Transcriptome analysis reveals potential mechanisms of the effects of dietary Enteromorpha polysaccharides on bursa of Fabricius in broilers.

The present study was conducted to evaluate the effects of dietary supplementation of Enteromorpha polysaccharides (EP) on relative organ weight of broilers, and RNA-seq technique was used to reveal the potential molecular mechanisms of the positive effects of EP on relative organ weight. A total of 396 1-day-old male chicks (Arbor Acres) were randomly assigned to six dietary treatments containing EP at 0 (EP0), 1000 (EP1000), 2500 (EP2500), 4000 (EP4000), 5500 (EP5500), and 7000 (EP7000) mg/kg levels for a 35-day feeding trial. At the end of feeding trail, six birds (one bird from each replicate cage) were randomly selected from each treatment and then slaughtered for relative organ weight analysis. The results showed that the relative weight of bursa of Fabricius were increased in the EP1000 group (p < 0.05), and then three bursa of Fabricius samples from each group (EP0 and EP1000) were randomly selected for RNA-seq analysis. The results of RNA-seq analysis showed that there were 20 differentially expressed genes (DEGs) between EP0 and EP1000 groups, among the DEGs, 6 genes were upregulated and 14 genes were downregulated by EP1000 supplementation (p-adjust < 0.05). Gene ontology (GO) enrichment analysis suggested that the DEGs were mainly enriched in negative regulation of toll-like receptor 9 signaling pathway (p-corrected < 0.05). Kyoto encyclopedia of genes and genomes (KEGG) enrichment analysis showed that the DEGs were mainly enriched in phagosome, mitophagy-animal, Salmonella infection, autophagy-animal signaling pathways (p-corrected = 0.081). Taken together, dietary EP supplementation at 1000 mg/kg level promoted the relative weight of bursa of Fabricius may be involved in improving the immune function of broilers. These findings provided a reference for further exploring the specific molecular mechanism of EP that affecting the organ development in broilers.

INTRODUCTION

As a feed additive, antibiotics have the effects of preventing diseases and promoting growth, whichever widely used in poultry production (Apata, 2012; Liu et al., 2019). However, the problems caused by the abuse of antibiotics are becoming more and more significant such as causing bacterial resistance and harming human health (Han et al., 2020). Therefore, it is urgent to find beneficial antibiotic substitutes. As natural active substances, marine‐derived polysaccharides (MDP) have multiple biological activities including antitumor, hypolipidemic, and antivirus (Sun et al., 2019; Zhang et al., 2010). As a kind of MDP, Enteromorpha polysaccharides (EP) are derived from wild green seaweed and widely distributed in various sea, which not only have hypolipidemic and antioxidant activities (Liu et al., 2020a; Xue et al., 2010), but also exert important functions such as immune regulation, anticancer, and antibacterial (Hang et al., 2010; Jiao, 2009). Previous study found that dietary EP could increase the activity of intestinal enzymes, enhance the apparent digestibility of nutrients, and improve the intestinal function of broilers (Du et al., 2019). It was also reported that dietary supplementation of EP improved the immune function and growth performance in broilers (Li et al., 2017). Besides, Liu et al. (2020b) reported that dietary EP enhanced the growth rate and intestinal barrier function in broilers. Guo et al. (2020) found that dietary EP could improve the production performance of laying hens at the later stage of laying, and improve the egg quality and antioxidant capacity. Meanwhile, Guo et al. (2021) suggested that EP supplementation relieved the AFB1‐induced toxicity of bursa of Fabricius via antioxidant and apoptosis signaling pathway in broilers. These previous findings demonstrated that application of EP in diet could exert beneficial effects in poultry.

The bursa of Fabricius is an important immune organ of broilers and the main place for the development and differentiation of poultry B cells, which plays a crucial role in the central and peripheral immune systems (Kogut et al., 2020). It has been suggested that the nutritional manipulation of broilers can promote the growth and development of the bursa of Fabricius, thereby improving immune performance (Liu et al., 2021). With the development of omics, various molecular sequencing technologies have been derived. As a high‐throughput molecular sequencing technology, RNA‐seq could comprehensively analyze the structure, type, and expression level of transcription products of tissues or cells under different conditions, reveal the molecular mechanism of tissue and organ development by nutritional manipulation (Bai et al., 2017). RNA‐seq is also used in medicine to detect gene expression changes in some immune diseases (Sehoon et al., 2020).

Although there are scant studies reported the positive effects of EP in broilers, reports about the effects of dietary EP on relative organ weight (especially the bursa of Fabricius) in broilers are still limited. A related study found that dietary EP affect the relative organ weight of the bursa of Fabricius, but the study did not explain its molecular mechanism (Li et al., 2017). Based on the biological activity of EP, we hypothesized that dietary EP may possess positive impacts on the development of organs, including the bursa of Fabricius, thereby affecting the immune function of broilers. Therefore, to better understand the effect of EP on organs development and the molecular mechanism in broilers, this study was conducted to evaluate the influence of dietary EP on relative organ weight of broilers, and the RNA‐seq was used to reveal the underlying molecular mechanism behind this effect, with the expectation to lay a theoretical foundation for the application of EP as functional feed additives in broilers.

MATERIALS AND METHODS

Source of EP

The EP were extracted from the Enteromorpha by Qingdao Haida Biotechnology Co., Ltd. (Qingdao, China), with ≥48% purity with the molecular weight of 4929 Da. The EP are water‐soluble sulfated polysaccharides obtained from the natural green alga Enteromorpha by enzymatic extraction, purification, concentration, and spray drying. Briefly, after crushing the algae, the algal powders are soaked in water. Then the water extracts of the algae are subjected to stepwise enzymatic treatment with pectinase, cellulase, and papain. Then, the enzymes are inactivated, centrifugal concentrated, precipitated with ethanol, and finally spray dried to obtain the EP used in this study. Based on the analysis by high performance liquid chromatography (HPLC), the polysaccharides were mainly consisting of rhamnose (Rha), glucuronic acid (GlcA), glucose (Glc), galactose (Gal), and xylose (Xyl) monosaccharides. The molar percentage of monosaccharides in the EP are as follows Rha 40.6%, GlcA 9.3%, Glc 38.2%, Gal 5.6%, and Xyl 6.3%.

Experimental design, birds, and diets

A total of 396 1‐day‐old male Arbor Acres broiler chicks (initial body weights 44.65 ± 0.56 g) were obtained from a commercial hatchery (Guangxi, China). The chicks were randomly allocated into one of six dietary treatments (6 replicate cages per treatment, with 11 broilers per cage) for 35 days study period. Dietary treatments were as follows: basal diets supplemented with EP at 0 (EP0), 1000 (EP1000), 2500 (EP2500), 4000 (EP4000), 5500 (EP5500), and 7000 (EP7000) mg/kg. The graded supplemental levels of EP in this study were set according to the previous studies about effects of dietary EP in poultry (Guo et al., 2020; Li et al., 2017). The mash form basal diet was formulated (Table 1) to meet or exceed the nutrient requirements of NRC (1994) of broilers in two phases: starter (1‐21 days) and finisher (22‐35 days). The EP were mixed into the diet before feeding. To ensure that EP were thoroughly mixed into the diet, first, EP were mixed with 1 kg of feed by hand, and then the premixes were mixed with the remaining feed using a blender. The broilers were grown in a temperature‐controlled room at 33 ± 1℃ for the first 3 days and then gradually reduced by 3℃ per week until reaching 24℃ and maintaining humidity 65% for the rest of the study period. Stainless steel cages [90 (length) × 70 (width) × 40 (height) cm] were used for housing. The birds had free access to feed and water.

TABLE 1

Basal diet composition (as‐fed basis)

Items	d 1—21	d 22‐35
Ingredients (%)
Corn	57.20	60.74
Soybean meal (CP 45%)	29.24	25.03
Corn gluten meal (CP 60%)	4.40	3.83
Soybean oil	3.41	5.00
Limestone	0.91	1.02
Dicalcium phosphate	2.07	1.93
Salt	0.32	0.37
Methionine, 99%	0.33	0.37
Lysine‐HCI, 24%	1.68	1.28
Threonine, 98.5%	0.18	0.18
Vitamin premix1	0.06	0.05
Trace mineral premix2	0.10	0.10
Choline, 50%	0.10	0.10
Calculated values
ME (kcal/kg)	3020.00	3200.00
CF (%)	6.30	7.50
Lys (%)	1.50	1.20
CP (%)	22.20	20.07
Met (%)	0.65	0.64
Met+Cys (%)	1.37	1.41
Ca (%)	0.90	0.95
Total P (%)	0.71	0.66

Provided per kilogram of diet: 15,000 IU of vitamin A, 3750 IU of vitamin D3, 37.5 mg of vitamin E, 2.55 mg of vitamin K3, 3 mg of thiamin, 7.5 mg of riboflavin, 4.5 mg of vitamin B6, 24 μg of vitamin B12, 51 mg of niacin, 1.5 mg of folic acid, 0.2 mg of biotin, and 13.5 mg of pantothenic acid.

Provided per kilogram of diet: 37.5 mg of Zn, 37.5 mg of Mn, 37.5 mg of Fe, 3.75 mg of Cu, 0.83 mg of I, and 62.5 mg of S.

Relative organ weight analysis

At the end of the feeding trail, all birds are fasted for 12 h, and six birds (one bird from each replicate cage) were randomly selected from each treatment, then they were weighted and slaughtered for relative organ weight analysis. Briefly, the proventriculus, gizzard, pancreas, heart, liver, spleen, thymus, and bursa of Fabricius were separated and weighed, the relative organ weight calculated as follows: relative organ weight = (organ weight/live weight before slaughter) × 100%.

Transcriptome analysis

Based on the relative organ weight data, three organ samples with significant differences (bursa of Fabricius) from each group (EP0 and EP1000 groups) were randomly selected and sent to Majorbio (Shanghai, China) for RNA‐seq analysis.

Sequencing uses the Illumina TruseqTM RNA sample prep Kit method for library construction. Trizol reagent was used to extract total RNA from the bursa of Fabricius samples selected from EP0 and EP1000 treatment groups, and then Nanodrop2000 was used to detect the concentration and purity of RNA, agarose gel electrophoresis was used to detect RNA integrity, and Agilent 2100 was used to determine RIN value. A single library construction requires a total of 1 μg RNA, concentration ≥50 ng/μL and OD260/280 (between 1.8 and 2.2). Since the 3′ end of eukaryotic mRNA has a polyA tail structure, magnetic beads with oligonucleotides (dT) are used for AT base pairing with polyA, and a magnetic stand is used to isolate the mRNA from the total RNA to analyze the transcriptome information. Since the Illumina HiSeq platform performs sequencing for short‐sequence fragments, what we enriched is complete RNA, so we add fragmentation buffer to the enriched RNA to randomly fragment mRNA into small fragments of about 300 bp. Then, under the action of reverse transcriptase, six‐base random primers (random hexamers) are added, and one‐strand cDNA is reversely synthesized using mRNA as a template, followed by two‐strand synthesis to form a stable double‐stranded structure. Then add End Repair Mix to make the sticky ends of the double‐stranded cDNA blunt ends, and then add an “A” base to the 3′ end to connect the Y‐linker. Finally, use Illumina Hiseq 400 SBS Kit (300 cycles) for sequencing. Among them, DESeq2, DEGseq, and edgeR are used to analyze the difference in gene expression, goatools is used for Gene ontology (GO) enrichment analysis, and R language is used to write scripts for Kyoto encyclopedia of genes and genomes (KEGG) enrichment analysis of genes/transcripts in the gene set. When the corrected p value (p‐corrected) < 0.05, it is considered that GO pathway and KEGG pathway are significantly enriched.

Three DEGs were selected to verify the RNA‐Seq results using qPCR, the specific primers for qPCR are described in Table 2 (Primer Express 3.0 software, Applied Biosystems, Foster City, CA, USA), they are synthesized from Sangon Biotech Co., Ltd. (Shanghai, China), and the β‐actin was used as the reference gene. The qPCR reactions be performed with a CFX‐96 Real‐Time PCR Detection System (BioRad, USA), and it carried out in a total volume of 20 μL, including 10 μL SYBR® Premix Ex Taq II (Tli RNaseH Plus), 2 μL canal template, 1 μL of each primer (forward and reverse primers), and 6 μL DEPC treated water. DEPC treated water for the replacement of cDNA template was used as negative control. The PCR program as following: 95℃ for 30 s, and then followed by 40 cycles of 95℃ for 10 s, 30 s under T temperature and 72℃ for 15 s. Each sample was tested in triplicate. The relative mRNA expression levels of the six target genes were calculated using the 2–ΔΔ method.

TABLE 2

The primers information of qPCR

Genes	Primer sequence (5′‐3′)	Product size (bp)	Annealing temperature)℃(	Accession No.
GATA5	F: AAGGAAGCCGAAAAACA	163	51	XM_015296343.2
	R: GGACACCGACACAATGC
ATPIF1	F: GCCCCGCCCCTCG	181	56	XM_015297582.1
	R: GCCGCCCTTCCCG
EIF2B5	F: GCCACACCTCTCCCAAC	133	52	XM_015291568.2
	R: GATACCACATCCCCAGT
β‐actin	F: GCGTGACATCAAGGAGAAGC	187	60	NM_205518.1
	F: GGACTCCATACCCAAGAAAGAT

Statistical analysis

The relative organ weight data were statistical analyzed using general linear model procedures of SAS (Statistical Analysis System, version 9.2, SAS Institute Inc., Cary, NC, USA) with a pen as the experimental unit. Orthogonal polynomial contrasts of the relative organ weight data were used to test the linear, quadratic, and cubic effects of the increasing levels of dietary EP. Differential gene analysis of transcriptome using edgeR software (Majorbio, Shanghai, China), genes enrichment analysis using goatools software (GO analysis, Majorbio, Shanghai, China), and Majorbio software (KEGG analysis, Majorbio, Shanghai, China). The probability value of less than 0.05 was considered to be statistically significant, and 0.05 ≤ p < 0.10 was considered as a tendency.

RESULTS

Relative organ weight

The effects of EP on the relative organ weight are shown in Table 3. After 35 days of feeding, broilers fed with EP1000 had higher relative weight of bursa of Fabricius compared with the EP0 group (p < 0.05).

TABLE 3

Effects of dietary graded levels of Enteromorpha polysaccharides (EP) on relative organ weight (%) of 35 days broilers

Dietary EP levels (mg/kg)	Proventriculus, %	Gizzard, %	Pancreas, %	Heart, %	Liver, %	Spleen, %	Thymus, %	Bursa of Fabricius, %
0	0.419	1.772	0.253	0.392	2.995	0.16	0.389	0.179a
1000	0.398	1.662	0.258	0.396	2.775	0.188	0.485	0.319b
2500	0.392	1.726	0.245	0.372	2.631	0.185	0.515	0.243ab
4000	0.400	1.612	0.231	0.340	2.67	0.139	0.454	0.249ab
5500	0.420	1.63	0.266	0.385	2.856	0.168	0.581	0.219ab
7000	0.445	1.687	0.244	0.373	2.713	0.212	0.498	0.220ab
SEM1	0.027	0.109	0.02	0.041	0.196	0.033	0.068	0.043ab
Contrast	p‐value
Linear	0.622	0.403	0.390	0.171	0.278	0.652	0.469	0.486
Quadratic	0.603	0.986	0.643	0.415	0.349	0.271	0.258	0.130
Cubic	0.994	0.477	0.853	0.821	0.860	0.942	0.931	0.135

SEM, standard errors of mean.

In order to explore the molecular mechanism behind the beneficial effects of dietary EP on the development of bursa of Fabricius, the bursa of Fabricius was randomly selected from EP0 and EP1000 groups for RNA‐seq analysis. As shown in Table 4 and Figure 1, RNA‐seq identified 20 DEGs between EP0 and EP1000 groups, among them, 6 DEGs were upregulation and 14 DEGs were downregulation by EP supplementation at 1000 mg/kg (p‐adjust < 0.05). The validation of RNA‐Seq resulted by qPCR are shown in Figure 2, the three selected DEGs (GATA5, ATPIF1, and EIF2B5) showed a consistent expression trend between the RNA‐Seq and qPCR, suggesting that the results of RNA‐Seq are reliable.

TABLE 4

The differentially expressed genes identified between EP0 and EP1000 groups

Genes_ID	Genes_name	EP0_mean	EP1000_mean	Log2FC(EP1000/EP0)	p‐adjust	Regulate
ENSGALG00000008376	EIF2B5	0.000	4.286	10.560	0.001	up
ENSGALG00000012813	–	0.018	6.827	9.971	0.002	up
ENSGALG00000029368	–	3.357	17.491	3.368	0.002	up
ENSGALG00000029577	–	0.476	10.486	4.541	0.030	up
ENSGALG00000038833	–	0.000	6.828	8.559	0.012	up
ENSGALG00000041647	–	0.000	2.779	7.520	0.040	up
ENSGALG00000005352	GATA5	1.741	0.100	−3.805	0.035	down
ENSGALG00000028466	–	25.225	0.238	−6.447	0.001	down
ENSGALG00000031738	–	25.402	0.039	−9.023	0.015	down
ENSGALG00000032571	–	30.003	0.063	−8.337	0.000	down
ENSGALG00000034566	–	80.952	15.109	−2.177	0.002	down
ENSGALG00000035729	–	6.291	0.000	−9.192	0.001	down
ENSGALG00000036073	–	69.579	8.444	−2.707	0.040	down
ENSGALG00000037047	–	93.344	0.122	−5.938	0.015	down
ENSGALG00000038171	–	2.003	0.000	−8.145	0.000	down
ENSGALG00000038672	ATPIF1	490.705	67.789	−2.582	0.004	down
ENSGALG00000041477	–	8.870	1.560	−3.665	0.015	down
ENSGALG00000042236	–	71.365	9.786	−2.826	0.001	down
ENSGALG00000043546	–	168.164	35.154	−2.041	0.015	down
ENSGALG00000045659	–	4.881	0.078	−5.774	0.009	down

EP0, dietary supplementation of Enteromorpha polysaccharides (EP) at 0 mg/kg; EP1000, dietary supplementation of Enteromorpha polysaccharides (EP) at 1000 mg/kg.

FIGURE 1

Volcano plot of differentially expressed genes. EP0, dietary supplementation of Enteromorpha polysaccharides (EP) at 0 mg/kg; EP1000, dietary supplementation of Enteromorpha polysaccharides (EP) at 1000 mg/kg; nosig, no significant

FIGURE 2

Validation of RNA‐Seq result by qPCR. EP0, dietary supplementation of Enteromorpha polysaccharides (EP) at 0 mg/kg; EP1000, dietary supplementation of Enteromorpha polysaccharides (EP) at 1000 mg/kg

GO enrichment analysis results are shown in Table 5 and Figure 3, DEGs are mainly enriched in negative regulation of toll‐like receptor (TLR) 9 signaling pathway, and the correlation was statistically significant (p‐corrected < 0.05). KEGG enrichment analysis results are shown in Table 5 and Figure 4, the study found that EP0 and EP1000 DEGs were mainly enriched in phagosome, mitophagy‐animal, Salmonella infection, autophagy‐animal signaling pathway (p‐corrected = 0.081).

TABLE 5

The GO and KEGG enrichment analysis between EP0 and EP1000 groups

Number	Pathway ID	Pathway description	p‐corrected
GO enrichment analysis
1	GO:0034164	Negative regulation of toll‐like receptor 9 signaling pathway	0.026
KEGG enrichment analysis
1	map04145	Phagosome	0.081
2	map04137	Mitophagy‐animal	0.081
3	map05132	Salmonella infection	0.081
4	map04140	Autophagy‐animal	0.081

EP0, dietary supplementation of Enteromorpha polysaccharides (EP) at 0 mg/kg; EP1000, dietary supplementation of Enteromorpha polysaccharides (EP) at 1000 mg/kg.

FIGURE 3

GO enrichment analysis between EP0 and EP1000 groups. EP0, dietary supplementation of Enteromorpha polysaccharides (EP) at 0 mg/kg; EP1000, dietary supplementation of Enteromorpha polysaccharides (EP) at 1000 mg/kg

FIGURE 4

KEGG enrichment analysis between EP0 and EP1000 groups. EP0, dietary supplementation of Enteromorpha polysaccharides (EP) at 0 mg/kg; EP1000, dietary supplementation of Enteromorpha polysaccharides (EP) at 1000 mg/kg

DISCUSSION

As a kind of seaweed polysaccharides, EP have been confirmed to have biological activities such as antioxidation, anticancer, and immune regulation (Wei et al., 2014; Zhong et al., 2020). Previous study suggested that dietary supplementation of 1000‐4000 mg/kg EP improved the intestinal digestive enzymes activity, as well as the number of lactic acid bacteria, and enhanced the apparent nutrients digestibility in broilers (Du et al., 2019). Also, previous studies found that adding 1000‐8000 mg/kg EP to the basal diet could increase the IFN‐γ content in serum and the conversion rate of lymphocytes in whole blood, thus, promoting the immune function and growth performance of broilers (Li et al., 2017). In addition, Sun et al. (2018) demonstrated that injection of 0.1 mL 20‐40 g/L EP enhanced the immunity function of broilers. In this study, it was found that the relative weight of the bursa of Fabricius was significantly improved by EP1000 supplementation. Consistently, Li et al. (2017) observed that dietary 1000 mg/kg EP supplementation improved the bursa of Fabricius index of broilers. The current experiment also found that the relative weight of broilers' bursa of EP1000 broilers was significantly higher than that of other dose groups. Similar findings were suggested by other studies, which showed that adding Lycium barbarum polysaccharides to broilers diet could promote the growth performance of broiler and improve the organ weight of broiler, and there is a dose‐dependent relationship between the growth performance and addition amount of broiler and Lycium barbarum polysaccharides (Long et al., 2020). Shan and Wei (2018) studied the effects of graded levels of yeast polysaccharides on the production performance of broilers, it was found that the improvement of the broiler production performance varied according to different doses. Lu et al. (2012) reported that inclusion of different levels of nonstarch polysaccharides to broilers’ diet also has dose‐dependent effects on productivity in broilers. This study observed that the positive impacts of EP1000 supplementation on the relative weight of the bursa of Fabricius may be associated with the immunomodulatory and/or antioxidant activity of EP (Guo et al., 2021; Liu et al., 2020b). Nevertheless, the specific mechanism, especially the molecular mechanism of EP that affects the relative orange weight of bursa of Fabricius is still to be further explored.

In order to explore the potential molecular mechanism behind the beneficial effects of dietary EP on relative weight of the bursa of Fabricius in broilers, the RNA‐seq was conducted to analysis the mRNA transcriptome of bursa of Fabricius between the EP0 and EP1000 groups. RNA‐seq analysis showed that a total of 20 DEGs were identified, of which 6 DEGs were upregulated and 14 DEGs were downregulated by EP1000 supplementation. Also, the current results showed that changes in the expression levels of these DEGs had a similar down‐ or upregulated trend between the qPCR and RNA‐seq, suggesting that the RNA‐seq data are reliable and could be represented as relative expression levels of DGEs in bursa of Fabricius of broilers. The number of DEGs identified in this experiment is relatively small (20 DEGs). According to the available literature, compared with the breed or environmental factors, dietary interventions usually cause limited changes in genes expression at the transcriptome level of broilers (Luo et al., 2021; Pascual et al., 2020; Zhang et al., 2018). Moreover, in this study, GO enrichment analysis of these DEGs showed that these genes were mainly enriched in negative regulation of TLRs 9 signaling pathway. KEGG enrichment analysis found that these DEGs were mainly enriched in phagosome, mitophagy‐animal, Salmonella infection, and autophagy‐animal signaling pathways. TLRs are chemical factors that mediate inflammatory response signaling pathways. TLRs play an important role in the body's innate and adaptive immune response (Qin et al., 2017). Similarly, Zhao et al. (2021) found that dietary supplementation of 7000 mg/kg EP altered the immune and infectious diseases signaling pathways in breast muscle of broilers. Liu et al. (2021) observed that dietary inclusion of 1000 mg/kg EP improved the immune function of bursa of Fabricius in heat stressed broilers by modulating immune‐related signaling pathway. Other studies also suggested that dietary natural polysaccharides could regulate the immune‐related signaling pathways in animals. For instances, Wang et al. (2015) demonstrated that dietary Astragalus polysaccharides enhanced the intestinal mucosa immunity of broilers by regulating TLR‐related signaling pathway. Lycium barbarum polysaccharides were reported that could affect the TLRs signaling pathway in mice, thereby improving the immune function of mice and alleviating liver injury induced by carbon tetrachloride (CCl4) (Gan et al., 2017). A previous study found that the polysaccharides extracted from the roots of Actinidia eriantha enhanced the immune function by regulating TLRs and activating macrophages in mice (Chen et al., 2019). Chen (2019) suggested that Glycyrrhiza uralensis polysaccharides could induce the expression of dendritic cells by stimulating TLRs/NF‐KB signaling pathway, thus, enhancing the immune function of mice. Li et al. (2020) reported that the Astragalus polysaccharides exerted anti‐inflammatory effects in LPS‐infected Caco2 cells and is related to the TLRs signaling pathway. Additionally, phagosome is an important mechanism of the body's innate immune defense system. It can devour apoptotic cells and some microbial pathogens in the body to effectively clear the pathogens in the body (Poirier et al., 2020). Mitophagy‐animal, Salmonella infection, and autophagy‐animal are the signaling pathways that also associated with the immune function and resistance in broilers (Martyna et al., 2018). Therefore, the molecular mechanism behind the positive effects on relative weight of bursa of Fabricius by EP supplementation may be due to the biological activity of EP that affects the signaling pathways related to the immunomodulatory function, thereby promoting the growth and development of the bursa of Fabricius. However, the further verification experiments of molecular function are necessary.

CONCLUSIONS

Taken together, dietary EP improved the development of bursa of Fabricius in broilers. Based on the RNA‐seq analysis, the beneficial effects of EP are mainly involved in the immunity‐related signaling pathways. These findings as the first time to reveal the underlying molecular mechanism of the effects of dietary EP on development of immune organs at the mRNA transcriptome level in broilers.

AUTHOR CONTRIBUTIONS

Sheng‐Jian Qiu: Data curation; formal analysis; investigation; writing‐original draft. Rui Zhang: Project administration; writing‐review & editing. Yan Guo: Data curation; formal analysis; investigation. Yue Zhao: Data curation; formal analysis; investigation. Zhi‐Hui Zhao: funding acquisition; project administration; supervision; writing‐review & editing. Wen‐Chao Liu: conceptualization; funding acquisition; project administration; supervision; writing‐review & editing.

CONFLICT OF INTEREST

The authors report that they have no conflict of interest.

ETHICAL STATEMENT

This study was conducted at the College of Coastal Agricultural Sciences, Guangdong Ocean University, Zhanjiang, P. R. China. The study protocol was approved by the Animal Care and Use Committee of the Guangdong Ocean University, Zhanjiang, P. R. China.