| Literature DB >> 34275002 |
Denise Palm1, Adriana Uzoni1, Frederick Simon1, Oliver Tucha1, Johannes Thome1, Frank Faltraco2.
Abstract
Attention-deficit hyperactivity disorder (ADHD) is characterized by changes to the circadian process. Many medications used to treat the condition, influence norepinephrine levels. Several studies have, in addition, reported that norepinephrine itself has an effect on circadian function. The aim of this study was to investigate the circadian gene expression in primary human-derived dermal fibroblast cultures (HDF) after norepinephrine exposure. We analyzed circadian preference, behavioral circadian and sleep parameters as well as the circadian gene expression in a cohort of healthy controls and participants with an ADHD diagnosis. Circadian preference was evaluated with German Morningness-Eveningness Questionnaire (D-MEQ) and rhythms of sleep/wake behavior were assessed via actigraphy. After ex vivo exposure to different norepinephrine concentrations in HDF cultures, the rhythmicity of circadian gene expression was analyzed via qRT-PCR. The exposure of 1 µM norepinephrine to confluent cultures of human dermal fibroblasts from participants with a diagnosis of ADHD, was shown to dampen Per1 rhythmicity. The expression of Bmal1, Per1 and Per3 in control subjects was also influenced by incubation with 1 µM norepinephrine. Cultures from the ADHD group revealed no statistically significant overall differences in circadian gene expression, between cultures with and without norepinephrine incubation. Per3 expression showed a significant ZT × group interaction via mixed ANOVA. Per3 expression at ZT4 was significant higher in the group of control samples incubated with 1 µM norepinephrine, compared to the control group without norepinephrine. This effect was also shown in the control samples incubated with 1 µM norepinephrine and cultures from subjects with ADHD without norepinephrine incubation. Per3 expression differed between the healthy control group and the ADHD group without norepinephrine incubation at ZT28. The results of the present study illustrate that norepinephrine impacts on circadian function. In both groups, control group and cultures taken from subjects with ADHD, the expression of the periodic genes (Per1-3) was significantly influenced by incubation with norepinephrine.Entities:
Keywords: Attention-deficit hyperactivity disorder; Circadian rhythm; Human dermal fibroblasts; Norepinephrine
Mesh:
Substances:
Year: 2021 PMID: 34275002 PMCID: PMC8295072 DOI: 10.1007/s00702-021-02376-2
Source DB: PubMed Journal: J Neural Transm (Vienna) ISSN: 0300-9564 Impact factor: 3.850
Oligonucleotides for qRT-PCR to measure circadian gene expression
| Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) |
|---|---|---|
| CCAGCAGTTTCATGAGATGC | GAGGTCATTTCATAGCTGAGC | |
| AAGGATGGCTGTTCAGCACATGA | CAAAAATCCATCTGCTGCCCTG | |
| TGGGGACAACAGAACAGAGAA | AGGACACTCCTGCGACCA | |
| GTATCCATTCATGCTGGGCT | TCGTTTGAACTGCGGTGAC | |
| TCAGTGTTTGGTGGAAGGAA | TCTGGGTCAGCAGCTCTACA | |
| CACGAATCACAAACAGACGG | TACATCCTGGACCCCTGGT | |
| GCCAGAAATGTTGATGCCTT | AGATGGCGGAGGTGCAG | |
| GTGGCAAGAAGAAGGTCTGG | GCCCATCTTTGATGAGCTTC | |
| GAAGGTGAAGGTCGGAGT | GAAGATGGTGATGGGATTTC |
Demographic data
| Demographic data | Healthy controls, | ADHD, |
|---|---|---|
| Age | 41.50 ± 14.04 years | 41.57 ± 13.45 years |
| Female | 8 (66.7%) | 5 (35.4%) |
| BMI | 25.87 ± 5.42 | 26.21 ± 3.62 |
| IQ score | 110.25 ± 9.32 | 108.86 ± 12.60 |
| D-MEQ | 58.83 ± 8.97* | 46.57 ± 15.44* |
| WURS-k-score | 7.17 ± 8.19*** | 37.21 ± 15.20*** |
*p < 0.05, ***p < 0.001
Fig. 1Actigraphic measures of mid-sleep of weekend days, mid-sleep of week days, social jetlag, sleep efficiency, WASO (wakening after sleep onset) and total number of wake bouts are displayed as boxplots. Circles correspond to outlier values and asterisks correspond to extreme values
Fig. 2a Relative mRNA gene expression of Per3 in healthy controls (0, 0.1, 1 μM NE). b Relative mRNA gene expression of Per3 between healthy controls and ADHD volunteers for 0 μM NE. c Relative mRNA gene expression of Per3 between healthy controls (1 μM) and ADHD volunteers for (0 μM NE). Asterisks correspond to significant values
Fig. 3Relative mRNA gene expression of circadian genes in healthy controls (0 μM) and ADHD volunteers (0, 0.1, 1 μM NE)
Chronotype groups and demographic data in healthy and ADHD participants
| Demographic data in healthy controls | All ( | Morning type | Neutraltype ( | Evening type | |||
|---|---|---|---|---|---|---|---|
| Moderate morning type ( | Definite morning type ( | Moderate evening type | Definite evening type | ||||
| Age (years) | 41.50 ± 14.04 | 43.00 ± 15.72 | 56.00 ± 7.68 | 36.57 ± 12.83 | N/A | N/A | ns |
| Gender | 4 male, 8 female | 3 female | 2 female | 4 male, 3 female | N/A | N/A | ns |
| BMI | 25.86 ± 5.42 | 25.06 ± 4.05 | 25.55 ± 0.63 | 26.30 ± 6.91 | N/A | N/A | ns |
| D-MEQ | 58.83 ± 8.97 | 65.33 ± 2.88 | 72.00 ± 1.41 | 52.29 ± 3.95 | N/A | N/A | 9.10E − 05 |
| WURS-k | 7.17 ± 8.18 | 6.67 ± 7.02 | 1.00 ± 0.00 | 9.14 ± 9.44 | N/A | N/A | ns |
| IQ | 110.25 ± 9.32 | 106.67 ± 7.50 | 99.50 ± 6.36 | 114.86 ± 8.00 | N/A | N/A | ns |