Literature DB >> 34193038

Insertion of an endogenous Jaagsiekte sheep retrovirus element into the BCO2 - gene abolishes its function and leads to yellow discoloration of adipose tissue in Norwegian Spælsau (Ovis aries).

Matthew Kent1, Michel Moser1, Inger Anne Boman2, Kristine Lindtveit1, Mariann Árnyasi1, Kristil Kindem Sundsaasen1, Dag Inge Våge3.   

Abstract

BACKGROUND: The accumulation of carotenoids in adipose tissue leading to yellow fat is, in sheep, a heritable recessive trait that can be attributed to a nonsense mutation in the beta-carotene oxygenase 2 (BCO2) gene. However, not all sheep breeds suffering from yellow fat have this nonsense mutation, meaning that other functional mechanisms must exist. We investigated one such breed, the Norwegian spælsau.
RESULTS: In spælsau we detected an aberration in BCO2 mRNA. Nanopore sequencing of genomic DNA revealed the insertion of a 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) sequence in the first intron of the BCO2 gene. Close examination of its cDNA revealed that the BCO2 genes first exon was spliced together with enJSRV-sequence immediately downstream of a potential -AG splice acceptor site at enJSRV position 415. The hybrid protein product consists of 29 amino acids coded by the BCO2 exon 1, one amino acid coded by the junction sequence, followed by 28 amino acids arbitrary coded for by the enJSRV-sequence, before a translation stop codon is reached.
CONCLUSIONS: Considering that the functional BCO2 protein consists of 575 amino acids, it is unlikely that the 58 amino acid BCO2/enJSRV hybrid protein can display any enzymatic function. The existence of this novel BCO2 allele represents an alternative functional mechanism accounting for BCO2 inactivation and is a perfect example of the potential benefits for searching for structural variants using long-read sequencing data.

Entities:  

Keywords:  BCO2; Endogenous Jaagsiekte sheep retrovirus; Functional mutation; Nanopore sequencing; Sheep; Structural variant; Yellow fat; spælsau

Mesh:

Substances:

Year:  2021        PMID: 34193038      PMCID: PMC8247158          DOI: 10.1186/s12864-021-07826-5

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   3.969


Background

The yellow coloration of adipose tissue in sheep is known to be a heritable trait in different sheep breeds and is caused by the accumulation of carotenoids [1-4]. In terms of consumer preferences, “yellow fat” is an undesirable meat quality that leads to loss of product value and is therefore not wanted in meat animals. In animals, two enzymes displaying different cleavage effects on carotenoids have been identified; BCO1 (beta-carotene oxygenase 1) which cleaves β-carotene symmetrically into two retinal molecules, and BCO2 (beta-carotene oxygenase 2) which cleaves β-carotene asymmetrically into β-apo-10′-carotenal (C27) and β-ionone (C13) [5-8]. An important function of these two enzymes is to execute the first step in degradation of the large amounts of carotenoids absorbed from the plant rich diet of ruminants. Functional failure of these enzymes may lead to accumulation of intact carotenoids in body tissues like fat or muscle. This effect has been illustrated by mutations influencing either transcript levels or protein coding sequence for both genes in several organisms [9-12]. Mutations in BCO2 especially seem to result in accumulation of carotenoids and yellow colouration of tissues [13, 14], possibly due to its broader substrate specificity [15, 16]. Earlier we have reported that a mutation that introduces a stop codon in amino acid position 66 of ovine BCO2 is associated with yellow fat in Norwegian White Sheep breed [12]. However, in the native Norwegian breed Spælsau, the yellow fat trait is found to segregate in the absence of this mutation, suggesting that alternative functional mechanism is influencing this trait. In the present study we searched for novel BCO2 mutations in the Spælsau breed that could explain the yellow fat phenotype and included Nanopore long range sequencing to also detect structural variants that possibly could influence this trait.

Results

Our initial experiments (sample set 1) to better understand the mechanism(s) responsible for yellow fat in Norwegian Spælsau included performing PCR on cDNA from animals presenting white or yellow fat to detect expression of BCO2. Four primer pairs targeting BCO2 produced 4 fragments of expected size in the three individuals showing white fat, while no fragments were amplified from the individual with yellow fat (Fig. 1).
Fig. 1

Figure shows 4 different sets of primers (A: 7541–7542, B: 7543–7544, C: 7545–7546, D: 7547–7548) amplifying different subregions of the ovine BCO2 cDNA sequence in 4 different individuals (20025, 50289, 70203 and 70346, respectively). No fragments are amplified in the yellow fat individual (70346). The band in 70346 - D is an artefact which also is visible in the 3 other individuals, in addition to the band of expected size found in the other 3. The full-length, unprocessed gel picture is found in Fig. S2a. The size marker is 1 kb GeneRuler®

Figure shows 4 different sets of primers (A: 7541–7542, B: 7543–7544, C: 7545–7546, D: 7547–7548) amplifying different subregions of the ovine BCO2 cDNA sequence in 4 different individuals (20025, 50289, 70203 and 70346, respectively). No fragments are amplified in the yellow fat individual (70346). The band in 70346 - D is an artefact which also is visible in the 3 other individuals, in addition to the band of expected size found in the other 3. The full-length, unprocessed gel picture is found in Fig. S2a. The size marker is 1 kb GeneRuler® Genomic DNA from the single yellow fat individual (70346) and from an individual with the white fat phenotype (20025) was sequenced using nanopore long read technology. Over the course of two consecutive PromethION sequencing runs, one flow-cell yielded 6,908,462 reads (73 Gb raw data). After demultiplexing, 78% of reads (n = 5,387,322) were assigned either to sample 20025 (1,330,100 reads; 21 Gb) or to sample 70346 (2,512,544 reads; 27.2 Gb). After filtering for quality and read length (Q > 7, length > 4 kb) a total of 20.2 Gb data remained for individual 20025 (≈7X coverage; median read length = 14,792, N50 read length = 23,141) and 25.8 Gb for individual 70346 (≈9X coverage, median read length = 10,567, N50 read length = 13,570 bp). Filtered nanopore reads were mapped to the Oar_rambouillet_v1.0 reference and examined for SV’s. Within the 70 kb genomic interval harbouring BCO2 (NC_040266.1: 25,021,687-25,091,194), 7 SV’s were detected. Six of these (see Table S1) were found in both individuals (both white and yellow fat phenotype). These were disregarded as candidate SVs explaining the yellow fat phenotype. The single remaining SV consisted of a 7939 bp insertion at reference genome position NC_040266.1: 25,022,547 which is 730 bp downstream from the end of BCO2’s first exon (Fig. 2). The inserted sequence showed high similarity (99.0% identity) and covered the full length (7941 bp) of the endogenous Jaagsiekte sheep retrovirus (enJSRV; accession MF175071.1). Compared to the virus genome reference sequence (NC_001494.1), which is 7462 bp long, the endogenous version is 479 bp longer due to longer repeats at each end of the enJSRV. The virus sequence is 92.8% identical and shows 98% coverage to the inserted enJSRV sequence. The enJSRV insertion was verified with PCR using primer pairs 7554–7555 and 7556–7557 in the two sequenced animals (20025 and 70346), which gave expected products of 686 bp and 766 bp, respectively, spanning the upstream and downstream sheep BCO2 - enJSRV junctions, respectively. The primer pair spanning the insertions site 7552–7553 did not amplify any product in the yellow fat animal (70346), while it did in the heterozygous white fat animal (20225) (Fig. 2). Complete BCO2 intron 1 sequence, including the 7939 bp enJSRV insertion is available under accession LR701838.1.
Fig. 2

A 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) element inserted into the first intron of the ovine BCO2 - gene. A The BCO2 first intron is shown together with exon 1 and exon 2. The insertion point of the enJSRV is indicated in red, 730 bp downstream of exon 1. The line below is showing the corresponding chromosome 15 positions in bp. B BCO2 intron 1 is shown with and without the inserted endogenous virus element. C Primer pairs for amplifying the enJSRV insertion point when no insertion is present (7552/7553), the upstream intron 1/enJSRV junction (7554/7555) and the downstream enJSRV/intron 1 juction (7556/7557). Distances are not drawn to scale. D Gel separations of PCR-products resulting from the primer combinations shown in the previous section (c). Genotypes are scored as wild type (wt) or carrier of the endogenous Jaagsiekte Sheep Retrovirus (ins). Example lanes are copied from 3 different gels used for genotyping (Fig. S2b,c,d). The primer combinations 7552/7553, 7554/7555 and 7556/7557 are shown from left to right. The lanes resulting from each of the 3 primer pairs are grouped together for the genotypes wt/wt, wt/ins and ins/ins, respectively. The size marker in lane 1 is 100 bp GeneRuler®. E The corresponding phenotypes of the genotypes shown in previous section (d). Photo: Nortura SA

A 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) element inserted into the first intron of the ovine BCO2 - gene. A The BCO2 first intron is shown together with exon 1 and exon 2. The insertion point of the enJSRV is indicated in red, 730 bp downstream of exon 1. The line below is showing the corresponding chromosome 15 positions in bp. B BCO2 intron 1 is shown with and without the inserted endogenous virus element. C Primer pairs for amplifying the enJSRV insertion point when no insertion is present (7552/7553), the upstream intron 1/enJSRV junction (7554/7555) and the downstream enJSRV/intron 1 juction (7556/7557). Distances are not drawn to scale. D Gel separations of PCR-products resulting from the primer combinations shown in the previous section (c). Genotypes are scored as wild type (wt) or carrier of the endogenous Jaagsiekte Sheep Retrovirus (ins). Example lanes are copied from 3 different gels used for genotyping (Fig. S2b,c,d). The primer combinations 7552/7553, 7554/7555 and 7556/7557 are shown from left to right. The lanes resulting from each of the 3 primer pairs are grouped together for the genotypes wt/wt, wt/ins and ins/ins, respectively. The size marker in lane 1 is 100 bp GeneRuler®. E The corresponding phenotypes of the genotypes shown in previous section (d). Photo: Nortura SA To test whether exon 1 (located upstream of the insertion point) could still be expressed in a homozygous carrier we amplified a subregion of exon 1 (primers 7550–7551) from cDNA. A band of expected size (112 bp) was produced, indicating that BCO2 exon 1 was being transcribed in individual 70346. By combining a BCO2 exon 1 forward primer (7550) with enJSRV specific reverse primer (7555) we were able to generate a 188 bp PCR product using cDNA from the yellow fat individual (70346). Sanger sequencing this fragment between the two primer binding sites revealed it to be composed of 94 bp from BCO2 exon 1, and 55 bp of enJSRV sequence (in a non-protein coding region), beginning at the base corresponding to position 415 in the enJSRV sequence (MF175071.1) (Fig. 3).
Fig. 3

Diagram of the viral insertion in the BCO2 gene (NC_040266.1: 25021687–25,091,194). The splice donor and acceptor sites are indicated in green. The solid dark colour in the viral insertion is indicating the protein translation start point in the spliced mRNA

Diagram of the viral insertion in the BCO2 gene (NC_040266.1: 25021687–25,091,194). The splice donor and acceptor sites are indicated in green. The solid dark colour in the viral insertion is indicating the protein translation start point in the spliced mRNA Analysis of sample set 2 (26 individuals with an expected relatively high frequency of the yellow fat allele) showed that 10 were heterozygous for the insertion, 4 were homozygous for the insertion, and the remaining 12 lambs were homozygous wild type. The abattoir’s meat-grading report noted that the 4 homozygous animals displayed yellow fat, while the remaining group had white fat (Table 1).
Table 1

Fat colour grading and genotypes of 26 lambs descending from two different rams (76245736 and 89012427) known to produce yellow fat offspring. The ewes also have an increased probability of carrying the yellow fat allele, due to relationship to known carriers. Genotypes are scored as wild type (wt) or carrier of the endogenous Jaagsiekte Sheep Retrovirus (ins) based on the PCR-test described in materials and methods

Lamb IDRamEweSexPhenotypeGenotype
900277624573637200184malewhite fatwt/ins
900297624573637200184malewhite fatwt/wt
900417624573689740216malewhite fatwt/ins
900597624573637198929femalewhite fatwt/ins
900607624573637198929malewhite fatwt/wt
900727624573689740213femalewhite fatwt/ins
900737624573689740213femalewhite fatwt/wt
900018901242782424293femaleyellow fatins/ins
900028901242782424293femaleyellow fatins/ins
900158901242776245888femalewhite fatwt/ins
900198901242788844575femaleyellow fatins/ins
900758901242776382061femalewhite fatwt/ins
900778901242776382061femalewhite fatwt/wt
900838901242737199669femalewhite fatwt/wt
901048901242770456589femalewhite fatwt/ins
901158901242782991541femalewhite fatwt/wt
902018901242788842546malewhite fatwt/wt
902028901242788842546malewhite fatwt/wt
902148901242776245888malewhite fatwt/wt
902288901242776245885malewhite fatwt/ins
902308901242776245885malewhite fatwt/wt
902978901242789400436maleyellow fatins/ins
902988901242789400436malewhite fatwt/wt
903078901242737199669malewhite fatwt/ins
903308901242770456589malewhite fatwt/wt
903368901242782991541malewhite fatwt/ins
Fat colour grading and genotypes of 26 lambs descending from two different rams (76245736 and 89012427) known to produce yellow fat offspring. The ewes also have an increased probability of carrying the yellow fat allele, due to relationship to known carriers. Genotypes are scored as wild type (wt) or carrier of the endogenous Jaagsiekte Sheep Retrovirus (ins) based on the PCR-test described in materials and methods

Discussion

In this study we investigated whether changes the BCO2 gene could be responsible for yellow fat phenotype observed in Norwegian spælsau. By performing PCR on cDNA, we were able to confirm the expression of BCO2 in 3 individuals displaying the white fat phenotype, however no amplification products were observed in the yellow fat individual. This indicated that the yellow fat phenotype was due to downregulated expression of BCO2 mRNA, but our results did not offer insight into the mechanism underlying this. To investigate if novel genomic rearrangements (for example structural variants) in the BCO2 region could account for the lack of detectable mRNA, we sequenced DNA from both a single yellow- and white-fat individual. This revealed the presence of a complete enJSRV-sequence inserted between exon 1 and exon 2 in the BCO2 gene. By amplifying a subregion of exon 1 from cDNA, we could establish that the insertion does not appear to interfere with expression of exon 1 in a homozygous carrier, leading us to hypothesize that gene regulation is unaffected by the insertion and that the enJSRV sequence within intron 1 is interrupting the normal splicing process. By combining a forward primer located in the BCO2 exon 1 with a reverse primer located 470 bp into the enJSRV sequence, a hybrid cDNA product was amplified consisting of 94 bp from BCO2 exon 1 and 55 bp of enJSRV sequence. If translated, this hybrid mRNA sequence would give rise to 29 amino acids of the wild-type ovine BCO2 protein chimerized to 1 amino acid coded by the junction sequence followed by 28 amino acids coded by the enJSRV-sequence, before the protein is terminated by a stop codon. Knowing that the full-length protein consists of 575 amino acids, we theorize that it is highly unlikely that these 58 peptides can perform the functions of wildtype BCO2 enzyme in animals homozygous for the enJSRV insertion. To strengthen our finding that the enJSRV insertion is functionally impacting transcript processing of BCO2, we genotyped 26 additional individuals (sample set 2) with an expected high frequency of the yellow fat allele. Comparing our genotypes with the reported phenotypes of these 26 individuals, we observed a genotype pattern consistent with recessive inheritance of the yellow fat phenotype. Due to the relatively low frequency of this phenotype in the population and access to individuals, the number of individuals included in the present study is low. However, based on the available evidence we conclude that the enJSRV insertion in BCO2 (intron 1) is a strong candidate for the yellow fat phenotype in spæl sheep. To the best of our knowledge, this insertion also represents the first example of a structural variant (excluding copy number variation) affecting a quality trait in this production livestock species.

Conclusions

In this study we identified an insertion of an endogenous Jaagsiekte Sheep Retrovirus element in the BCO2 gene in the Norwegian spælsau breed by using Nanopore sequencing technology. The insertion is localised in the first intron of BCO2 and interrupts the mRNA splicing process. The resulting mRNA consists of BCO2 exon 1 sequence fused with endogenous retrovirus sequence, leaving an open reading frame of totally 58 amino acids. Given that the wild type BCO2 enzyme consists of 575 amino acids, we find it highly unlikely that the hybrid protein of 58 amino acids can have any enzyme function. Our results make it possible for the sheep farming industry to screen their breeding candidates for this variant to avoid the yellow fat phenotype. We also think this paper clearly illustrate the strength of using long-read sequencing technology to search for structural variation and it also exemplifies how such variation can directly influence gene function.

Methods

Animals

In Norwegian abattoirs, fat colour in sheep carcasses is graded as “normal” (white) or “yellow” and recorded at the individual level within the Norwegian Sheep Recording System. For sample set 1, we obtained samples from 4 Spælsau animals at slaughter from a private farm with a history of producing yellow fat lambs (sample set 1). Liver samples (approximately 0.125 cm3) from a yellow fat male (individual 70346), and from two white fat males (50289,70203) and one white fat female (20025) were collected and stored in RNAlater™ (QIAGEN, Hilden, Germany). The white fat individuals may be carriers of the genetic variant(s) causing yellow fat, based on their relationship to known yellow fat animals, but most likely not homozygous. Subsequently, a larger set of 26 Spælsau lamb samples (Table 1) were collected from two private farms in Norway (sample set 2). Lambs from each farm were half-sibs descending from one of two rams registered with some offspring displaying the yellow fat trait. Similarly, mothers of these lambs were also known to be related to individuals presenting yellow fat, and therefore had an increased probability of carrying at least one yellow fat allele. To be specific, 5 ewes had offspring with yellow fat, 9 ewes had a parent with offspring with yellow fat and one ewe was half-sib of individual 70203 in sample set 1. The farms contributing to both sample set 1 and 2 are members of the Norwegian Sheep Recording System.

RNA extraction and cDNA synthesis

RNA was extracted using the RNeasy®Plus Universal Mini Kit from QIAGEN according to the manufacturer’s instructions. The concentration and purity of the RNA was measured using a NanoDrop 8000 (Thermo Scientific), and the integrity of RNA was measured using a Bioanalyzer 2100 (Agilent). All samples had an RNA integrity value (RIN) of at least 8.1. cDNA was produced using a SuperScript™ II Reverse Transcriptase kit from Invitrogen according to manufacturer’s instructions.

PCR amplification of BCO2 cDNA

To amplify the complete cDNA sequence of BCO2, four pairs of validated primers (A: 7541–7542, B: 7543–7544, C: 7545–7546, D:7547–7548) were mixed with cDNA and AmpliTaq Gold® Polymerase (Applied Biosystems) in four separate PCR reactions generating overlapping regions of the BCO2 cDNA [12]. The PCR was performed using 10 min at 95 °C, and 40 cycles of 95 °C for 30 s, 57 °C for 30 s and 72 °C for 1.5 min. Expected fragment sizes are 692 bp, 822 bp, 491 bp and 660 bp for primer pairs A, B, C and D, respectively (Fig. 1).

Nanopore sequencing

High-molecular-weight DNA from white (20025) and yellow fat (70346) individuals was extracted from liver tissue using Genomic-tips (G/100) from Qiagen, and fragments smaller than 25Kb were progressively depleted using a Short Read Eliminator kit (Circulomics; USA). Sequencing libraries were prepared using Ligation sequencing kit (LSK109, Oxford Nanopore) with native barcoding (EXP-NBD104, Oxford Nanopore). Equal masses of libraries were combined, 300 ng was loaded into a single PromethION flowcell (FLO-PRO002). After 23 h the run was stopped (producing 36 Gb raw data) and the flow-cell regenerated according to Oxford Nanopore’s nuclease flush protocol. The remaining pooled library (230 ng) was added to the same flow-cell and a new sequencing run performed (22.2 h; 22 Gb raw data).

Base-calling and quality filtering

Nanopore reads were base-called using Guppy, version 3.0.3 (Oxford Nanopore, MinKNOW v.19.05.1) using the ‘High accuracy’ flip-flop model. Reads from the two sequencing runs were merged and demultiplexed with QCAT (https://github.com/nanoporetech/qcat). Demultiplexed reads from each sample were trimmed for 50 bp from the start and quality-filtered for average PHRED quality > 7 and minimum length of 4000 bp with fastp (v0.19.5) options “ –disable trim_poly_g --disable_adapter_trimming -q 7 -l 4000 -f 50 “ [17].

Structural variant detection

Quality-filtered reads were mapped to the sheep reference genome Oar_rambouillet_v1.0 (RefSeq accession GCF_002742125.1) using minimap2 (v2.16-r922) [18]. Structural variants (SV’s) were called with the SV-caller SVIM (v0.5.0) using default parameters [19]. SVs within 100 Kbp of the candidate gene BCO2 (NM_001159278.1) were inspected visually with Integrative Genomics Viewer (IGV) [20]. As a complementary approach to identify larger rearrangements between the sheep reference genome and the yellow fat individual (70346), quality-filtered reads of individual 70346 were assembled using Flye software (v2.4.2) with options “--genome-size 2.8g -m 10000” [21]. Contigs from the individual 70346 genome assembly were mapped to the sheep reference genome using minimap2 (v2.16-r922) [18]. Candidate contigs spanning BCO2-region were aligned and dot-plotted against the sheep reference genome using Gepard (v1.40) for visual inspection [22], (see Fig. S1).

Identification of intronic insertion in BCO2

Candidate SVs within the BCO2 gene region were filtered for presence only in individual 70346 or following expected allele pattern among the two individuals (homozygous in individual 70346 and heterozygous in individual 20025. On-line blastn [23] was used to identify the inserted sequence in BCO2 intronic region (INS_chr15_25022547). Insertion boundaries were determined by aligning contigs of sheep_70346 genome assembly against the Oar_rambouillet_v1.0 reference genome.

Detection of BCO2 exon 1 and BCO2- JSRV hybrid cDNA in the yellow fat animal

A 112 bp exon 1 fragment of BCO2 from the yellow fat individual (70346) was amplified using primers 7550/7551 (Table 2). A hybrid fragment consisting of sheep BCO2 exon 1 sequence and JSRV sequence were amplified from the same individual using primers 7550/7555. In both cases cDNA was used as template with the following thermo cycler program: 10 min at 95 °C and 40 cycles at 95 °C for 30 s, 57 °C for 30 s and 72 °C for 30 s using AmpliTaq Gold® Polymerase (Applied Biosystems). The 7550/7555 product was DNA sequenced by Sanger technology at Eurofins Scientific, Luxembourg, using the same two primers for the sequencing reaction.
Table 2

Primers used in addition to those described in Våge & Boman 2010

PrimerSequence 5′ - 3’PositionDirectionNCBI reference seq
7550CTGCTGCTGCAGAACTCAAC24–43FNM_001159278
7551GGGATCCGGCGTAATATCAT116–135RNM_001159278
7552AATCCCATGGACGGAGAAG25,022,430–25,022,448FNC_040266.1
7553CTCCCTTTAAGAGGCAGCAT25,022,631–25,022,650RNC_040266.1
7554CAGGAAACCTGGGTTCGAT530–548FLR701838.1
7555GGCGAGGAAAACTGTCGAG1197–1215RLR701838.1
7556CACCAACATCTTATGGAGCTTTT8182–8204FLR701838.1
7557GGGTTCTTTGCCATTAGCAC8928–8947RLR701838.1
Primers used in addition to those described in Våge & Boman 2010

PCR to detect the presence or absence of the endogenous virus sequence in genomic DNA

To detect the presence or absence of endogenous virus sequence in genomic DNA, three pairs of primers were designed (Table 2): one pair (7552/7553) was designed to amplify across the insertion point without any insertion, one pair (7554/7555) to amplify the junction between the BCO2 intron sequence and the upstream enJSRV region and one (7556/7557) to amplify the junction between the BCO2 intron sequence and the downstream enJSRV region. Expected fragments lengths are 221 bp, 686 bp and 766 bp, respectively. DNA was denatured for 10 min at 95 °C and PCR run for 40 cycles at 95 °C for 30 s, 58 °C for 30 s and 72 °C for 1.5 min using using AmpliTaq Gold® Polymerase (Applied Biosystems). Additional file 1: Table S1. Contain information about 6 additional structural variants detected within the 70 kb genomic interval harbouring BCO2 gene. Additional file 2: Figure S1. A plot showing the alignment of a the 70 kb contig constructed from nanopore reads from a yellow-fat individual aligned to the ovine reference genome Additional file 3: Figure S2. Full-length, unprocessed gel pictures of the gels shown in Fig. 1 and Fig. 2D.
  20 in total

1.  Cloning and expression of beta,beta-carotene 15,15'-dioxygenase.

Authors:  A Wyss; G Wirtz; W Woggon; R Brugger; M Wyss; A Friedlein; H Bachmann; W Hunziker
Journal:  Biochem Biophys Res Commun       Date:  2000-05-10       Impact factor: 3.575

2.  Identification, expression, and substrate specificity of a mammalian beta-carotene 15,15'-dioxygenase.

Authors:  T M Redmond; S Gentleman; T Duncan; S Yu; B Wiggert; E Gantt; F X Cunningham
Journal:  J Biol Chem       Date:  2000-11-22       Impact factor: 5.157

3.  Assembly of long, error-prone reads using repeat graphs.

Authors:  Mikhail Kolmogorov; Jeffrey Yuan; Yu Lin; Pavel A Pevzner
Journal:  Nat Biotechnol       Date:  2019-04-01       Impact factor: 54.908

4.  Enzymatic formation of apo-carotenoids from the xanthophyll carotenoids lutein, zeaxanthin and β-cryptoxanthin by ferret carotene-9',10'-monooxygenase.

Authors:  Jonathan R Mein; Gregory G Dolnikowski; Hansgeorg Ernst; Robert M Russell; Xiang-Dong Wang
Journal:  Arch Biochem Biophys       Date:  2010-11-21       Impact factor: 4.013

5.  Genetic variation in the beta, beta-carotene-9', 10'-dioxygenase gene and association with fat colour in bovine adipose tissue and milk.

Authors:  R Tian; W S Pitchford; C A Morris; N G Cullen; C D K Bottema
Journal:  Anim Genet       Date:  2009-11-26       Impact factor: 3.169

6.  Mutation in bovine beta-carotene oxygenase 2 affects milk color.

Authors:  S D Berry; S R Davis; E M Beattie; N L Thomas; A K Burrett; H E Ward; A M Stanfield; M Biswas; A E Ankersmit-Udy; P E Oxley; J L Barnett; J F Pearson; Y van der Does; A H K Macgibbon; R J Spelman; K Lehnert; R G Snell
Journal:  Genetics       Date:  2009-04-27       Impact factor: 4.562

7.  Nutrigenetics of carotenoid metabolism in the chicken: a polymorphism at the β,β-carotene 15,15'-mono-oxygenase 1 (BCMO1) locus affects the response to dietary β-carotene.

Authors:  Maamer Jlali; Benoit Graulet; Béatrice Chauveau-Duriot; Estelle Godet; Christophe Praud; Carlos Simões Nunes; Elisabeth Le Bihan-Duval; Cécile Berri; Michel J Duclos
Journal:  Br J Nutr       Date:  2014-03-18       Impact factor: 3.718

8.  Detection of a Cis [corrected] eQTL controlling BCMO1 gene expression leads to the identification of a QTG for chicken breast meat color.

Authors:  Elisabeth Le Bihan-Duval; Javad Nadaf; Cécile Berri; Frédérique Pitel; Benoît Graulet; Estelle Godet; Sophie Y Leroux; Olivier Demeure; Sandrine Lagarrigue; Cécile Duby; Larry A Cogburn; Catherine M Beaumont; Michel J Duclos
Journal:  PLoS One       Date:  2011-07-05       Impact factor: 3.240

9.  fastp: an ultra-fast all-in-one FASTQ preprocessor.

Authors:  Shifu Chen; Yanqing Zhou; Yaru Chen; Jia Gu
Journal:  Bioinformatics       Date:  2018-09-01       Impact factor: 6.937

10.  Identification of the yellow skin gene reveals a hybrid origin of the domestic chicken.

Authors:  Jonas Eriksson; Greger Larson; Ulrika Gunnarsson; Bertrand Bed'hom; Michele Tixier-Boichard; Lina Strömstedt; Dominic Wright; Annemieke Jungerius; Addie Vereijken; Ettore Randi; Per Jensen; Leif Andersson
Journal:  PLoS Genet       Date:  2008-02-29       Impact factor: 5.917

View more
  1 in total

Review 1.  Genetics of the phenotypic evolution in sheep: a molecular look at diversity-driving genes.

Authors:  Peter Kalds; Shiwei Zhou; Yawei Gao; Bei Cai; Shuhong Huang; Yulin Chen; Xiaolong Wang
Journal:  Genet Sel Evol       Date:  2022-09-09       Impact factor: 5.100

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.