| Literature DB >> 34275001 |
Frank Faltraco1, Denise Palm2, Adriana Uzoni2, Lena Borchert2, Frederick Simon2, Oliver Tucha2, Johannes Thome2.
Abstract
A link between dopamine levels, circadian gene expression, and attention deficit hyperactivity disorder (ADHD) has already been demonstrated. The aim of this study was to investigate the extent of these relationships by measuring circadian gene expression in primary human-derived dermal fibroblast cultures (HDF) after dopamine exposure. We analyzed circadian preference, behavioral circadian and sleep parameters as well as the circadian gene expression in a cohort of healthy controls and participants with ADHD. Circadian preference was evaluated with German Morningness-Eveningness-Questionnaire (D-MEQ) and rhythms of sleep/wake behavior were assessed via actigraphy. After ex vivo exposure to different dopamine concentrations in human dermal fibroblast (HDF) cultures, the rhythmicity of circadian gene expression (Clock, Bmal1, Per1-3, Cry1) was analyzed via qRT-PCR. We found no statistical significant effect in the actigraphy of both groups (healthy controls, ADHD group) for mid-sleep on weekend days, mid-sleep on weekdays, social jetlag, wake after sleep onset, and total number of wake bouts. D-MEQ scores indicated that healthy controls had no evening preference, whereas subjects with ADHD displayed both definitive and moderate evening preferences. Dopamine has no effect on Per3 expression in healthy controls, but produces a significant difference in the ADHD group at ZT24 and ZT28. In the ADHD group, incubation with dopamine, either 1 µM or 10 µM, resulted in an adjustment of Per3 expression to control levels. A similar effect also was found in the expression of Per2. Statistical significant differences in the expression of Per2 (ZT4) in the control group compared to the ADHD group were found, following incubation with dopamine. The present study illustrates that dopamine impacts on circadian function. The results lead to the suggestion that dopamine may improve the sleep quality as well as ADHD symptoms by adjustment of the circadian gene expression, especially for Per2 and Per3.Entities:
Keywords: ADHD Dopamine; Circadian rhythm; Human dermal fibroblasts
Mesh:
Substances:
Year: 2021 PMID: 34275001 PMCID: PMC8295132 DOI: 10.1007/s00702-021-02374-4
Source DB: PubMed Journal: J Neural Transm (Vienna) ISSN: 0300-9564 Impact factor: 3.575
Oligonucleotides for qRT-PCR to measure circadian gene expression
| Gene | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|
| CCAGCAGTTTCATGAGATGC | GAGGTCATTTCATAGCTGAGC | |
| AAGGATGGCTGTTCAGCACATGA | CAAAAATCCATCTGCTGCCCTG | |
| TGGGGACAACAGAACAGAGAA | AGGACACTCCTGCGACCA | |
| GTATCCATTCATGCTGGGCT | TCGTTTGAACTGCGGTGAC | |
| TCAGTGTTTGGTGGAAGGAA | TCTGGGTCAGCAGCTCTACA | |
| CACGAATCACAAACAGACGG | TACATCCTGGACCCCTGGT | |
| GCCAGAAATGTTGATGCCTT | AGATGGCGGAGGTGCAG | |
| GTGGCAAGAAGAAGGTCTGG | GCCCATCTTTGATGAGCTTC | |
| GAAGGTGAAGGTCGGAGT | GAAGATGGTGATGGGATTTC |
Demographic data
| Demographic data | Healthy controls | ADHD |
|---|---|---|
| Age | 41.50 ± 14.04 years | 45.08 ± 18.07 years |
| Female | 8 (66.7%) | 4 (33.3%) |
| BMI | 25.87 ± 5.42 | 26.73 ± 4.48 |
| IQ-Score | 110.25 ± 9.32 | 107.50 ± 10.91 |
| D-MEQ | 58.83 ± 8.97** | 44.33 ± 16.14** |
| WURS-k-Score | 7.17 ± 8.19*** | 41.50 ± 14.94*** |
*p < 0.01, ***p < 0.001
Fig. 1Actigraphic measures of mid-sleep of weekend days, mid-sleep of week days social jetlag, sleep efficiency, WASO (wakening after sleep onset) and total number of wake bouts are displayed as boxplots. Circles correspond to outer values and asterisks correspond to extreme values
Fig. 2Relative mRNA gene expression of circadian genes in healthy controls and ADHD volunteers (0, 1.0, 10.0 µM Dopamine). *p < 0.05, **p < 0.01
Fig. 3Relative mRNA gene expression of circadian genes in healthy controls (0 µm) and ADHD volunteers (0, 1.0, 10.0 µM Dopamine)