Prognostic role and biologic features of Musashi-2 expression in colon polyps and during colorectal cancer progression.

BACKGROUND: The RNA-binding protein Musashi-2 (MSI2) controls the translation of proteins that support stem cell identity and lineage determination and is associated with progression in some cancers. We assessed MSI2 as potential clinical biomarker in colorectal cancer (CRC) and tubulovillous adenoma (TA) of colon mucosa.
METHODS: We assessed 125 patients, of whom 20 had polyps of the colon (TAs), and 105 had CRC. Among 105 patients with CRC, 45 had stages I-III; among metastatic CRC (mCRC) patients, 31 had synchronous and 29 metachronous liver metastases. We used immunohistochemistry to measure MSI2 expression in matching specimens of normal tissue versus TAs, primary CRC tumors, and metastases, correlating expression to clinical outcomes. We analyzed the biological effects of depleting MSI2 expression in human CRC cells.
RESULTS: MSI2 expression was significantly elevated in polyps versus primary tissue, and further significantly elevated in primary tumors and metastases. MSI2 expression correlated with decreased progression free survival (PFS) and overall survival (OS), higher tumor grade, and right-side localization (p = 0.004) of tumors. In metastases, high MSI2 expression correlated with E-cadherin expression. Knockdown of MSI2 in CRC cells suppressed proliferation, survival and clonogenic capacity, and decreased expression of TGFβ1, E-cadherin, and ZO1.
CONCLUSION: Elevated expression of MSI2 is associated with pre-cancerous TAs in the colonic mucosa, suggesting it is an early event in transformation. MSI2 expression is further elevated during CRC progression, and associated with poor prognosis. Depletion of MSI2 reduces CRC cell growth. These data imply a causative role of MSI2 overexpression at multiple stages of CRC formation and progression.

Introduction

Despite the development of new methods of screening, diagnosis and treatment, colorectal cancer (CRC) continues to be a significant source of cancer mortality worldwide, both in men and women [1]. Worldwide, in 2018, 1.8 million people were diagnosed with CRC and more than 850,000 died of this disease [2]. The advent of targeted therapy and the use of a multidisciplinary approach to treatment have improved overall survival (OS) [3]. The 5-year relative survival rate for all CRC stages has improved from 50% in the 1970s to 64% during the 2010s, and in patients diagnosed with distant metastases, the 2-year survival rate improved from 21% during the mid-1990s to 37% during 2010s [4,5]. However, mCRC remains a major cause of death in cancer patients.

Up to 21% of patients are diagnosed with stage IV cancer, with typical OS of 7.2 months following diagnosis [6]. Liver metastases are the most common sites of CRC metastasis. At the initial diagnosis, liver metastases are detected in 15–25% of patients (synchronous metastases). For another 18–25% of patients diagnosed at stages I–III [7], liver metastases are observed within 5 years after diagnosis (metachronous metastases) [8]. Resistance to therapy and subsequent mortality in mCRC is associated with many biological changes in the tumor [9]. A critical question is the degree to which patients likely to develop an aggressive disease course, including metachronous metastases, can be identified at an earlier disease stage. Such early identification would allow these individuals to receive more active surveillance and potentially nominate them for more aggressive treatment. Hence, there is much interest in defining biomarkers of aggressive malignancy in early stages of CRC, and in premalignant colon mucosa [9,10].

The RNA-binding protein Musashi-2 (MSI2) controls the translation of proteins that support stem cell identity and lineage determination [11], and is a potential biomarker for CRC prognosis. Elevated expression of MSI2 plays an important role during progression [12], dissemination [13], and drug resistance [13,14] in numerous solid [15-18] and hematological malignancies [19-21]. Importantly, elevated MSI2 expression at an early tumor stage may predict worse outcomes in later tumors. For example, in non-small cell lung cancer (NSCLC), elevated MSI2 expression was first detectable in early stage tumors, and continued to rise during tumor progression [12]. Mechanistically, MSI2 was found to govern expression of proteins in the TGF-β signaling pathway, which is known to undergo a transition from growth-inhibiting to invasion-promoting during oncogenesis [22], supporting the process of epithelial-mesenchymal transition (EMT). These data suggested MSI2 may play an important role in this shift towards invasive and metastatic tumors [23].

Some work has suggested MSI2 regulation of genes governing EMT and aggressive tumor growth may be relevant in CRC. In studies using multiple mouse models for CRC formation, MSI2 overexpression was shown to inhibit expression of tumor suppressors, partially phenocopying changes induced by loss of APC. Moreover, loss of Musashi function in transgenic mouse model compromised the growth of CRCs, and influenced response to investigational targeted therapies in pre-clinical models [24,25]. Based on these data, we hypothesized that MSI2 expression may provide a useful biomarker for tumor aggressiveness in CRC. In this study, using the histological material of patients with tubulovillous adenomas (Tas) of the colon and patients with verified CRC, we evaluated the expression of MSI2 and its effect on clinical characteristics. In addition, we assessed the role of MSI2 in regulating the proliferative and colony forming ability of human CRC cell lines, and whether MSI2 regulated the expression of proteins associated with EMT and tumor stage, including E-cadherin (CDH1), the tight junction protein ZO1, and the cytokine TGFβ1.

Patients, methods, and materials

Patients

The patient group consisted of 66 men and 59 women with an average age of 59 years (range 31–78 years). Of these 125 patients, 20 had colon tubulovillous adenomas (TAs, or colon polyps), and 105 had CRC (53 patients with left-sided and 52 patients with right-sided tumors). Patients with polyps and CRCs were matched for age, sex and absence of comorbidity. Of the CRC patients, 45 had locoregional cancer (stages I-III), and 60 patients had mCRC with liver metastases; of the specimens from mCRC patients, 31 patients had been diagnosed with synchronous and 29 with metachronous metastases.

Sample collection, tissue preparation, immunohistochemistry and quantitative analysis

All patients with TA polyps or colon cancer in this study signed approved National Medical Research Center of Oncology (Rostov-on-Don, Russia) institutional consent forms (IRB No. 6, 02/03/2018) that allowed us to collect specimens, perform IHC, and analyze data. All samples were de-identified. No research activity was done prior to obtaining appropriate IRB permissions. Normal mucosa, colorectal polyps and tumors were collected. Tissues were collected and fixed in 10% phosphate-buffered formaldehyde (formalin) for 24–48 hrs, dehydrated and embedded in paraffin. Tissues were processed by dehydration through ethanol followed by xylene (70% ethanol, 3 hr; 95% ethanol, 2 hr; 100% ethanol, 2 hr; ethanol-xylene, 1hr; xylene, 3hr) then immersed in paraffin. Paraffin blocks were cut into 5 μm sections, mounted on microscope slides, and stored at room temperature until used. Prepared specimens were analyzed by hematoxylin and eosin (H&E) staining (SigmaAldrich, St. Louis, MO).

Immunohistochemistry and assessment of data

IHC was performed by standard protocols specified by antibody manufacturers, using anti-MSI2 antibody (Abcam, cat. № ab50829 with 1:200 dilution), anti-E-Cadherin (CDH1) antibody (Abcam, cat. № ab1416 with 1:200 dilution) and secondary goat anti-rabbit IgG (Abcam, cat. N° ab205718 with 1:2000 dilution). Immunostained slides were scanned using an Aperio ScanScope CS scanner (Aperio, Vista, CA) and Vectra Automated Quantitative Pathology Imaging System (Perkin Elmer, Waltham, MA). Scanned images then were viewed with Aperio ImageScope software. Selected regions of interest were outlined manually by a certified clinical pathologist (N. Karnaukhov). The percentage of cells at each staining intensity level was determined, and an H-score was assigned and calculated for each slide using the following formula: [1 × (% cells 1+) + 2 × (% cells 2+) + 3 × (% cells 3+)]. H-scores were subsequently used for analysis.

Statistical analysis

For statistical processing, the quantitative indicators of MSI2 and E-cadherin IHC expression in patients’ samples, evaluated by H-score method was approximated into qualitative ones by dividing the expression level into high and low by median in every type of tissue respectively. Obtained result were compared using the Kruskal-Wallis test. Categorical data were evaluated using the Pearson chi-square test, adjusted by Yates’s correction for continuity. The correlation coefficients between protein expression and clinical and pathological parameters were estimated using Spearman correlations. A linear regression model was used to investigate correlation in MSI-2 and E-cadherin protein expression levels. The Kaplan-Meier method was used to construct survival curves, as well as to calculate the median of survival. Differences between groups were established using a log-rank test. All statistical analyzes were performed using SPSS 16.0 for Windows (SPSS, Inc., Chicago, Illinois, USA). All P values were two-sided, with P <0.05 indicating a statistically significant difference.

Cell culture

The RKO (ATCC CRL-2577) and HCT116 (ATCC CCL-247) colorectal carcinoma cell lines were obtained from the FCCC Cell Culture Facility and authenticated by genotyping performed by IDEXX BioResearch (Columbia, MO, USA). Both cell lines were cultured in RPMI-1640 media containing 10% fetal bovine serum (FBS), L-glutamine, non-essential amino acids, pyruvate and penicillin/streptomycin (pen/strep). For the list of cell line derivatives used in the study, see S1 Table.

shRNA targeting sequences and lentivirus production

Short hairpin RNAs (shRNAs) were obtained from SIGMA-ALDRICH (St Louis, MO) (S2 Table). Two MSI2- targeting sequences were used:

MSI2-sh1: CCGGGTGGAAGATGTAAAGCAATATCTCGAGATATTGCTTTACATCTTCCACTTTTTG

MSI2-sh2: CCGGCCCAACTTCGTGGCGACCTATCTCGAGATAGGTCGCCACGAAGTTGGGTTTTTG

Empty vector Tet-pLKO-puro system (Plasmid #21915, Addgene, Cambridge, MA) was used as a control. To prepare lentivirus for introduction of shRNAs into CRC cells, HEK-293T cells were transfected with shRNA lentivirus prepared in the Tet-pLKO-puro system (Plasmid #21915, Addgene, Cambridge, MA), with the psPAX2 (Plasmid # 12260, Addgene, Cambridge, MA) and pMD2.G (Plasmid #12259, Addgene, Cambridge, MA packaging plasmids Pspax #12260 and pMD2.G # 12259, both from Addgene (Cambridge, MA). Media containing lentiviral particles was collected on day 4. Subsequently, CRC cells were infected with lentivirus and selected by growth in media, as described above, using standard methods [12].

In silico evaluation of MSI2 binding to EGFR mRNA

Human genome sequences for TGFβ-1, CDH1 and ZO-1 were obtained from the UCSC Human Gene Sorter December 2013 (GRCh38/hg38) assembly, and scanned for Musashi binding motifs defined by Wang et al [25]: see S3 Table.

mRNA expression

Total DNA-free mRNA was isolated from HCT116 (-pLko, sh1, sh2) and RKO (-pLko, sh1, sh2) cell lines using Quick-RNA™ MiniPrep (#R1054) (Zymo Research, Orange, CA), reverse-transcribed using Moloney murine leukemia virus reverse transcriptase (Ambion-Thermo Fisher Scientific, Waltham, MA) with a mixture of anchored oligo-dT and random decamers used as primers (Integrated DNA Technologies, Coralville, IA). mRNA expression for MSI2 and other genes of interest were analyzed by quantitative RT-PCR, using the primers listed in S4 Table.

Western blotting

For western blotting analysis, RKO and HCT-116 transfected with MSI2-targeting or control lentiviruses were plated and treated with 1μg/μl of doxycycline for 48 hours to induce MSI2 knockdown. Cells were then washed twice with cold PBS and were disrupted in CelLytic M lysis buffer (Sigma-Aldrich, St. Louis, MO) supplemented with protease and phosphatase inhibitor cocktails (Roche, Basel, Switzerland). Whole cell lysates were used directly for SDS–PAGE and Western blotting, using standard procedures. After centrifugation, supernatants were collected, and total protein quantified by BCA (Thermo Scientific). Cell lysates were separated by 4–15% SDS–PAGE and transferred to PVDF membrane. Membranes were blocked and were blotted overnight (4°C) for TGβ-1 (ab92486, AbCam, 1:1000 dilution), ZO-1 (sc-33725, Santa Cruz; 1:1000 dilution), CDH1 (#3195, Cell Signaling; 1:1,000 dilution), MSI2 (ab76148, Abcam; 1:2,000 dilution) and β-actin (A3854, Sigma-Aldrich; 1:5000 dilution) used as primary antibodies. Secondary anti-mouse and anti-rabbit horseradish peroxidase–conjugated antibodies (GE Healthcare, Little Chalfont, UK) were used at a dilution of 1:10,000 for visualization of Western blots and blots developed by chemiluminescence using the West-Pico system (Pierce, Waltham, MA). Image analysis was done using ImageJ (National Institutes of Health, Bethesda, MD), with signal intensity normalized to β-actin or total level of detected proteins. Data was analyzed in Excel by paired t-test to determine statistical significance.

Colony formation assay

For each test condition, 500 cells were plated in 6-well plates and incubated in complete media for 12 days. Cells were then fixed in 10% acetic acid/10% methanol solution and stained with 0.5% (w/v) crystal violet. A colony was defined as consisting of >50 cells, and counted digitally using ImageJ software. GraphPad software was used statistical analysis.

Cell proliferation assays

Cells (1–2 × 103/well) were plated in quadruplicate plates in RPMI1640 media with 10% FBS in 96-well cell culture plates for 5 days. On days 1–5, CellTiter-Blue® (Promega, Fitchburg, WI) or WST-1 reagent (Sigma-Aldrich, St. Louis, MO) reagent were added to wells one one plate; after 2 hours incubation at 37°C, optical density readings were made to visualize percentage of live cells, using a Perkin-Elmer ProXpress Visible-UV-fluorescence 16-bit scanner (Perkin-Elmer, Waltham, MA). GraphPad software used for statistical analysis.

TCGA analysis

The Cancer Genome Atlas (TCGA, data release from January 28 2016) results shown in this study are based upon Firehose legacy data generated by Broad Institute (https://gdac.broadinstitute.org/ (Version: 1.1.40)). Data for 83 protein samples and 203 matched RNA samples for colorectal adenocarcinoma were downloaded from www.cbioportal.org (Date: January 22 2020). We used internal www.cbioportal.org software (R/MATLAB) for creation of correlation graphs, and calculation of Pearson and Spearman correlation coefficients. Correlation data for tumor samples from matching RNA and protein samples sets for the colorectal adenocarcinoma study were downloaded from www.cbioportal.org [26,27].

Results

Expression of MSI2 based on tumor stage, grade, and survival

We compared immunohistochemical staining intensity for MSI2 in normal colon mucosa, polyps, and invasive colorectal carcinomas (CRCs) (Fig 1A). Based on analysis of H-score, there was a significant increase in MSI2 protein expression in colorectal polyps (all tubulovillous adenoma by histology) versus normal mucosa (median values, 140 versus 60; average values, 138.75 versus 60.25; p<0.001) (Fig 1B). We also compared MSI2-stained matched normal mucosa versus primary and metastatic tumor samples for 105 CRC patients, including 45 patients with localized (stage I-III) CRC and 60 patients mCRC (Fig 1C). In this case, MSI2 H-scores were significantly elevated in primary tumors versus normal mucosa (median values, 190 versus 70; average values, 197 versus 69.4; p<0.001). H-values for MSI2 were further elevated in tumor metastases (median values, 270 versus 190; average, 267.3 versus 197; p<0.001 for metastases versus primary tumor). High expression of MSI2 in the primary tumors correlated with differentiation grade, both using H-score (p<0.001) (Fig 1D) and percent MSI2 expression level (p = 0,037) methods (Table 1), but not with depth of invasion, lymph node positivity, tumor location (right or left sidedness), presence of distant metastases or tumor stage (Table 1).

Fig 1

An increased level of MSI2 expression is associated with colon polyps, primary tumor, liver metastasis and poor survival.

(A) Representative IHC images of MSI2 expression in normal colon mucosa, colon polyps, primary CRC, and CRC liver metastasis. (B) H-score for MSI2 expression in normal mucosa (n = 20) and colorectal polyps (n = 20). (C) H-score for MSI2 expression in normal colon mucosa, primary CRC tumor, and matched CRC liver metastasis (n = 60). (D) H-score for MSI2 expression in primary tumors with the grades of differentiation (n = 105). (E) Kaplan-Meier progression-free survival (PFS) and overall survival (OS) for patients with low (dotted line) and high (solid line) levels of Musashi-2 protein expression based on median values for H-score in primary tumor. Data is presented for patients diagnosed with stage I-III CRC (green), with synchronous metastases (stage IV) (red), or stage I-III but subsequently with metachronous metastases(blue), based on evaluation of primary tumors collected at initial diagnosis.

Table 1

Comparison of the frequencies of qualitative indicators in primary colorectal tumors with low and high expression of MSI2 (n = 105).

Clinicopathological parameters	Total Number of patients	Musashi-2 protein expression		χ2	p-value	r
		Low (n. (%))	High (n. (%))
Gender
Male	56	19 (34%)	37 (66%)	0.023	0.878	-0.035
Female	49	15 (31%)	34 (69%)
Age range
≤65 years	54	16 (30%)	38 (70%)	0.169	0.681	-0.061
>65 years	51	18 (35%)	33 (65%)
Type (Localized/Metastasized)
Non-metastatic	45	13 (29%)	32 (71%)	0.659	0.719	-0.078
Synchronous	31	10 (32%)	21 (68%)
Metachronous	29	11 (38%)	18 (62%)
Location of tumor
Left-sided	53	21 (40%)	32 (60%)	1.939	0.164	0.156
Right-sided	52	13 (25%)	39 (75%)
Stage
I	13	4 (31%)	9 (69%)	2.542	0.468	0.051
II	22	10 (45%)	12 (55%)
III	39	10 (25%)	29 (75%)
IV	31	10 (33%)	21 (67%)
Depth of invasion
T2	17	6 (35%)	11 (65%)	0.118	0.943	0.033
T3	68	22 (32%)	46 (68%)
T4	20	6 (30%)	14 (70%)
Lymph node metastasis
N0	35	14 (40%)	21 (60%)	2.065	0.356	0.139
N1	51	16 (31%)	35 (69%)
N2	19	4 (21%)	15 (79%)
Grade of differentiation
High	43	9 (21%)	34 (79%)	4.361	0.037	0.204
Moderate and low	62	25 (40%)	37 (60%)
E-cadherin in primary tumor
Low	12	3 (25%)	9 (75%)	0.000	1.000	-0.040
High	14	5 (32%)	11 (68%)
E-cadherin in metastasis
Low	12	5 (42%)	7 (58%)	1.750	0.186	0.333
High	16	2 (12%)	14 (88%)

Categorical data were evaluated using the Pearson χ2 test, adjusted by Yates’s correction for continuity. The correlation coefficients between protein expression and clinical and pathological parameters were estimated using a Spearman correlation. Significant distinctions are indicated in bold font.

We also assessed the relationship between MSI2 expression and the clinical and pathological features of liver metastases from the same patients for whom we had assessed primary tumors (Table 2). MSI2 protein expression was higher in the liver metastases of tumors arising on the right side (median values with quartiles 260 [245; 275] versus 280 [270;290]; average values, 258 versus 273; (p = 0.004). A high level of MSI2 expression in the metastasis was also associated with lymph node positivity (median values with quartiles 270 [250;280] for N0 versus 265 [242;280] for N1 versus 280 [275;290] for N2; average values, 268 versus 262 versus 281; p = 0.04), and with higher differentiation grade of the primary tumor (p = 0.000) (Table 2). In these tumors, there was also no correlation between the level of MSI2 expression and initial stage at diagnosis of tumors that subsequently metastasized (e.g. o metachronous mCRC) (p = 0.793) (Table 2). For both primary tumors and their metastases, no statistically significant relationship was identified for MSI2 expression with patient sex, age, or type of metastasis (synchronous or metachronous).

Table 2

Comparison of the frequencies of qualitative indicators in CRC liver metastases with low and high expression level of Musashi-2 (n = 60).

Clinicopathological parameters	Total Number of patients	Musashi-2 protein expression		χ2	p-value	r
		Low (n. %)	High (n. %)
Gender
Male	32	12 (37%)	20 (63%)	0.000	1.000	-0.018
Female	28	10 (36%)	18 (64%)
Age range
≤65 years	22	5 (23%)	17 (77%)	2.036	0.154	-0.220
>65 years	38	17 (45%)	21 (55%)
Type (Localized/Metastasized)
Synchronous	31	13 (42%)	18 (58%)	0.369	0.543	0.113
Metachronous	29	9 (31%)	20 (69%)
Location of tumor
Left-sided	25	15 (60%)	10 (40%)	8.399	0.004	0.409
Right-sided	35	7 (20%)	28 (80%)
Initial stage of CRC
I	5	2 (40%)	3 (60%)	1.036	0.793	-0.055
II	6	2 (33%)	4 (67%)
III	18	5 (28%)	13 (72%)
IV	31	13 (42%)	18 (58%)
Depth of invasion
T2	7	2 (29%)	5 (71%)	0.878	0.645	0.033
T3	42	17 (41%)	25 (59%)
T4	11	3 (27%)	8 (73%)
Lymph node metastasis
N0	11	4 (36%)	7 (64%)	6.427	0.040	0.209
N1	36	17 (47%)	19 (53%)
N2	13	1 (8%)	12 (92%)
Grade of differentiation
High	36	6 (16%)	30 (84%)	13.424	0.000	0.508
Moderate	24	16 (67%)	8 (33%)
Low	0	0 (0%)	0 (0%)

Categorical data were evaluated using the Pearson χ2 test, adjusted by Yates’s correction for continuity. The correlation coefficients between protein expression and clinical and pathological parameters were estimated using Spearman correlation.

For each patient cohort, we evaluated progression free survival (PFS) and overall survival (OS) associated with MSI2 expression in the primary tumor, stratifying the level of MSI2 as high or low expression based on the median H-score for each group (Table 3). Based on this analysis, PFS was significantly lower in patients with high MSI2 expression in the primary tumors, whether patients were diagnosed with synchronous (p = 0.0045) or metachronous metastasis (p = 0.001) (Fig 1E). However, MSI2 expression level in the primary tumors of mCRC patients did not influence OS for these patients (Fig 1E and Table 3). Further, MSI2 expression level in localized CRC (stage I-III) did not correlate with OS or PFS (Fig 1E).

Table 3

Comparison of frequencies of qualitative indicators with OS and PFS in mCRC patients with synchronous and metachronous metastasis.

Clinicopathological parameters	N	Mean OS (months. CI 95%)	Log-rank	p-value	Mean PFS (months. CI 95%)	Log-rank	p-value
Gender
Male	32	17.0 (13.4–20.6)	2.479	0.115	9.0 (7.7–10.3)	0.471	0.493
Female	28	16.0 (12.8–19.2)			8.0 (5.4–10.3)
Age range
≤65 years	22	17.0 (13.8–20.2)	0.012	0.914	8.0 (5.2–10.8)	0.049	0.825
>65 years	38	17.0 (14.0–20.0)			9.0 (7.8–10.2)
Type (Localized/Metastasized)
Synchronous	31	13.5 (9.7–17.3)	8.963	0.003	6.0 (3.3–8.7)	11.395	0.001
Metachronous	29	20.0 (13.7–26.3)			11.0 (10.0–12.0)
Location of tumor
Left-sided	25	20.0 (16.8–23.2)	0.314	0.575	11.0 (9.0–13.0)	4.664	0.031
Right-sided	35	14.5 (11.6–17.4)			8.0 (5.5–10.5)
Stage
I	5	-	11.592	0.009	11.0 (8.9–13.1)	11.591	0.009
II	6	17.0 (13.6–20.4)			11.0 (8.7–13.3)
III	18	19.0 (14.8–23.2)			10.0 (5.8–14.2)
IV	31	14.0 (10.4–17.6)			6.0 (3.3–8.7)
Depth of invasion
T2	7	-	6.536	0.038	11.0 (9.2–12.2)	2.947	0.229
T3	42	17.0 (14.6–19.4)			9.0 (8.0–10.0)
T4	11	11.5 (8.3–14.7)			4.0 (1.8–6.2)
Lymph node metastasis
N0	11	23.0 (18.0–28.0)	27.584	<0.0001	11.0 (10.2–11.8)	18.338	<0.0001
N1	36	19.0 (15.5–22.5)			9.0 (7.5–10.5)
N2	13	11.0 (7.9–14.1)			4.0 (1.7–6.3)
Histology
Adenocarcinoma	50	17.0 (14.7–19.3)	1.668	0.434	9.0 (7.3–10.7)	0.878	0.645
Mucinous carcinoma	8	13.0 (10.7–15.3)			7.0 (4.2–9.8)
Signet-ring cell carcinoma	1	-			11.0
Grade of differentiation
Moderate	24	21.5 (16.7–26.3)	6.378	0.012	11.0 (8.6–13.4)	8.307	0.004
High	36	14.5 (11.6–17.4)			8.0 (6.5–9.5)
Therapy
Sole surgical resection	1	6.0	13.175	<0.0001	4.0	2.533	0.282
+ chemotherapy	55	17.0 (14.2–19.8)			9.0 (7.8–10.2)
+ chemoradiation	4	20.0 (5.3–34.7)			11.0 (2.7–19.3)
Resection
R0	57	17.0 (14.5–19.5)	0.571	0.450	9.0 (7.7–10.3)	1.411	0.235
R1+R2	3	13.5 (11.1–15.9)			8.0 (6.4–9.6)
E-cadherin in primary tumor
Low	12	12.0 (9.5–14.5)	0.019	0.889	4.0 (2.6–5.4)	1.405	0.236
High	14	13.0 (9.4–17.6)			8.0 (6.2–9.8)
E-cadherin in metastasis
Low	12	19.0 (13.9–24.1)	12.291	<0.0001	11.0 (6.0–16.0)	8.458	0.004
High	16	11.0 (9.5–12.5)			6.0 (4.7–7.3)
Musashi 2 in primary tumor
Low	21	20.0 (15.5–24.5)	2.849	0.091	11.5 (9.6–13.4)	12.627	<0.0001
High	39	14.0 (11.3–16.7)			8.0 (6.3–9.7)
Musashi 2 in metastasis
Low	22	24.5 (20.8–28.2)	12.555	<0.0001	11.0 (8.7–13.3)	13.481	<0.0001
High	38	13.0 (10.7–15.2)			7.0 (5.0–9.0)

The Kaplan-Meier method was used to construct survival curves, as well as to calculate the median of survival. Differences between groups were established using a log-rank test.

We also evaluated the relationship between OS and PFS and MSI2 expression level in the matched liver metastases for 60 mCRC patients. MSI2 expression above the median H-score in these liver metastases was strongly associated with poor OS (log-rank = 12.555; p <0.0001) and PFS (log-rank = 13.481; p <0.0001) (Table 3). Additional relationships were found between OS and diagnosis with synchronous liver metastasis (p = 0.003), the depth of invasion (p = 0.038), the presence of metastases in the lymph nodes (p<0.0001), and the grade of differentiation (p = 0.012) (Table 3).

Relationship between MSI2 and E-cadherin in CRC

Because our data suggested a potential relationship between MSI2 expression and tumor grade in CRC metastases, we investigated the expression of E-cadherin (CDH1) (Fig 2A), in relation to MSI2, in 28 randomly chosen patients with mCRC. Comparison of the medians of E-cadherin expression by H-score in the matched primary tumor and metastasis revealed statistically significant differences, with elevated expression of E-cadherin in metastasis (p<0.001) (Fig 2B). For further statistical analysis, quantitative indicators of CDH1 expression in the primary tumor and metastasis were approximated into qualitative ones by dividing the expression level into high and low median 140 and 220, respectively. The expression of MSI2 in primary tumors did not correlate with that of CDH1 in either the primary tumors (p = 1.0) or metastases (p = 0.186) (Table 4). However, the expression level of MSI2 protein correlated positively with that of E-cadherin in metastases (p = 0.027) (Fig 2C).

Fig 2

Expression of E-cadherin/CDH1 in primary CRC and liver metastases; correlation with MSI2 expression.

(A) Representative IHC expression of E-cadherin/CDH1 in primary CRC and liver metastasis from individual patient. (B) H-score for E-cadherin/CDH1 in primary tumor and liver metastasis (n = 28). (C) Correlation of H-score for MSI2 and E-cadherin/CDH1 in liver metastases (R2 = 0.505, p = 0.027).

Table 4

Relationship between MSI2 and E-cadherin in CRC.

Clinicopathological parameters	Total Number of patients	MSI2 protein expression		χ2	p-value	r
		Low (n. %)	High (n. %)
Expression level in primary tumor
E-cadherin in primary tumor
Low	12	3 (25%)	9 (75%)	0.000	1.000	-0.040
High	16	5 (32%)	11 (68%)
E-cadherin in metastasis
Low	12	5 (42%)	7 (58%)	1.750	0.186	0.333
High	16	2 (12%)	14 (88%)
Expression level in metastasis
E-cadherin in primary tumor
Low	12	1 (8%)	11 (92%)	0.650	0.420	-0.256
High	16	5 (32%)	11 (68%)
E-cadherin in metastasis
Low	12	6 (50%)	6 (50%)	4.861	0.027	0.500
High	16	1 (6%)	15 (94%)

Categorical data were evaluated using the Pearson χ2 test, adjusted by Yates’s correction for continuity. The correlation coefficients between protein expression and clinical and pathological parameters were estimated using Spearman correlation.

MSI2 positively regulates expression of CDH1, ZO1, and TGFb1 in CRC

MSI2 is an RNA-binding protein (RBP) that can regulate translation of downstream target mRNAs. Given our analysis of clinical specimens suggested a connection between MSI2 expression, E-cadherin/CDH1 expression, and tumor grade, particularly in tumor metastases, we analyzed whether MSI2 might directly regulate E-cadherin expression in CRC. We first performed in silico analysis to determine if the CDH1 mRNA contained predicted binding motifs for MSI2 (Fig 3A). For this, we looked for motifs suggested by Wang et al [25], focusing on occurrence of longer (7 or 8 nucleotide) binding consensus sites, as these were less likely to occur by chance (Fig 3A, S3 Table). We performed similar analysis for two other genes known to be relevant to tumor grade in CRC: the tight junction-associated protein ZO-1/TJP1, and a regulator of epithelial-mesenchymal transition, TGFβ1 [25]. This analysis identified 3 predicted MSI2 binding sites in the 3’ untranslated region (UTR) of the CDH1 mRNA, 4 in the ZO-1/TJP1 UTR, and 1 in the TGFβ1 UTR.

Fig 3

In silico analysis of MSI2 gene regulation in CRC.

(A) Location of predicted binding sites for human MSI2 protein defined from study by Wang et al. [25], using eight MSI2 binding motifs with the highest p values). Coding sequences (CDS) are represented by thick lines; 3’ untranslated regions (3’UTR) by thin line. Shorter consensus sequences are not indicated. (B, C) Correlation analysis for expression between MSI2 and CDH1, TGFβ1, ZO1, based on 203 CRC mRNA specimens (B) or 83 CRC protein specimens (C), based on data downloaded from www.cbioportal.org (TCGA, Firehouse legacy, Date: January 22 2020).

As a first approach to exploring the suggested relationships, we assessed whether MSI2 expression correlated with expression of CDH1, ZO-1/TJCP1, or TGFβ1 mRNA or protein, using data from The Cancer Genome Atlas (TCGA) Research Network. Based on the idea that MSI2 regulates protein translation of its targets, we would predict correlated expression at the protein level, but no correlation, or much lower correlation, at the mRNA level. In a data set of 83 CRC cases for which matching RNA and protein data was available, we found no correlation between MSI2 and TGFβ1 mRNA expression, and we only observed modest correlation between MSI2 and ZO1/CDH1 mRNA expression (Fig 3B). However, we observed significantly correlated protein expression of MSI2 with TGFβ1, ZO-1 and CDH1 protein, consistent with a role of MSI2 in regulating primarily mRNA translation for these genes (Fig 3C).

Next, we used RT-PCR and western analysis to directly determine if MSI2 depletion reduced the protein, but not mRNA, expression of these candidate targets. Use of two independent shRNAs (-sh1,-sh2) to deplete MSI2, versus empty vector, in two human CRC cell lines (RKO and HCT116), significantly decreased TGFβ1, CDH1, and ZO-1 protein expression in both cell lines, while not affecting mRNA levels for these proteins (Fig 4A–4D). These results were consistent with a primary role of MSI2 as an RBP in regulating protein translation rather than regulating expression of mRNA.

Fig 4

In vitro assessment of MSI2 depletion in CRC cell lines.

(A-D) Averaged values for qRT-PCR (A, B) and Western blot (C, D) for MSI2, CDH1, TGFβ1, and ZO1 in control and MSI2-depleted RKO and HCT116 cell lines. (E-H) Cell viability (E, F) and clonogenic capacity (G, H) of control or MSI2-depleted RKO and HCT116 CRC cell lines. *, p<0.05; **, p<0.01; ***, p<0.001, in each case in reference to control-depleted cells; non-significant comparisons are not indicated.

MSI2 supports viability and clonal growth of CRC cell lines

Finally, we assessed whether depletion of MSI2 affected the viability and clonogenic capacities of CRC cell lines, again using shRNA to deplete MSI2. Three days after MSI2 depletion, use of a WST-1/CelltiterBlue assay indicated that MSI2 depletion significantly decreased viability of both the RKO and HCT116 human CRC cell lines versus cells bearing negative control shRNA (Fig 4E and 4F). Similarly, MSI2 depletion also significantly suppressed colony formation capacity of both cell lines in a clonogenic assay, reducing staining intensity by more than 80% (Fig 4G and 4H).

Discussion

In this study, we show that MSI2 expression in the colon is elevated by stages during malignant transformation. MSI2 expression is initially elevated in pre-cancerous tubulovillus adenomas (polyps), further elevated in primary tumors, and then dramatically increased in distant metastases compared to normal mucosa and primary tumor. We find that regardless of tumor stage, high levels of MSI2 in primary tumors were associated with shorter PFS. Elevated MSI2 expression in liver metastasis linked to both poor PFS and OS, and intriguingly, were associated with high expression of E-cadherin/CDH1, a marker of epithelial identity. Pursuing this last observation in analysis of public datasets, we found that MSI2 protein expression correlated with that of CDH1 and other proteins implicated in control of epithelial versus mesenchymal identity. We also demonstrated directly that depletion of MSI2 in vitro reduced protein but not RNA expression of CDH1, ZO-1, and TGFβ1, and that the 3’UTRs in the mRNAs in these genes contained candidate MSI2 binding sites. We further showed MSI2 depletion reduced viability and clonogenic capacity of CRC cell models.

Overall, these data suggested MSI2 has a complex action in CRC that varies dependent on tumor stage. MSI2 support of the expression of proteins associated with both epithelial (E-cadherin and ZO-1) and mesenchymal (TGFβ1) identity is consistent with a role of MSI2 reported previously in non-small cell lung cancer (NSCLC), in which MSI2 overexpression induced a mixed differentiation phenotype [9]. In that study, MSI2 was identified as a metastatic driver that supported the protein expression of the TGFβ receptor TGFBR1, and TGFβ effector SMAD3, suggesting MSI2 was required for EMT; however, MSI2 depletion reduced CDH1 expression in NSCLC cell cultures, indicating a role in supporting epithelial identity [9]. A growing number of studies have emphasized the presence of quasi-mesenchymal cells in aggressive tumors [28]; these cells, which are marked by extreme lineage plasticity, are associated with poor response to therapy and poor survival. In CRC progression, malignancy is promoted by loss of differentiation in pre-metastatic cells, but increased differentiation in cancer cells after extravasation, as this is necessary to form rapidly proliferating tumors in the metastatic niche. We hypothesize that the specific correlation between MSI2 and CDH1 expression in liver metastases may indicate a specific role for MSI2 in supporting CDH1 expression in the metastatic setting. In contrast, MSI2 may be more active in regulating TGFβ1 expression and supporting proliferation in primary tumors, and may also contribute to the proliferation of pre-cancerous polyps.

Several prior studies have identified roles for MSI2 as an oncogenic driver in multiple types of cancer [14,15,18,29]. Particularly pertinent to this study, work in murine CRC models have shown a direct oncogenic role of MSI2, as well as the importance of overexpression of MSI2 and APC gene loss [15]. In the TRE-MSI2 mouse model, overexpression of MSI2 in the intestinal epithelium was associated with high crypt proliferation and crypt fission, a block in differentiation, and development of specific morbidities that were similar to acute loss of APC [25]. MSI2 overexpression in these mice provoked rapid and substantial shifts in the intestinal epithelial transcriptome, with gene set enrichment analysis of these changes showing that the APC-loss gene signature was among the most significantly enriched [25]. In addition, overexpressed MSI2 plays an oncogenic role in myeloid leukemia, with elevated expression of MSI2 is linked with poor survival in leukemia patients [13]. Other tumor types in which MSI2 overexpression has been linked to increased aggressiveness include hepatocellular carcinoma and gastric cancer [11].

In summary, our data indicate that elevated expression of the MSI2 protein is a prognostic biomarker for poor prognosis both in pre-cancerous conditions and at multiple stages of CRC. Further, MSI2 actively promotes CRC growth, and is potentially a promising therapeutic target, with efforts currently ongoing to identify drugs targeting MSI2 RNA-binding activity [11]. This is of potential clinical value, as in many cases, identification of specific mutations or epigenetic changes occurring early in tumor formation has been shown to help stratify patients for clinical management, improving therapeutic outcomes [23,30]. As one example, a recently proposed classification of four consensus molecular subtypes (CMS) can be used as a basis for studying the sensitivity of various molecular subtypes to therapy; studies using this classification determined that irinotecan is particularly effective in CMS4 patients [27]. As another example, the presence of BRAF mutations in tumors from stage III-IV CRC patients is associated with decreased survival [31,32]. Additional retrospective studies and a post hoc analysis of a prospective clinical trial have indicated that abnormal DNA methylation can affect prognosis in colon cancer, with CpG Island Methylator Phenotype positive (CIMP+) colon cancers predicting poor survival compared to CIMP negative cancers [33,34]. As a regulator of protein translation, MSI2 is positioned to influence expression of numerous cancer targets in addition to those identified here; based on the work presented here, further study in CRC is strongly merited.

List of cell line derivatives used in the study.

For human cell lines, the lentiviral vectors Tet-pLKO-puro (Addgene, Plasmid #21915) was used for inducible expression of shRNAs.

(DOCX)

Click here for additional data file.

DNA oligonucleotides used for construction of shRNA vectors.

Table lists of single stranded DNA (ssDNA) oligos used for generation of Tet-pLKO-puro vectors expressing specific shRNAs, which used for lentiviral infection and selection of stable cell lines. MSI2 targeting sequences are underscored.

(DOCX)

Click here for additional data file.

Consensus MSI2 binding site sequences, defined by Wang et al.

(XLSX)

Click here for additional data file.

Primers used for RT-PCR to quantify gene expression.

List of primers used for SYBR Green assay, and TaqMan gene expression assay, used for qRT-PCR analysis of gene expression.

(DOCX)

Click here for additional data file.

WB Musashi CRC project.

(PDF)

Click here for additional data file.

24 Aug 2020

PONE-D-20-17649

Prognostic role and biologic features of Musashi-2 expression in colon polyps and during colorectal cancer progression

PLOS ONE

Dear Dr. Kharin,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript within 45 days of this decision. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Punita Dhawan

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.Thank you for including your ethics statement: 'IRB of National Medical Research Center of Oncology (Rostov-on-Don, Russia) (IRB No. 6, 02/03/2018).'

(a) Please amend your current ethics statement to include the full name of the ethics committee/institutional review board(s) that approved your specific study.

(b) Please amend your current ethics statement to specifically state that the IRB approved your study.

(c) Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

For additional information about PLOS ONE ethical requirements for human subjects research, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-human-subjects-research.

3. In the ethics statement in the manuscript and in the online submission form, please provide additional information about the patient samples used in your retrospective study, including: a) whether all samples were fully anonymized before you accessed them; b) the date range (month and year) during which patients' samples were accessed; c) the date range (month and year) during which patients whose samples were selected for this study sought treatment; and d) the source of the samples analyzed in this work (e.g. hospital, institution or medical center name).

4. Please provide additional information about the HEK293T cells used in this work, including source, culture conditions and any quality control testing procedures (authentication and mycoplasma testing). For more information, please see http://journals.plos.org/plosone/s/submission-guidelines#loc-cell-lines.

5. At this time, we ask that you please provide scale bars on the microscopy images presented in Figure 1 and 2 and refer to the scale bar in the corresponding Figure legend.

6. To comply with PLOS ONE submission guidelines, in your Methods section, please provide additional information regarding your statistical analyses for the in vitro cell line studies. For more information on PLOS ONE's expectations for statistical reporting, please see https://journals.plos.org/plosone/s/submission-guidelines.#loc-statistical-reporting.

7.PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

8. Please upload a copy of Supp. Table S1., Supp. Table S2., Supp. Table S3., Supp. Table S4.,  which you refer to in your text on page 6 and 7.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: RNA-binding protein Musashi-2 (MSI2) controls the translation of proteins that support stem cell identity and lineage determination and is associated with progression in some cancers. The present study explore the prognostic significance of MSI2 in CRC polyps and colon cancer. Its well-planned study that explicitly signifies the role of MSI2 in CRC. However, the data on its role in initiation is still unclear. In order to clarify its role and prognostic significance, it will be interesting to see MSI2 expression alteration in hyperplastic, and serrated polyp types. How microsatellite instability impact MSI2 expression and does its differential expression is associated with mutational status of tumor.

Minor Suggestion: A high level of MSI2 expression in the metastasis was also associated with lymph node positivity (median values with quartiles 270 [250;280] for N0 versus 265 [242;280] for N1 versus 280 [275;290] for N2; average values, 268 versus 262 versus 281; p=0.04), and with higher differentiation grade of the primary tumor (p = 0.000). Clearly mention the p-value observed for the study.

Reviewer #2: The manuscript entitled "Prognostic role and biologic features of Musashi-2 expression in colon polyps and during colorectal cancer progression" by Leonid Kharin et al. Here authors, addressed the critical role of Musashi-2 (MSI2) in colorectal cancer and metastasis. The idea of this article is exciting. The author showed a stage-wise increase in the expression of MSI2. Also, it showed the critical role of MSI cell proliferation and growth. However, colon cancer-promoting role of MSI2 is already reported. The techniques or methodology used is up to date. However, the following points need to be addressed.

1. In one section of the results, the author stated that the expression of MSI2 in primary tumors did not correlate with CDH1 expression. However, in another section using the TCGA data set, the author showed a positive correlation between MSI2 protein expression and CDH1 protein. This ambiguity needs to be addressed.

2. The whole idea of this manuscript to show the significance of MSI2 in prognosis colon cancer progression. It would be better to use regression and ROC analysis methods to show the prognostic significance of MSI2 in predicting disease progression.

3. Figure1A: MSI2 expression (representative IHC images) in adenocarcinoma and liver metastasis is not clear and hard to interpret. Higher magnification insert would help in compression between them.

4. Figure1D: Author showed MSI2 expression comparison between grade 3 with grade1 & 2. It would be better to show compressions among normal and all the grades with representative IHC images of MSI2.

5. Figure4G-H: typo error in Y axis, % colony formation instead of % cell viability.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

29 Dec 2020

December 19, 2020

Punita Dhawan, PhD

Editorial Office

PLoS One

Dear Dr. Dhawan,

We here submit our revised original research article, ““"Prognostic role and biologic features of Musashi-2 expression in colon polyps and during colorectal cancer progression"” (PONE-D-20-17649), to be considered for publication in PLoS One. We greatly appreciate the expert comments and suggestions from the reviewers. We have addressed most of the points raised by the reviewers, and the appropriate changes have been made to the manuscript, as detailed below. A small number of points could not be addressed due to technical reasons which we explain in the following point-by-point response letter and additional data attached. We hope that you agree that the revised manuscript is significantly improved and is now acceptable for publication.

Reviewer #1: RNA-binding protein Musashi-2 (MSI2) controls the translation of proteins that support stem cell identity and lineage determination and is associated with progression in some cancers. The present study explore the prognostic significance of MSI2 in CRC polyps and colon cancer. It is a well-planned study that explicitly signifies the role of MSI2 in CRC.

Response: We thank the Reviewer for the positive assessment of the study.

Point #1. …The data on its role in initiation is still unclear. In order to clarify its role and prognostic significance, it will be interesting to see MSI2 expression alteration in hyperplastic, and serrated polyp types.

Response #1: We have added new images showing the expression of MSI2 in 1 hyperplastic polyp and 1 serrated adenoma (revised Figure 1). These data suggest that MSI2 is not expressed in these early stage lesions. However, the low number of samples available does not allow us to draw statistically significant conclusions, so we are cautious in discussing these results.

Point #2. How microsatellite instability impact MSI2 expression and does its differential expression is associated with mutational status of tumor.

Response #2: This is an important point. In our study, we analyzed 39 tumors that were microsatellite stable, and 5 tumors that had microsatellite instability (numbers now indicated in revised Table 1). We found no impact of microsatellite instability status on MSI2 expression level (p=0.932). We have added a sentence to the results to make this point.

Minor Suggestion: A high level of MSI2 expression in the metastasis was also associated with lymph node positivity (median values with quartiles 270 [250;280] for N0 versus 265 [242;280] for N1 versus 280 [275;290] for N2; average values, 268 versus 262 versus 281; p=0.04), and with higher differentiation grade of the primary tumor (p = 0.000). Clearly mention the p-value observed for the study.

Response for suggestion: We have clarified the description of the results with associated p-values in the main text of the manuscript.

Reviewer #2: The manuscript entitled "Prognostic role and biologic features of Musashi-2 expression in colon polyps and during colorectal cancer progression" by Leonid Kharin et al. Here authors, addressed the critical role of Musashi-2 (MSI2) in colorectal cancer and metastasis. The idea of this article is exciting. The author showed a stage-wise increase in the expression of MSI2. Also, it showed the critical role of MSI cell proliferation and growth. However, colon cancer-promoting role of MSI2 is already reported. The techniques or methodology used is up to date. However, the following points need to be addressed.

Response: We thank the Reviewer for the positive assessment of the study.

Point #1. In one section of the results, the author stated that the expression of MSI2 in primary tumors did not correlate with CDH1 expression. However, in another section using the TCGA data set, the author showed a positive correlation between MSI2 protein expression and CDH1 protein. This ambiguity needs to be addressed.

Response #1: We apologize for the apparent contradiction of these data. Due to limited tissue for both MSI2 and CDH1 staining, we were only able to stain colon tumors from 28 patients in our study using IHC vs. 83 patients in TCGA, providing more statistical power to the TCGA data set. Furthermore, besides difference in the number of patients, different methods were used; IHC in our study vs. mass spectrometry in TCGA. Based on all of these factors, it is clear that additional studies should be done to assess the functional relationship of MSI2 and CDH1 expression. This point was added to the Discussion section.

Point #2. The whole idea of this manuscript to show the significance of MSI2 in prognosis colon cancer progression. It would be better to use regression and ROC analysis methods to show the prognostic significance of MSI2 in predicting disease progression.

Response #2: Thank you for your comment. We applied Cox regression analysis and ROC analysis to the data; however, these methods sdid not show any significance in relationship of MSI2 expression in primary CRC and prognosis in patients. We added this statement to the manuscript Results section.

Point #3. Figure 1A: MSI2 expression (representative IHC images) in adenocarcinoma and liver metastasis is not clear and hard to interpret. Higher magnification insert would help in compression between them.

Response #3: We apologize for the quality of the initially submitted images. We have updated Figure 1A, and replaced old images with the new images in this Figure.

Point #4. Figure 1D: Author showed MSI2 expression comparison between grade 3 with grade1 & 2. It would be better to show comparisons among normal and all the grades with representative IHC images of MSI2.

Response #4: We added new images with Grade 1 – 3 tumors (MSI2 IHC staining).

Point #5. Figure 4G-H: typo error in Y axis, % colony formation instead of % cell viability.

Response #5: We apologize for this typo. We updated the Y-axis in Figures 4G and 4H.

We once again thank the Editor and the Reviewers for a fair review, and hope that the improved manuscript would be suitable for PLoS One.

Sincerely yours,

Yanis Boumber, MD, PhD

Leonid Khaein , MD

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

11 May 2021

Prognostic role and biologic features of Musashi-2 expression in colon polyps and during colorectal cancer progression

PONE-D-20-17649R1

Dear Dr. Kharin,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Punita Dhawan

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: The manuscript entitled "Prognostic role and biologic features of Musashi-2 expression in colon polyps and during colorectal cancer progression" is now looks satisfactory and ready for acceptance.

Reviewer #3: Authors have made revisions that are sufficient to address the concerns. Thanks for all the revisions.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

Reviewer #3: No

25 Jun 2021

PONE-D-20-17649R1

Prognostic role and biologic features of Musashi-2 expression in colon polyps and during colorectal cancer progression

Dear Dr. Kharin:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Punita Dhawan

Academic Editor

PLOS ONE