Literature DB >> 34096173

Up-regulation of KISS1 as a novel target of Let-7i in melanoma serves as a potential suppressor of migration and proliferation in vitro.

Haider A Alkafaji1, Ahmed Raji1, Heshu S Rahman2, Angelina O Zekiy3, Ali Adili4, Mohammadmahdi Jalili5, Tahereh Hojjatipour6, Angel Cid-Arregui7, Navid Shomali5,8, Saeed Tarzi5, Rozita Tamjidifar5, Ramin Heshmati5, Faroogh Marofi8, Morteza Akbari5, Ali Hasanzadeh8, Mina Deljavanghodrati5, Mostafa Jarahian9, Siamak Sandoghchian Shotorbani5,8.   

Abstract

Melanoma is a kind of skin cancer that is begun by the alteration of melanocytes. miRNAs are small non-coding RNA molecules that regulate a variety of biological processes. KISS1, the metastasis-suppressor gene, encodes kisspeptins which inhibits migration and proliferation of cancers. This study was aimed to determine the role of Let-7i and KISS1 in melanoma cell migration and proliferation. At first, the expression of Let-7i and KISS1 was determined in patients with melanoma. In the in vitro part of the study, Let-7i mimics were transfected and the impact of its restoration on target gene expression, proliferation, migration and apoptosis of SK-MEL-3 melanoma cell line was assessed by real-time PCR and Western blotting, MTT assay, wound-healing assay and flow cytometry, respectively. Besides, KISS1 inhibitor siRNA alone and along with Let-7i was transfected to determine their probable correlation. The results revealed that either Let-7i or KISS1 were down-regulated in patients with melanoma. The results obtained from the in vitro part of the study revealed that restoration of Let-7i reduced the expression of metastasis- and proliferation-related target genes. Moreover, it was revealed that up-regulation of Let-7i attenuated migration and proliferation capability of SK-MEL-3 cells. Besides, it was demonstrated that Let-7i restoration induced apoptosis in melanoma cells. More importantly, the KISS1 inhibitor caused a prominent cell migration and proliferation, attenuated by Let-7i re-expression. To sum up, the present study revealed the impressive role of Let-7i restoration along with its correlation with KISS1 on melanoma carcinogenicity which may be applicable in future in vivo studies.
© 2021 The Authors. Journal of Cellular and Molecular Medicine published by Foundation for Cellular and Molecular Medicine and John Wiley & Sons Ltd.

Entities:  

Keywords:  KISS1; Let-7i; apoptosis; melanoma; migration; proliferation

Mesh:

Substances:

Year:  2021        PMID: 34096173      PMCID: PMC8278109          DOI: 10.1111/jcmm.16695

Source DB:  PubMed          Journal:  J Cell Mol Med        ISSN: 1582-1838            Impact factor:   5.310


BACKGROUND

One of the most dangerous types of skin cancers is melanoma. The main and the most common cause of this cancer is exposure to UV rays. This disease is mainly formed by the accumulation of melanin granules above the keratinocytes in the outer layer of the skin. , , MicroRNAs are small, non‐coding, single‐stranded RNA molecules that are involved in the regulation of diverse biological processes by binding to and inhibiting target genes mainly through post‐translational or gene expression regulation. , , , miRNAs have been shown to be involved in melanoma metastasis, survival and proliferation. , Regulation of microRNAs has been represented as a promising targeted therapy approach against melanoma. It has been revealed that microRNAs interact with important regulatory pathways in melanoma development and progression, suggesting them as a potential contributor to the treatment of melanoma. , MicroRNAs are generally classified into two groups: tumour‐suppressing or tumour‐promoting microRNAs. Tumour suppressor microRNAs show a reduced expression in cancers, while tumour‐promoting (or oncogenic) ones are up‐regulated. Regarding this aberrant expression of microRNAs in cancer, restoration of tumour suppressor microRNAs may attenuate the oncogenicity of cancers by reducing the expression of oncogenic target genes. , , The Let‐7i has been shown to be down‐regulated in several types of cancer including, cervical, lung, liver, prostate, gastric and melanoma cancers, resulting in cancer initiation and progression. Therefore, it has widely been known as a tumour suppressor microRNA. Let‐7is take part in many cellular processes including cell proliferation, migration and differentiation, besides its role as a diagnostic and prognostic, and therapeutic role by involvement in patients' survival. , , Since Let‐7i has been thought to be a tumour suppressor microRNA in melanoma, and the participation of KISS1 has been suggested to be important in melanoma carcinogenesis, we aimed to determine their probable correlation in melanoma. Regarding the conducted studies on the role of KISS1, its role as an inhibitor of metastasis and proliferation in cancers has identified the KISS1 as a promising molecular target for the management of cancer progression and migration. KISS1 has been known as a regulator of metastasis in cancers, such as melanoma. Nowadays, the regulatory role of KISS1 in the progression of several cancers, especially tumorigenesis and metastasis, has come to light; however, its role has not been fully elucidated, so determining its exact role can be beneficial in types of cancers. , This study was aimed to investigate the role of Let‐7i in melanoma by transfection its mimic oligonucleotides. Since the relationship between Let‐7i with several target genes including MMP9, C‐Myc and PTEN has been evaluated in different types of cancer, this study focused on KISS1, a newly identified target gene in which there was no study to determine its association with Let‐7i. In this regard, the present study intended to determine the expression of Let‐7i and KISS1 in patients with melanoma. Besides, the authors tried to elucidate the effects of Let‐7i re‐expression on migration, proliferation, apoptosis and related target gene expression in SK‐MEL‐3 melanoma cells. At the final stage, this work was aimed to determine a possible correlation between Let‐7i and KISS1 in melanoma pathogenesis, so KISS1 inhibitor alone and in combination with Let‐7i was transfected and cell migration and proliferation were measured by wound‐healing and MTT assays, respectively.

MATERIALS AND METHODS

Patient samples

Cancerous tissues and non‐tumour adjacent tissues of 50 patients with melanoma were obtained from patients admitted to Imam Reza Hospital (Tabriz, Iran) by a specialist surgeon. All samples were placed in a freezer at −80℃ immediately after separation, which were then transferred to liquid nitrogen. None of the patients had a history of chemotherapy or radiotherapy. Clinicopathological features of patients have been summarized in Table 1.
TABLE 1

Clinicopathological features of patients

Clinicopathological Features

No. of cases

(N = 50)

Sex
Male31
Female19
Age
≤5529
>5521
Lymph node metastasis
Negative42
Positive8
Tumour thickness (mm)
≤1.028
>1.022
TNM stage
I, II39
III11
Tumour subtype
ALM24
NM18
SSM8

TNM, tumour node metastasis; ALM, acral lentiginous melanoma; NM, nodular melanoma; SSM, superficial spreading melanoma.

Clinicopathological features of patients No. of cases (N = 50) TNM, tumour node metastasis; ALM, acral lentiginous melanoma; NM, nodular melanoma; SSM, superficial spreading melanoma.

Cell culture

Human SK‐MEL‐3 melanoma cells were got from Pasture Institute (Tehran, Iran). The cells were immediately defreezed, cultured and maintained in flasks inside the incubators with 5% CO2 at 37℃. The medium inside the flasks was comprised of RPMI‐1640 + 10٪ FBS +pen strep (Gibco, USA).

Transfection of Let‐7i mimic and KISS1 inhibitor siRNA

At first, SK‐MEL‐3 melanoma cells were seeded into 6‐well plates, and then, Let‐7i oligonucleotide mimic (Microsynth, Austria) was transfected to cells with different doses (5, 7.5 and 10 nmol) along with negative control (scramble mimic) with the jetPEI reagent (Aminsan Co, Iran) according to the manufacturer's protocol. After 48 hours, 20% FBS was added to the cells harvested in RPMI medium. To harness the KISS1 expression, the KISS1 inhibitor siRNA was purchased from Sigma‐Aldrich Company (Steinheim, Germany). Then, approximately 5 × 105 cells were seeded into 6‐well plates, and transfection of 3.3 µg/well KISS1 siRNA was performed using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer protocol. To have control cells, negative control siRNA was transferred using Lipofectamine 2000 reagent.

RNA isolation and real‐time PCR

The cells were cultured into a 6‐well plate. RNAs were extracted by TRIzol reagent based on the protocol (Takara, Japan). RNAs were transcribed into cDNAs by reverse transcription enzyme using a cDNA synthesis kit (Takara, Japan). Real‐time PCR was performed by light cycler 96 instrument (Roche, Germany) using SYBR Premix Ex Taq (BIO FACT Co., Ltd.). The β‐actin gene was considered an internal control. The primer sequences are summarized in Table 2.
TABLE 2

Primer sequences

NameSequences
β‐actinForward5´‐CAAGATCATCACCAATGCCT‐3´
Reverse5´‐CCCATCACGCCACAGTTTCC‐3´
KISS1Forward5′‐CCATTAGAAAAGGTGGCCTCTGT‐3′
Reverse5′‐GACGGCTCAGCCTGGCAGTAG‐3′
PTENForward5´‐TGAGTTCCCTCAGCCGTTACCT‐3´
Reverse5´‐GAGGTTTCCTCTGGTCCTGGTA‐3´
MMP9Forward5´‐GCCACTACTGTGCCTTTGAGTC‐3´
Reverse5´‐CCCTCAGAGAATCGCCAGTACT‐3´
c‐MycForward5´‐CCTGGTGCTCCATGAGGAGAC‐3´
Reverse5´‐CAGACTCTGACCTTTTGCCAGG‐3´
Let‐7i‐5p5´‐UGAGGUAGUAGUUUGUGCUGUU‐3´
Primer sequences

Western blotting

First, the whole proteins were extracted using RIP (radioimmunoprecipitation) lysis buffer (Santa Cruz Biotechnology, Inc). Second, using a semi‐dry blotting system, extracted proteins were loaded on an SDS gel and transferred to PVDF membranes. Then, incubation of the membrane with 0.5% Tween‐20 in PBS and 3% BSA was done for 2 hours at RT (room temperature). The next step was the incubation of the membrane with goat monoclonal antibodies for 2 hours. Further, HRP‐conjugated rabbit or mouse anti‐goat secondary antibodies were used for 1 hour at RT. All antibodies were purchased from Santa Cruz Biotechnology, Inc Finally, the ECL (enhanced chemiluminescence kit) was used to visualize the bands by Western blot imaging instrument (Sabz Co.). ImageJ software was used to qualify the density of bands and normalized to the density of the β‐actin band.

MTT assay

MTT assay was performed to determine the effect of Let‐7i up‐regulation on the viability of SK‐MEL‐3 melanoma cells so approximately 10 000 cells were seeded into 96‐well plates, and the effect of Let‐7i optimum dose transfection on cell viability was measured using the MTT assay kit (Cinnagen, Iran) according to the manufacturer's protocol at the absorbance of 570 nm. Similarly, after transfection of the KISS1 inhibitor, the MTT assay was carried out and the absorbance was read at 570 nm to measure proliferation rate.

Wound‐healing assay

Melanoma cell lines were cultured in 24‐well plates, and the optimum dose of Let‐7i mimic was transfected and grown for 24 hours. After filling the plates, the cells were scratched with a sterile yellow pipette tip. Then, FBS was added to the wells and incubated for 72 hours. Finally, cell migration to the wounded area was monitored and imaged by a reverse microscope (OPTIKA, Italy).

Flow cytometry

200 000 cells were seeded into 6‐well plates, and the optimum dose of Let‐7i was transfected when cells reached 80% confluence. After 48 hours, the FITC Annexin V Apoptosis Detection (eBioscience, USA) was used according to the manufacturer's protocol using a flow cytometry instrument (MACSQuant™, Germany).

Statistical analysis

All experiments were done as triplicate independent experiments, and statistical analysis was carried out using Student's t test or ANOVA in GraphPad Prism version 7. All data were expressed as mean ±SD. Western blot data were analysed using ImageJ. A P‐value less than 0.05 was considered significant.

RESULTS

Let‐7i and KISS1 were down‐regulated in melanoma tissues

Data obtained from qRT‐PCR showed that the expression of Let‐7i and KISS1 has been down‐regulated in melanoma tissues. In this regard, a statistically significant reduction in both Let‐7i expression and KISS1 expression was observed in melanoma tissues in comparison with non‐tumour marginal tissues (Figure 1A and B, ***P < 0.001, ****P < 0.0001) (Data S1).
FIGURE 1

Expression levels of Let‐7i and KISS1 in tissues obtained from patients with melanoma. A, Let‐7i and B, KISS1 were down‐regulated in tissues obtained from patients with melanoma in comparison with adjacent normal tissue. ***P < 0.001 and ****P < 0.0001

Expression levels of Let‐7i and KISS1 in tissues obtained from patients with melanoma. A, Let‐7i and B, KISS1 were down‐regulated in tissues obtained from patients with melanoma in comparison with adjacent normal tissue. ***P < 0.001 and ****P < 0.0001

Transfection of Let‐7i up‐regulated the level of this microRNA in melanoma cells

The expression level of Let‐7i was measured by RT‐qPCR, and the result showed that the expression level of this microRNA up‐regulated in melanoma cell line compared with non‐transfected cells in a dose‐dependent manner (Figure 2. *P < 0.05, **P < 0.01, ****P < 0.0001) (Data S2A). 10 nmol was considered as the optimum dose for subsequent experiments.
FIGURE 2

Restoration of Let‐7i could increase its expression level in a dose‐dependent manner. This figure shows that transfection of Let‐7i mimic increases its expression in a dose‐dependent manner compared with untreated cells. The 10 nM was considered as the optimum dose. *P < 0.05, **P < 0.01 and ****P < 0.0001

Restoration of Let‐7i could increase its expression level in a dose‐dependent manner. This figure shows that transfection of Let‐7i mimic increases its expression in a dose‐dependent manner compared with untreated cells. The 10 nM was considered as the optimum dose. *P < 0.05, **P < 0.01 and ****P < 0.0001

Let‐7i replacement alters expression of both tumour suppressor and oncogenic target genes

The results obtained from real‐time PCR and Western blotting revealed that restoration of Let‐7i could reduce the mRNA and protein expression of oncogenic target genes including c‐Myc and MMP9, while its replacement led to the increment of both mRNA and protein expression of tumour suppressor genes including PTEN and KISS1 (Figures 3 and 4 *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). CT values and fold induction obtained from real‐time PCR have been summarized in Data S2B.
FIGURE 3

Effects of Let‐7i restoration on mRNA expression of aimed target genes. These graphs show that Let‐7i caused the reduction in MMP‐9 and c‐Myc as well as increasing PTEN and KISS1 expression at both mRNA and protein levels compared with untreated cells. *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001

FIGURE 4

Effects of Let‐7i restoration on protein expression of aimed target genes. These graphs show that Let‐7i caused the reduction in MMP‐9 and c‐Myc as well as increasing PTEN and KISS1 expression at both mRNA and protein levels compared with untreated cells. *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001

Effects of Let‐7i restoration on mRNA expression of aimed target genes. These graphs show that Let‐7i caused the reduction in MMP‐9 and c‐Myc as well as increasing PTEN and KISS1 expression at both mRNA and protein levels compared with untreated cells. *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001 Effects of Let‐7i restoration on protein expression of aimed target genes. These graphs show that Let‐7i caused the reduction in MMP‐9 and c‐Myc as well as increasing PTEN and KISS1 expression at both mRNA and protein levels compared with untreated cells. *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001

Replacement of Let‐7i reduced viability of SK‐MEL‐3 melanoma cells via inducing the apoptosis

The results of the MTT assay revealed that Let‐7i could reduce the cell viability of melanoma cells in comparison with the control group (Figure 5, ***P < 0.001). In conjunction with the MTT assay, the dotplots of flow‐cytometry demonstrated that Let‐7i induces apoptosis in comparison with control untreated cells. Here, DMSO was used as a positive control (Figure 6, ****P < 0.0001) (Data S3).
FIGURE 5

Let‐7i up‐regulation caused the reduction in melanoma cells’ viability. This figure indicates that Let‐7i transfection reduced melanoma cells’ viability in comparison with untreated cells. ***P < 0.001

FIGURE 6

Effect of Let‐7i replacement on apoptosis induction. It can be deducted from these dotplots that Let‐7i transfection could induce apoptosis in melanoma cells in comparison with untreated cells. NC, negative control; PC, positive control; ****P < 0.0001

Let‐7i up‐regulation caused the reduction in melanoma cells’ viability. This figure indicates that Let‐7i transfection reduced melanoma cells’ viability in comparison with untreated cells. ***P < 0.001 Effect of Let‐7i replacement on apoptosis induction. It can be deducted from these dotplots that Let‐7i transfection could induce apoptosis in melanoma cells in comparison with untreated cells. NC, negative control; PC, positive control; ****P < 0.0001

Down‐regulation of KISS1 increased melanoma cells' proliferation while this effect was attenuated after replacement of Let‐7i

To be convinced that Let‐7i has an association with KISS1 in melanoma pathogenesis, rescue experiments were performed. In this regard, we hypothesized that KISS1 inhibition could increase melanoma cells' proliferation and its expression may be attenuated after Let‐7i transfection. Regarding this hypothesis, KISS1 inhibitor siRNA was transfected to melanoma cells with and without Let‐7i mimics. Then, cell proliferation assay and Western blot were performed. The results demonstrated that down‐regulation of KISS1 by specific siRNA led to increased proliferation of melanoma cells while simultaneous transfection of Let‐7i and KISS1 inhibitor attenuated KISS1 inhibitor‐induced proliferation (Figure 7A‐C, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). To sum up, these results showed that KISS1 participated in melanoma pathogenesis by reducing proliferation and Let‐7i suppresses melanoma cell proliferation via affecting the KISS1 expression.
FIGURE 7

Let‐7i restoration could reduce cell proliferation by up‐regulating the KISS1 expression. (A and B) The results of the Western blot analysis showed that Let‐7i increased KISS1 protein expression in the SK‐MEL‐3 cell line. (C) The results obtained from the MTT assay showed that Let‐7i inhibited cell proliferation induced by KISS1 inhibitor in the melanoma cell line. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001

Let‐7i restoration could reduce cell proliferation by up‐regulating the KISS1 expression. (A and B) The results of the Western blot analysis showed that Let‐7i increased KISS1 protein expression in the SK‐MEL‐3 cell line. (C) The results obtained from the MTT assay showed that Let‐7i inhibited cell proliferation induced by KISS1 inhibitor in the melanoma cell line. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001

KISS1 inhibition caused increased migration in melanoma cell line while Let‐7i could modulate this effect by up‐regulation KISS1 expression

In this section, the effect of KISS1 inhibition on melanoma cells' migration was evaluated via a wound‐healing assay. The results showed that inhibition of KISS1 increased the migration of melanoma cells compared with the control, while this effect was attenuated when combined with Let‐7i. It was also shown that Let‐7i could sharply attenuate the migration capability of melanoma cells when compared to control cells. Besides, it was demonstrated that simultaneous transfection of Let‐7i and KISS1 inhibitor attenuated migration compared with when only the KISS inhibitor was transfected. (Figure 8A‐B, **P < 0.01, ***P < 0.001, ****P < 0.0001). To sum up, these results showed that KISS1 participated in melanoma pathogenesis by reducing migration and Let‐7i suppresses melanoma cell migration via increasing the KISS1 expression.
FIGURE 8

Let‐7i restoration could attenuate cell migration induced by the KISS1 inhibitor. It can be seen that inhibition of KISS1 increased the migration of melanoma cells compared with the control, while this effect was attenuated when combined with Let‐7i. It can also be deducted from these figures that Let‐7i could sharply attenuate the migration capability of melanoma cells in comparison with control cells. These figures also reveal that simultaneous transfection of Let‐7i and KISS1 inhibitor attenuated migration compared to when only the KISS inhibitor was transfected. **P < 0.01, ***P < 0.001 and ****P < 0.0001

Let‐7i restoration could attenuate cell migration induced by the KISS1 inhibitor. It can be seen that inhibition of KISS1 increased the migration of melanoma cells compared with the control, while this effect was attenuated when combined with Let‐7i. It can also be deducted from these figures that Let‐7i could sharply attenuate the migration capability of melanoma cells in comparison with control cells. These figures also reveal that simultaneous transfection of Let‐7i and KISS1 inhibitor attenuated migration compared to when only the KISS inhibitor was transfected. **P < 0.01, ***P < 0.001 and ****P < 0.0001

DISCUSSION

Melanoma is the most commonly known skin cancer. This type of cancer can spread rapidly in the body. Although surgical removal or excision is the main therapeutic approach for the primary melanoma on the skin, its high recurrence makes it hard to deal with this disease. Therefore, novel therapeutic approaches including targeted therapies may take part as a beneficial method for patients who suffer from melanoma. , , , MicroRNAs are present in the entire human genome except for the Y chromosome. Approximately 80% of human microRNA genes are located in intronic regions, in both protein and non‐protein‐coding regions. , MicroRNAs based on their role are categorized into two groups, one of which is tumour suppressor microRNAs and another one is oncogenic microRNAs. Oncogenic microRNAs are up‐regulated in cancers and take part in cancer carcinogenesis via suppressing the tumour suppressor genes and increasing the oncogenic ones while tumour suppressor microRNAs like Let‐7i get down‐regulated in cancers which their restoration can be a beneficial therapeutic approach. , In a study conducted by Serguienko et al, it was shown that restoration of Let‐7i could reduce metastatic potency of WM239 melanoma cells. Restoration of let‐7i was reported to be involved in the reduction in melanoma cells' progression via regulating several target genes, leading to inhibition of melanoma development. , Similarly, the participation of Let‐7i in the reduction in the proliferative capacity of several types of cancers has also been reported. , , Besides, Let‐7i was reported as a potential tumour suppressor microRNA in melanoma by reducing cell viability in human malignant melanoma cells in vitro by decreasing either cell proliferation or apoptosis induction. , , All of these studies were consistent with the present study in which showed that restoration of Let‐7i could reduce cell proliferation, migration as well as induced apoptosis in melanoma cells in vitro. Considering the role of Let‐7i in regulating target genes involved in melanoma carcinogenesis, MMP9, c‐Myc and PTEN, which have a potential role in controlling the biology of melanoma, were selected from the mirdb.org website (MicroRNA target prediction database) or previous studies. PTEN, a fundamental tumour suppressor, plays its role through PI3K‐independent signalling pathway modulation via regulation of extended biological functions, such as cell proliferation, metabolism, metastasis and survival, leading to suppression of cancer initiation or progression. It has been seen in a wide spectrum of cancers that PTEN is down‐regulate which is leading to cancer progression. , , The c‐Myc as an oncogenic target gene has been shown to be up‐regulated in several types of cancers. Its up‐regulation takes its role by suppressing the cell growth' regulators, leading to cell proliferation. , , MMP‐9 is one of the most widely studied and well‐documented MMPs in cancers which has been determined to be involved in several biological processes, especially take a part in extracellular matrix (ECM) degradation. Therefore, its involvement in several cancers' pathogenesis has been well‐documented which takes part in metastasis and invasion. , Let‐7i was first identified to be involved in modulating the differentiation of adipose‐derived stem cells (ASCs) via targeting MMP‐9. In line with this work, it was demonstrated that Let‐7i regulates cell migration of melanoma cells via directly targeting MMP‐9 in vitro. , Similar to the statements of the authors in the present study, Let‐7i was shown to reduce the survival of lung cancer by modulating several target genes, one of which was c‐ Myc. Results of studies have revealed that PTEN has been decreased in metastatic melanoma tumours, and it was hypothesized that mutations in the PI3K pathway may be responsible for this decrement. Therefore, one of the most important mechanisms by which activates the oncogenic PI3K/AKT signalling pathway is the loss of the PTEN tumour suppressor gene. It had been proposed that Let7 may attenuate cancer progression via increasing PTEN and further regulating PI3K/AKT signalling pathway, which was confirmed by the present study. KiSS1 was first described as a potential suppressor of melanoma metastatic capability. Regarding its role in melanoma carcinogenesis, this study sought to determine its association with melanoma carcinogenesis as a predicted target gene of Let‐7i. The results were determined for the first time that Let‐7i restoration could increase KISS1 expression at both mRNA and protein levels, leading to reduced cell proliferation and metastasis.

CONCLUSION

In conclusion, the results of this study specified the involvement of Let‐7i as a tumour suppressor microRNA in melanoma carcinogenesis. In this regard, its restoration could decrease the metastatic and proliferative ability of the SK‐MEL‐3 melanoma cells while induced apoptosis in melanoma cells. Moreover, it could regulate the important target genes involved in melanoma carcinogenesis, one of which (KISS1) was identified for the first time in the literature. Besides, it was determined that restoration of Let‐7i could reduce melanoma cells' proliferation and migration by up‐regulating KISS1. To sum up, restoration of Let‐7i could be a novel therapeutic approach for treating melanoma, most importantly, because it correlates with KISS1; however, it is needed more in vitro and in vivo studies to determine the exact role of Let‐7i in melanoma carcinogenesis.

CONFLICT OF INTEREST

The authors declares that they have no conflicts of interest.

AUTHOR CONTRIBUTIONS

Haider AbdulRidha Alkafaji: Conceptualization (equal); Data curation (equal); Formal analysis (equal); Writing‐review & editing (equal). Ahmed Raji: Conceptualization (equal); Data curation (equal); Formal analysis (equal); Writing‐review & editing (equal). Heshu Sulaiman Rahman: Conceptualization (equal); Data curation (equal); Formal analysis (equal); Writing‐review & editing (equal). Angelina Olegovna Zekiy: Conceptualization (equal); Data curation (equal); Formal analysis (equal); Writing‐review & editing (equal). Ali Adili: Investigation (equal). Mahdi Jalili: Methodology (equal). Tahereh Hojjatipour: Conceptualization (equal); Investigation (equal); Methodology (equal). Angel Cid‐Arregui: Conceptualization (equal); Data curation (equal); Project administration (equal); Resources (equal). Navid Shomali: Conceptualization (lead); Investigation (equal); Methodology (equal); Writing‐original draft (lead). Saeed Tarzi: Methodology (equal). Rozita Tamjidifar: Methodology (equal). Ramin Heshmati: Conceptualization (equal). Faroogh Marofi: Conceptualization (equal); Formal analysis (equal). Morteza Akbari: Writing‐original draft (equal). Ali Hasanzadeh: Conceptualization (equal); Validation (equal). Mina Deljavanghodrati: Conceptualization (equal); Validation (equal). Mostafa Jarahian: Data curation (lead); Supervision (lead); Writing‐original draft (lead); Writing‐review & editing (lead). Siamak Sandoghchian Shotorbani: Conceptualization (equal); Project administration (lead); Supervision (lead).

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

The Ethical Committee of Tabriz University of Medical Sciences approved this study (IR.TBZMED.VCR.REC.1398.164). Written informed consent was obtained from all participants. Supplementary Material Click here for additional data file.
  45 in total

1.  Targeting c-MYC in Platinum-Resistant Ovarian Cancer.

Authors:  Jeyshka M Reyes-González; Guillermo N Armaiz-Peña; Lingegowda S Mangala; Fatma Valiyeva; Cristina Ivan; Sunila Pradeep; Ileabett M Echevarría-Vargas; Adrian Rivera-Reyes; Anil K Sood; Pablo E Vivas-Mejía
Journal:  Mol Cancer Ther       Date:  2015-07-30       Impact factor: 6.261

2.  Let-7b overexpression leads to increased radiosensitivity of uveal melanoma cells.

Authors:  Yixiong Zhou; Leilei Zhang; Jiayan Fan; Renbin Jia; Xin Song; Xiaofang Xu; Liyan Dai; Ai Zhuang; Shengfang Ge; Xianqun Fan
Journal:  Melanoma Res       Date:  2015-04       Impact factor: 3.599

3.  Evaluation of the Methylation of MIR129-2 Gene in Gastric Cancer.

Authors:  Nazila Alizadeh; Milad Asadi; Dariush Shanehbandi; Venus Zafari; Navid Shomali; Touraj Asvadi; Bita Sepehri
Journal:  J Gastrointest Cancer       Date:  2020-03

Review 4.  The biology and clinical relevance of the PTEN tumor suppressor pathway.

Authors:  Isabelle Sansal; William R Sellers
Journal:  J Clin Oncol       Date:  2004-07-15       Impact factor: 44.544

5.  miRNA let-7e targeting MMP9 is involved in adipose-derived stem cell differentiation toward epithelia.

Authors:  M Ventayol; J L Viñas; A Sola; M Jung; B Brüne; F Pi; C Mastora; G Hotter
Journal:  Cell Death Dis       Date:  2014-02-06       Impact factor: 8.469

6.  Metabolic reprogramming of metastatic breast cancer and melanoma by let-7a microRNA.

Authors:  Anastassia Serguienko; Iwona Grad; Anna B Wennerstrøm; Leonardo A Meza-Zepeda; Bernd Thiede; Eva W Stratford; Ola Myklebost; Else Munthe
Journal:  Oncotarget       Date:  2015-02-10

7.  Modeling the Dynamics of Let-7-Coupled Gene Regulatory Networks Linking Cell Proliferation to Malignant Transformation.

Authors:  Claude Gérard; Frédéric Lemaigre; Didier Gonze
Journal:  Front Physiol       Date:  2019-07-11       Impact factor: 4.566

Review 8.  Heat Shock Proteins Regulating Toll-like Receptors and the Immune System could be a Novel Therapeutic Target for Melanoma.

Authors:  Navid Shomali; Leila Sadat Hatamnezhad; Saeed Tarzi; Rozita Tamjidifar; Huaxi Xu; Siamak Sandoghchian Shotorbani
Journal:  Curr Mol Med       Date:  2021       Impact factor: 2.222

Review 9.  PTEN: Tumor Suppressor and Metabolic Regulator.

Authors:  Chien-Yu Chen; Jingyu Chen; Lina He; Bangyan L Stiles
Journal:  Front Endocrinol (Lausanne)       Date:  2018-07-09       Impact factor: 5.555

Review 10.  Functional Roles of Matrix Metalloproteinases and Their Inhibitors in Melanoma.

Authors:  Salvatore Napoli; Chiara Scuderi; Giuseppe Gattuso; Virginia Di Bella; Saverio Candido; Maria Sofia Basile; Massimo Libra; Luca Falzone
Journal:  Cells       Date:  2020-05-07       Impact factor: 6.600

View more
  1 in total

1.  Up-regulation of KISS1 as a novel target of Let-7i in melanoma serves as a potential suppressor of migration and proliferation in vitro.

Authors:  Haider A Alkafaji; Ahmed Raji; Heshu S Rahman; Angelina O Zekiy; Ali Adili; Mohammadmahdi Jalili; Tahereh Hojjatipour; Angel Cid-Arregui; Navid Shomali; Saeed Tarzi; Rozita Tamjidifar; Ramin Heshmati; Faroogh Marofi; Morteza Akbari; Ali Hasanzadeh; Mina Deljavanghodrati; Mostafa Jarahian; Siamak Sandoghchian Shotorbani
Journal:  J Cell Mol Med       Date:  2021-06-06       Impact factor: 5.310

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.