moreover, the transendothelial migration assay revealed that less CD4+ T cells were attracted to lung cancer cells compared with the control group. *P<0.05. miR, microRNA; EMT, epithelial-mesenchymal transition; AOC, amine oxidase, copper containing 3.
Discussion
The present study attempted to identify a novel factor affecting the different aspects of lung cancer pathogenesis. Through analysis of lung cancer patients via a high-throughput NGS tool, and the utilization of genomic data from different cohorts, the present study determined that AOC3 contributed to lung cancer pathogenesis. Different findings at both transcriptional and translational levels revealed that low levels of AOC3 were a critical factor contributing to cancer development. Low-level AOC3 facilitated mesenchymal transformation and decreased CD4+ T-cell recruitment to lung cancer tumors. It was also revealed that AOC3 expression was under miR3691-5p epigenetic regulation. The strong negative association between AOC3 and the survival rate in patients indicated that it is a key factor involved in lung cancer, and that AOC3 could be a valuable target for drug development (Fig. 8). AOCs have different effects in different types of cancer (14,42–44,45,46). High levels of AOCs can act as oncogenes and confer worse clinical outcomes, such as AOC1 in gastric cancer (14) and AOC3 in human glioma (45). On the other hand, low levels of AOCs are associated with worse clinical outcomes, such as AOC3 in colorectal (42,47) and gastric cancer (46). Moreover, decreased AOC3 levels are correlated with lymph node and hepatic metastasis in colorectal cancer (47). The present study is the first one, to the best of our knowledge, which revealed that low-level AOC3 is the critical amine oxidase in lung cancer pathogenesis but not AOC1 or AOC2. Furthermore, miR-3691-5p regulation on AOC3 and its biological functions were defined. miR-3691-5p has been demonstrated to enhance migration and invasion in hepatocellular carcinoma (48). Low expression of AOC3 conferred poor clinical outcomes and lymph node metastasis, supporting the theory that AOC3 acts as a tumor suppressor in lung cancer. Biological function analyses revealed that AOC3 did not affect cell proliferation but that it did influence cell migration. The process of EMT is essential for the enhancement of cell migration (49). AOC3 knockdown enhanced mesenchymal characteristics as revealed by an increase in N-cadherin, vimentin and Slug and attenuated epithelial characteristics as revealed by a decrease in E-cadherin. Exogenous rhAOC3 reversed these mesenchymal patterns. This finding revealed that AOC3 is involved in the maintenance of epithelial characteristics to decrease the metastasis ability of lung cancer. For the first time, the present study has revealed the pathogenic roles of AOC3 in malignant cells and AOC3 per se providing a useful biomarker and prognostic factor in lung cancer patients for clinical diagnosis and treatment.
Figure 8.
Proposed model of reduced AOC3 mediating lung cancer. The low expression of AOC3 mediated by miR-3691-5p in lung cancer conferred the potential of tumor cells to migrate and mesenchymal characteristics such as vimentin and Slug to increase. Moreover, low expression of AOC3 failed to recruit CD4+ T cells to the tumor site in vitro and in vivo. These results may explain the reason why loss of AOC3 in tumor tissue leads to shorter 5-year survival time in lung cancer patients. AOC, amine oxidase, copper containing 3; miR, microRNA.
AOC3 contributes to both innate and acquired immunity (50). Endothelial AOC3 mediates the adhesion of tumor infiltration lymphocytes, lymphokine-activated killer cells and natural killer cells (51) in inflammatory tissue (52) and tumor tissue. An absence of AOC3 leads to a marked reduction in antigen-specific CD4+ recruitment into the airway bronchial lymph nodes (50). In the present study, knockdown of AOC3 in lung cancer cells caused a reduction in CD4+ T-cell extravasation through the endothelial layer and attachment to cancer cells. On the other hand, exogenous rhAOC3 increased transendothelial migration and enhanced CD4+ T-cell attachment onto lung cancer cells. Furthermore, rmAOC3 facilitated CD4+ T-cell recruitment to preexisting lung tumor in a mouse model. These results indicated that AOC3 could modulate the TIME in lung cancer cells, and it may be possible to potentiate its effectiveness by immunotherapy. However, before reaching a definite conclusion, there are some limitations in the present study. Firstly, CD4+ T cells were utilized as a recruiting immune cell to the lung. However, there are more immune cells such as dendritic cells and macrophages and consequently, further investigation may be necessary. Secondly, data from immunohistochemical staining for membrane-bound AOC3 in tumor tissues, which would limit the role of AOC3 in lung cancer, are lacking.Collectively, the results of the present study confirmed the axis of miR-3691-5p-AOC3 as having a critical role in lung cancer via inhibiting EMT and migration and a determining factor for the recruitment of CD4+ T cells to restore anticancer immunity in the TME. AOC3 expression in lung cancer specimens may provide valuable information for patient prognosis and could have valuable applications when determining a therapeutic strategy in immunotherapy/chemotherapy.
Authors: Mathias Uhlen; Cheng Zhang; Sunjae Lee; Evelina Sjöstedt; Linn Fagerberg; Gholamreza Bidkhori; Rui Benfeitas; Muhammad Arif; Zhengtao Liu; Fredrik Edfors; Kemal Sanli; Kalle von Feilitzen; Per Oksvold; Emma Lundberg; Sophia Hober; Peter Nilsson; Johanna Mattsson; Jochen M Schwenk; Hans Brunnström; Bengt Glimelius; Tobias Sjöblom; Per-Henrik Edqvist; Dijana Djureinovic; Patrick Micke; Cecilia Lindskog; Adil Mardinoglu; Fredrik Ponten Journal: Science Date: 2017-08-18 Impact factor: 47.728
Authors: Leonor Lopes de Carvalho; Eva Bligt-Lindén; Arunachalam Ramaiah; Mark S Johnson; Tiina A Salminen Journal: Mol Phylogenet Evol Date: 2019-07-24 Impact factor: 4.286
Authors: A Bhattacharjee; W G Richards; J Staunton; C Li; S Monti; P Vasa; C Ladd; J Beheshti; R Bueno; M Gillette; M Loda; G Weber; E J Mark; E S Lander; W Wong; B E Johnson; T R Golub; D J Sugarbaker; M Meyerson Journal: Proc Natl Acad Sci U S A Date: 2001-11-13 Impact factor: 11.205