Daigo Tsubokawa1,2, Taisei Kikuchi3, Jae Man Lee4, Takahiro Kusakabe5, Yasuhiko Yamamoto6, Haruhiko Maruyama3. 1. Department of Molecular and Cellular Parasitology, Kitasato University Graduate School of Medical Sciences, Sagamihara, Japan. 2. Department of Parasitology and Tropical Medicine, Kitasato University School of Medicine, Sagamihara, Japan. 3. Division of Parasitology, Department of Infectious Diseases, Faculty of Medicine, University of Miyazaki, Miyazaki, Japan. 4. Laboratory of Creative Science for Insect Industries, Kyushu University Graduate School of Bioresource and Bioenvironmental Sciences, Fukuoka, Japan. 5. Laboratory of Insect Genome Science, Kyushu University Graduate School of Bioresource and Bioenvironmental Sciences, Fukuoka, Japan. 6. Department of Biochemistry and Molecular Vascular Biology, Kanazawa University Graduate School of Medical Sciences, Kanazawa, Japan.
Abstract
Parasitic helminths can reside in humans owing to their ability to disrupt host protective immunity. Receptor for advanced glycation end products (RAGE), which is highly expressed in host skin, mediates inflammatory responses by regulating the expression of pro-inflammatory cytokines and endothelial adhesion molecules. In this study, we evaluated the effects of venestatin, an EF-hand Ca2+-binding protein secreted by the parasitic helminth Strongyloides venezuelensis, on RAGE activity and immune responses. Our results demonstrated that venestatin bound to RAGE and downregulated the host immune response. Recombinant venestatin predominantly bound to the RAGE C1 domain in a Ca2+-dependent manner. Recombinant venestatin effectively alleviated RAGE-mediated inflammation, including footpad edema in mice, and pneumonia induced by an exogenous RAGE ligand. Infection experiments using S. venezuelensis larvae and venestatin silencing via RNA interference revealed that endogenous venestatin promoted larval migration from the skin to the lungs in a RAGE-dependent manner. Moreover, endogenous venestatin suppressed macrophage and neutrophil accumulation around larvae. Although the invasion of larvae upregulated the abundance of RAGE ligands in host skin tissues, mRNA expression levels of tumor necrosis factor-α, cyclooxygenase-2, endothelial adhesion molecules vascular cell adhesion protein-1, intracellular adhesion molecule-1, and E-selectin were suppressed by endogenous venestatin. Taken together, our results indicate that venestatin suppressed RAGE-mediated immune responses in host skin induced by helminthic infection, thereby promoting larval migration. The anti-inflammatory mechanism of venestatin may be targeted for the development of anthelminthics and immunosuppressive agents for the treatment of RAGE-mediated inflammatory diseases.
Parasitic helminths can reside in humans owing to their ability to disrupt host protective immunity. Receptor for advanced glycation end products (RAGE), which is highly expressed in host skin, mediates inflammatory responses by regulating the expression of pro-inflammatory cytokines and endothelial adhesion molecules. In this study, we evaluated the effects of venestatin, an EF-hand Ca2+-binding protein secreted by the parasitic helminth Strongyloides venezuelensis, on RAGE activity and immune responses. Our results demonstrated that venestatin bound to RAGE and downregulated the host immune response. Recombinant venestatin predominantly bound to the RAGE C1 domain in a Ca2+-dependent manner. Recombinant venestatin effectively alleviated RAGE-mediated inflammation, including footpad edema in mice, and pneumonia induced by an exogenous RAGE ligand. Infection experiments using S. venezuelensis larvae and venestatin silencing via RNA interference revealed that endogenous venestatin promoted larval migration from the skin to the lungs in a RAGE-dependent manner. Moreover, endogenous venestatin suppressed macrophage and neutrophil accumulation around larvae. Although the invasion of larvae upregulated the abundance of RAGE ligands in host skin tissues, mRNA expression levels of tumor necrosis factor-α, cyclooxygenase-2, endothelial adhesion molecules vascular cell adhesion protein-1, intracellular adhesion molecule-1, and E-selectin were suppressed by endogenous venestatin. Taken together, our results indicate that venestatin suppressed RAGE-mediated immune responses in host skin induced by helminthic infection, thereby promoting larval migration. The anti-inflammatory mechanism of venestatin may be targeted for the development of anthelminthics and immunosuppressive agents for the treatment of RAGE-mediated inflammatory diseases.
Parasitic helminths are highly prevalent worldwide, particularly in developing countries, with over two billion peopleinfected around the globe [1]. Infection with helminths elicits a type 2 immune response, characterized by eosinophilia, mastocytosis, and increased numbers of type 2 helper T cells and serum IgE levels [2-4]. Helminths have evolved effective strategies to regulate the protective immune response in the host [5], thereby establishing successful tissue migration to their reproductive niche and facilitating chronic parasitism. Helminths dampen or overcome the host immune response by secreting a variety of immunomodulators [6,7]. Recently, various immunomodulators were identified from helminth genomes and proteomes, showing potential for immunologic tolerance to both innate and adaptive responses [8]. These immunomodulators may have dual effects on health. On one hand, they may suppress immunological disorders such as allergy and autoimmunity. On the other hand, they may also suppress immune defense mechanisms by antagonizing vaccine efficacy and resistance to microbial infections [9,10].Percutaneous infection with helminths, such as Necator, Strongyloides, and Schistosoma, induces a robust type 2 immune response in hosts via extensive larval migration [11-13]. However, the innate immune responses to helminths invading the host skin are poorly understood. Helminthic invasion damages host epithelial tissue, and induces the release of host damage-associated molecular patterns (DAMPs) [8], including S100 small calcium-binding proteins, high-mobility group box 1 protein (HMGB1), β-amyloid, and heparin [14]. In healthy cells, HMGB1 acts as a non-histone DNA-binding protein and induces bends in the DNA helix to facilitate interactions between DNA and proteins [15]. DAMPs are recognized by the receptor for advanced glycation end products (RAGE), a multiligand receptor belonging to the immunoglobulin superfamily that is highly expressed in skin cells, including fibroblasts and keratinocytes [16]. RAGE consists of 404 amino acids and contains a V domain followed by C1 and C2 domains, a transmembrane domain, and a short cytosolic tail [17,18]. RAGE/DAMP binding induces the generation of reactive oxygen species (ROS) and activates the signal transduction pathway involving mitogen-activated protein kinases and nuclear factor-kappa B (NF-κB) [14,19]. Subsequently, translocation of NF-κB into the nucleus induces the expression of pro-inflammatory cytokines, such as tumor necrosis factor-α (TNF-α), pro-inflammatory enzymes such as cyclooxygenase 2 (COX2), and endothelial adhesion molecules such as intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1), thereby triggering inflammatory responses [14,18,20,21]. Although helminthic invasion can be readily sensed by RAGE and cause the accumulation of inflammatory cells in the host skin, larvae achieve migration to their niche before being surrounding by inflammatory cells, particularly during primary infection [22,23]. Moreover, macrophages and dendric cells are also activated by DAMPs from epithelial tissues damaged by helminthic larvae, leading to initiation and amplification of the type 2 immune response. Although various immunomodulators are expressed by parasitic helminths to perturb these immune responses, the relationship between helminthic infection and RAGE is unclear. Helminthic larvae may express immunomodulators that interfere with RAGE-mediated innate and acquired immune responses.Recently, we identified and characterized an EF-hand Ca2+-binding protein, venestatin [24] [DDBJ/GenBank LC189319], from the rodent parasitic helminth Strongyloides venezuelensis, a counterpart of the human-infecting species S. stercoralis. The infective third stage larvae (iL3s) penetrate the host skin, migrate to the lungs, and grow into lung stage larvae (LL3s); they then reach the small intestine, where they become parthenogenetic adult female worms and produce eggs. Venestatin, a 19.7 kDa soluble protein, is highly conserved in Strongyloides spp. and its expression is upregulated after invasion of iL3s. Mature venestatin is secreted from the larvae into host skin tissue; therefore, venestatin may have pivotal roles in the larval migration process. Furthermore, recombinant venestatin (r-venestatin) binds with both mouse and humanRAGE [25]. Accordingly, venestatin may act as an immunomodulator in the RAGE signaling pathway, and Strongyloides larvae may use venestatin to achieve successful migration.In the current study, we evaluated the role of venestatin in RAGE-mediated immune responses, larval invasion, and larval migration. Our findings revealed, for the first time, that venestatin inhibited RAGE-mediated immune responses and had beneficial effects on larval migration.
Results
Venestatin bound to the C1 domain of RAGE in a Ca2+-dependent manner
To confirm the affinity of venestatin for RAGE, recombinant humanRAGE [GenPept NP_001340760] or toll-like receptor (TLR) 4 was reacted with immobilized r-venestatin. RAGE, but not TLR4, bound to r-venestatin in a concentration-dependent manner (KD = 43.6 nM; Fig 1A). Both anti-venestatin and anti-RAGE antibodies inhibited binding between r-venestatin and RAGE (S1 Fig). The RAGE-binding affinity of r-venestatin was comparable to that of other established RAGE ligands, such as glyceraldehyde-bovine serum albumin (Gla-BSA), N6-(carboxymethyl) lysine-BSA (CML-BSA), humanHMGB1 [NP_001370341], humanS100A6 [NP_055439], and humanS100A12 [NP_005612] (Fig 1B). Next, we attempted to determine which RAGE domain interacted with venestatin. The RAGE-binding affinity of r-venestatin was significantly inhibited by C1 and C2 domain-interacting RAGE ligands S100A6 and S100A12 (p < 0.01), but not by V domain-interacting ligands Gla-BSA, CML-BSA, and HMGB1 (Fig 1C) [26]. Binding assays with venestatin and recombinant V, C1, or C2 domains revealed that venestatin bound primarily to the C1 domain (p < 0.0001) and displayed significant binding with the C2 domain (p < 0.01; Fig 1D). A three-dimensional homology model of venestatin was developed using the crystal structure of humanmultiple coagulation factor deficiency protein 2 (hMCFD2 [PDB 2VRG]) as a template, which has the highest sequence similarity with venestatin (51%). Computational docking using ClusPro 2.0 software suggested that venestatin centrally bound to the C1 domain of RAGE [PDB 3O3U] (Fig 1E). These data confirmed that venestatin bound mainly to the C1 domain. Because venestatin has two canonical EF-hand Ca2+ binding domains and binds RAGE in a Ca2+-dependent manner [25], the effects of Ca2+ on the binding of venestatin to the C1 and C2 domains were assessed. The binding interaction between venestatin and the C1 domain was significantly stronger in the presence of Ca2+ (p = 0.0029; Fig 1F). Although the presence of Ca2+ did not significantly affect the binding between venestatin and the C2 domain, a Ca2+-dependent interaction trend was observed (p = 0.023; Fig 1G).
Fig 1
Venestatin bound to RAGE.
(A) Venestatin bound to RAGE, but not TLR4, in a concentration-dependent manner. Venestatin-coated (4 μg/mL) wells were reacted with RAGE/TLR4 (0–4 μg/mL) and treated with anti-RAGE or anti-TLR4 antibodies. BSA-coated negative control wells were reacted with RAGE (white circles). Antibodies were detected using HRP-conjugated IgG. (B) Venestatin and other established RAGE ligands bound to RAGE. Venestatin, other RAGE ligands, or BSA (4 μg/mL) were used to coat wells and then reacted with RAGE (1 μg/mL). *p < 0.01 from the venestatin-RAGE binding group. (C) Competitive binding of venestatin to the C1 and C2 domains of RAGE. RAGE (4 μg/mL) was used to coat wells, and wells were then treated with venestatin alone (8 μg/mL) or a mixture of venestatin plus other RAGE ligands (4 μg/mL). Bound venestatin was detected with anti-venestatin sera. *p < 0.01 from a venestatin-RAGE binding group. (D) Venestatin bound to the C1 and C2 domains of RAGE. Wells were coated with V, C1, and C2 domains (4 μg/mL) and then reacted with venestatin; bound venestatin was then detected. *p < 0.01, ***p < 0.0001 from the BSA-treated group. (E) Computational docking of venestatin to RAGE. (F) Ca2+-dependent C1 domain binding. (G) Ca2+-dependent C2 domain binding. Wells were coated with the C1 or C2 domain (4 μg/mL) and reacted with metal-free venestatin (8 μg/mL) with or without Ca2+; bound venestatin was then detected. Calcium chelating control was reacted with Ca2+ and EDTA. *p < 0.01 from Ca2+-containing conditions. Data are expressed as means ± SDs of three independent examinations.
Venestatin bound to RAGE.
(A) Venestatin bound to RAGE, but not TLR4, in a concentration-dependent manner. Venestatin-coated (4 μg/mL) wells were reacted with RAGE/TLR4 (0–4 μg/mL) and treated with anti-RAGE or anti-TLR4 antibodies. BSA-coated negative control wells were reacted with RAGE (white circles). Antibodies were detected using HRP-conjugated IgG. (B) Venestatin and other established RAGE ligands bound to RAGE. Venestatin, other RAGE ligands, or BSA (4 μg/mL) were used to coat wells and then reacted with RAGE (1 μg/mL). *p < 0.01 from the venestatin-RAGE binding group. (C) Competitive binding of venestatin to the C1 and C2 domains of RAGE. RAGE (4 μg/mL) was used to coat wells, and wells were then treated with venestatin alone (8 μg/mL) or a mixture of venestatin plus other RAGE ligands (4 μg/mL). Bound venestatin was detected with anti-venestatin sera. *p < 0.01 from a venestatin-RAGE binding group. (D) Venestatin bound to the C1 and C2 domains of RAGE. Wells were coated with V, C1, and C2 domains (4 μg/mL) and then reacted with venestatin; bound venestatin was then detected. *p < 0.01, ***p < 0.0001 from the BSA-treated group. (E) Computational docking of venestatin to RAGE. (F) Ca2+-dependent C1 domain binding. (G) Ca2+-dependent C2 domain binding. Wells were coated with the C1 or C2 domain (4 μg/mL) and reacted with metal-free venestatin (8 μg/mL) with or without Ca2+; bound venestatin was then detected. Calcium chelating control was reacted with Ca2+ and EDTA. *p < 0.01 from Ca2+-containing conditions. Data are expressed as means ± SDs of three independent examinations.
Venestatin alleviated RAGE-mediated inflammation in mice
To investigate the role of venestatin in the RAGE/ligand axis in vivo, we employed mouseinflammation models generated using pro-inflammatory stimulants Gla-BSA and carrageenan, which induce inflammation in RAGE-dependent and -independent manners, respectively [27]. Histopathological examination of the footpad edema model (Fig 2A) revealed that Gla-BSA injection significantly increased the number of infiltrated inflammatory cells (mean ± standard deviation [SD], 370 ± 79 cells/mm2) compared with phosphate-buffered saline (PBS) injection as a negative control (105 ± 43 cells/mm2, p < 0.0001). Pretreatment with r-venestatin significantly reduced the number of inflammatory cells (188 ± 53 cells/mm2, p < 0.0001) in Gla-BSA injected footpads, but not in carrageenan-injected footpads. Next, the effects of venestatin on mousepneumonia models were evaluated histopathologically (Fig 2B). Both Gla-BSA and carrageenan induced a massive infiltration of inflammatory cells, thick alveolar walls, and narrow alveolar spaces. Pretreatment with r-venestatin prevented inflammatory lung distortions induced by Gla-BSA, but not by carrageenan. The number of infiltrated cells was significantly lower in the Gla-BSA-induced pneumonia model following r-venestatin pretreatment (279 ± 47 cells/mm2) than in that without r-venestatin pretreatment (504 ± 83 cells/mm2, p < 0.0001). Cellular infiltration in both the footpad and lung was not affected by r-venestatin treatment alone (S2 Fig). Production of serum TNF-α, but not IFN-γ, was suppressed by r-venestatin pretreatment in the Gla-BSA-induced inflammation models (S3 Fig). These data suggested that r-venestatin prevented RAGE/ligand axis-mediated inflammation in vivo.
(A) Venestatin attenuated Gla-BSA-induced mouse footpad inflammation. Venestatin (100 μg) or PBS was injected into the hind footpad of each mouse, followed by injection with Gla-BSA (100 μg), 2% carrageenan, or PBS into the same footpad. After 8 h, the footpads were collected, fixed, and sections were stained with H&E. Black squares indicate magnified insets marking examples of inflammatory cells (arrow heads). White bars indicate the number of cells in PBS controls. D, dermal tissue. (B) Venestatin attenuated Gla-BSA-induced pneumonia in mice. Venestatin (50 μg) or PBS was instilled intranasally, followed by intranasal instillation with Gla-BSA (50 μg), 2% carrageenan, or PBS. After 48 h, the lungs were collected, fixed, and sections were stained with H&E. Black squares indicate magnified insets marking examples of inflammatory cells (arrow heads). White bars indicate the number of cells in PBS controls. A, pulmonary alveolus; B, bronchus lumen. Scale bar: 40 μm. Data are expressed as means ± SDs of 12 fields in two mice. ***p < 0.0001. NS, no significant difference.
(A) Venestatin attenuated Gla-BSA-induced mouse footpad inflammation. Venestatin (100 μg) or PBS was injected into the hind footpad of each mouse, followed by injection with Gla-BSA (100 μg), 2% carrageenan, or PBS into the same footpad. After 8 h, the footpads were collected, fixed, and sections were stained with H&E. Black squares indicate magnified insets marking examples of inflammatory cells (arrow heads). White bars indicate the number of cells in PBS controls. D, dermal tissue. (B) Venestatin attenuated Gla-BSA-induced pneumonia in mice. Venestatin (50 μg) or PBS was instilled intranasally, followed by intranasal instillation with Gla-BSA (50 μg), 2% carrageenan, or PBS. After 48 h, the lungs were collected, fixed, and sections were stained with H&E. Black squares indicate magnified insets marking examples of inflammatory cells (arrow heads). White bars indicate the number of cells in PBS controls. A, pulmonary alveolus; B, bronchus lumen. Scale bar: 40 μm. Data are expressed as means ± SDs of 12 fields in two mice. ***p < 0.0001. NS, no significant difference.
Transcription and translation of endogenous venestatin were suppressed in S. venezuelensis larvae by RNA interference (RNAi)
To elucidate the roles of endogenous venestatin secreted from S. venezuelensis during its migration process in host animals, we attempted knockdown of venestatin in S. venezuelensis larvae via RNAi. Accordingly, LL3s derived from the lungs of S. venezuelensis-infectedrats were soaked in double-stranded RNA (dsRNA) encoding venestatin (dsvenestatin). Expression of venestatin mRNA was significantly downregulated in RNAi-treated LL3s in a time-dependent manner, compared with that in control LL3s soaked with firefly luciferase dsRNA (dsluciferase); 45% reduction after 24-h soaking, (p = 0.0007), 74% reduction after 72-h soaking, (p < 0.0001; Fig 3A). Soaking with dsluciferase did not affect the expression of venestatin mRNA, indicating that dsvenestatin specifically disrupted venestatin mRNA. Western blot analysis of the larvae culture medium revealed that the level of secretory venestatin from RNAi-treated LL3s was decreased compared with that from control LL3s (Fig 3B). Although endogenous venestatin was localized in the hypodermis and digestive tracts of control LL3s, venestatin-specific immunofluorescence reactions were nearly absent in RNAi-treated LL3s (Fig 3C). The mobility and morphology of all LL3s were unchanged, despite soaking with dsRNA for 72 h (S4 Fig). These results indicated that RNAi using dsvenestatin efficiently silenced venestatin-specific mRNA expression and subsequent translation of venestatin. The RNAi-treated LL3s were used as venestatin-knockdown larvae for subsequent animal infection experiments.
Fig 3
Post-transcriptional silencing of the venestatin gene in S. venezuelensis.
(A) Quantitative RT-PCR analysis of venestatin transcripts. Lung stage larvae (LL3s) of S. venezuelensis were incubated with venestatin dsRNA as the RNAi-treated group. LL3s in the control group were incubated with luciferase dsRNA. The gene encoding S. venezuelensis actin-like protein (actin) was used as an internal control, and venestatin mRNA copies/actin was calculated. Data are expressed as means ± SDs for three independent experiments with two technical replicates. **p < 0.001; ***p < 0.0001 from the control group. (B) Effects of gene silencing on venestatin protein expression by western blot analysis. Excretory-secretory (ES) products (1 mL culture medium from 10,000 LL3s) were collected after 72 h of soaking with dsRNA and concentrated to 100 μL by ultrafiltration. Proteins were separated by SDS-PAGE on 12% gels under reducing conditions. Membranes were probed with anti-venestatin sera. (C) In situ detection of venestatin expression in LL3s. Immunofluorescent staining of LL3s using mouse anti-venestatin sera was performed after 72 h of soaking with dsRNA. Bound antibodies were probed with green fluorescent-labeled secondary antibodies. The sections were examined by confocal fluorescent microscopy. Differential interference contrast (DIC) images are also shown. Intense expression of native venestatin (arrow) was observed in the hypodermis of LL3s in the control group, but not in the RNAi-treated group. Scale bar: 50 μm.
Post-transcriptional silencing of the venestatin gene in S. venezuelensis.
(A) Quantitative RT-PCR analysis of venestatin transcripts. Lung stage larvae (LL3s) of S. venezuelensis were incubated with venestatin dsRNA as the RNAi-treated group. LL3s in the control group were incubated with luciferase dsRNA. The gene encoding S. venezuelensis actin-like protein (actin) was used as an internal control, and venestatin mRNA copies/actin was calculated. Data are expressed as means ± SDs for three independent experiments with two technical replicates. **p < 0.001; ***p < 0.0001 from the control group. (B) Effects of gene silencing on venestatin protein expression by western blot analysis. Excretory-secretory (ES) products (1 mL culture medium from 10,000 LL3s) were collected after 72 h of soaking with dsRNA and concentrated to 100 μL by ultrafiltration. Proteins were separated by SDS-PAGE on 12% gels under reducing conditions. Membranes were probed with anti-venestatin sera. (C) In situ detection of venestatin expression in LL3s. Immunofluorescent staining of LL3s using mouse anti-venestatin sera was performed after 72 h of soaking with dsRNA. Bound antibodies were probed with green fluorescent-labeled secondary antibodies. The sections were examined by confocal fluorescent microscopy. Differential interference contrast (DIC) images are also shown. Intense expression of native venestatin (arrow) was observed in the hypodermis of LL3s in the control group, but not in the RNAi-treated group. Scale bar: 50 μm.
Endogenous venestatin promoted larval migration in a RAGE-dependent manner
A previous study reported that subcutaneously injected LL3s could successfully migrate to the lungs and small intestines in mice and displayed normal maturation and egg production [28]. Therefore, we next aimed to identify the relationship between endogenous venestatin from S. venezuelensis larvae and host RAGE during the migration process using animal infection experiments with control and venestatin-knockdown larvae in wild-type (WT) and RAGE-null (RAGE-/-) mice. The larvae were administered by subcutaneous (s.c.) inoculation into mice. At 72 h post infection (p.i.), fewer petechial hemorrhages due to larval migration were observed in the lungs of WT miceinfected with venestatin-knockdown larvae than in those infected with control larvae (Fig 4A). In infectedRAGE-/- mice, the number of petechial hemorrhages was comparable between control and venestatin-knockdown larvae. The worm burden in the lungs of WT miceinfected with venestatin-knockdown larvae was significantly reduced by 61% (35.9 ± 16.8 larvae) compared with that in miceinfected with control larvae (89.8 ± 32.9 larvae, p = 0.0002; Fig 4B). Moreover, the worm burden was comparable between RAGE-/- miceinfected with control and venestatin-knockdown larvae. These data supported the observed differences in the number of petechial hemorrhages among the groups. At 96 h p.i., the worm burden was also reduced in the small intestines of WT mice (44.3 ± 19.6 larvae), but not RAGE-/- mice following infection with venestatin-knockdown larvae, compared with that in miceinfected with control larvae (78.7 ± 28.0 larvae, p = 0.0052). The worm burden did not differ significantly in the lungs and small intestines between WT and RAGE-/- miceinfected with control larvae. The number of adult worms in the small intestines of infected WT and RAGE-/- mice at 168 h p.i. was comparable to that at 96 h p.i. and the adult worms were able to lay eggs (S5 Fig). Thus, these data suggested that endogenous venestatin served an important role in larval migration from the skin to the lungs via the RAGE/ligand axis. Kinetic analysis of larval migration to the lungs indicated that the worm burden in the lungs was lower at 96 h p.i. than at 72 h p.i. (S6 Fig), and larvae were hardly detected in the lungs of all groups at 144 h p.i. These results suggested that larvae migrate to the small intestines from the lungs regardless of venestatin expression.
Fig 4
Effects of post-transcriptional silencing of the venestatin gene on larval migration of S. venezuelensis.
(A) Venestatin-specific gene silencing alleviated lung hemorrhage induced by larval migration. Wild-type (WT) or RAGE-null (RAGE-/-) mice were infected with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). Petechial hemorrhage in the lungs was observed on day 3 (72 h) p.i. Scale bar: 1 cm. (B) Venestatin-specific gene silencing reduced worm burden in the lungs. Lung and small intestinal larval burdens are shown from WT or RAGE-/- mice on days 3 (72 h) and 4 (96 h) p.i., respectively. Data are expressed as means ± SDs of 10 mice from two independent trials. *p < 0.01; **p < 0.001. NS, no significant difference.
Effects of post-transcriptional silencing of the venestatin gene on larval migration of S. venezuelensis.
(A) Venestatin-specific gene silencing alleviated lung hemorrhage induced by larval migration. Wild-type (WT) or RAGE-null (RAGE-/-) mice were infected with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). Petechial hemorrhage in the lungs was observed on day 3 (72 h) p.i. Scale bar: 1 cm. (B) Venestatin-specific gene silencing reduced worm burden in the lungs. Lung and small intestinal larval burdens are shown from WT or RAGE-/- mice on days 3 (72 h) and 4 (96 h) p.i., respectively. Data are expressed as means ± SDs of 10 mice from two independent trials. *p < 0.01; **p < 0.001. NS, no significant difference.Next, larvae remaining in the skin were detected by reverse transcription polymerase chain reaction (RT-PCR) analysis of transcripts of S. venezuelensis actin-like protein (S. venezuelensis actin [WormBase SVE_0864000]) due to the technical difficulties of collecting and counting larvae in skin tissues. The expression level of S. venezuelensis actin-specific mRNA in the skin of WT miceinfected with venestatin-knockdown larvae was higher than that in the skin of WT miceinfected with control larvae at 24 and 48 h p.i.; in contrast, the expression levels of S. venezuelensis actin-specific mRNA did not differ in the skin of RAGE-/- miceinfected with control or venestatin-knockdown larvae (Fig 5A). The expression levels of mouse actin-specific mRNA were comparable among skin tissues of all groups. S. venezuelensis and mouse actin primers did not cross-react with mouse actin and S. venezuelensis actin, respectively. At 48 h p.i., only the skin of WT miceinfected with venestatin-knockdown larvae contained S. venezuelensis actin-specific mRNA. Quantitative transcriptional analysis of S. venezuelensis actin demonstrated that the skin of WT miceinfected with venestatin-knockdown larvae contained significantly more mRNA than that of WT miceinfected with control larvae (24 h p.i., p < 0.001; 48 h p.i., p < 0.01; Fig 5B). Additionally, mRNA levels did not differ significantly between the skin of RAGE-/- miceinfected with control and venestatin-knockdown larvae. These results implied that larvae secreting venestatin favorably migrated out from the host skin in a RAGE/ligand axis-dependent manner.
Fig 5
Post-transcriptional silencing of the venestatin gene inhibited migration of S. venezuelensis from skin tissues.
(A) Transcripts of S. venezuelensis actin-like protein (S. venezuelensis actin) in skin tissue of wild-type (WT) or RAGE-null (RAGE-/-) mice infected with 2,000 LL3s of S. venezuelensis treated with dsluciferase (CR) or dsvenestatin (KD) were detected by RT-PCR. Total RNA was extracted from the skin tissues at the larva inoculation site at 24 and 48 h p.i. Naïve skin tissues were used as a negative control (no infection). Expression of mouse β-actin (mouse actin) was shown as an internal control. Expression of S. venezuelensis actin in CR or KD LL3s was also assessed. (B) Quantitative RT-PCR analysis of S. venezuelensis actin transcripts. Mouse actin was used to normalize the amount of cDNA, and the expression level in skin inoculated with CR LL3s was set as 1. Data are expressed as means ± SDs for three independent experiments with two technical replicates. *p < 0.01; **p < 0.001 from the control group. NS, no significant difference.
Post-transcriptional silencing of the venestatin gene inhibited migration of S. venezuelensis from skin tissues.
(A) Transcripts of S. venezuelensis actin-like protein (S. venezuelensis actin) in skin tissue of wild-type (WT) or RAGE-null (RAGE-/-) miceinfected with 2,000 LL3s of S. venezuelensis treated with dsluciferase (CR) or dsvenestatin (KD) were detected by RT-PCR. Total RNA was extracted from the skin tissues at the larva inoculation site at 24 and 48 h p.i. Naïve skin tissues were used as a negative control (no infection). Expression of mouse β-actin (mouse actin) was shown as an internal control. Expression of S. venezuelensis actin in CR or KD LL3s was also assessed. (B) Quantitative RT-PCR analysis of S. venezuelensis actin transcripts. Mouse actin was used to normalize the amount of cDNA, and the expression level in skin inoculated with CR LL3s was set as 1. Data are expressed as means ± SDs for three independent experiments with two technical replicates. *p < 0.01; **p < 0.001 from the control group. NS, no significant difference.
Endogenous venestatin suppressed RAGE-mediated immune responses during larval migration
Invasion and migration of control and venestatin-knockdown larvae significantly upregulated the expression of RAGE ligand mRNA, such as HMGB1 [GenBank NM_001313894], S100B [NM_009115], and S100A6 [NM_011313], in mouse skin tissues but did not affect the expression of RAGE [NM_007425] itself (S7 Fig), indicating the larvae may induce RAGE-mediated inflammation responses in host skin. Therefore, we next examined the expression of cytokines, pro-inflammatory enzymes, and endothelial adhesion molecules in skin tissues after invasion by larvae at 6 h p.i. using quantitative RT-PCR analysis. The expression levels of TNF-α [NM_013693] and COX2 [NM_011198] mRNA were significantly upregulated in the skin of WT mice, but not in that of RAGE-/- mice following infection with venestatin-knockdown larvae, compared with those infected with control larvae (TNF-α, p < 0.01; COX2, p < 0.0001; Fig 6). The mRNA expression levels of type 1 and 2 cytokines, i.e., interferon (IFN)-γ [NM_008337], interleukin (IL)-4 [NM_021283], IL-5 [NM_010558], and IL-13 [NM_008355], were not altered by larval infection. In contrast, expression levels of mRNA encoding endothelial adhesion molecules, i.e., VCAM-1 [NM_011693], ICAM-1 [NM_010493], and E-selectin [NM_011345], were significantly upregulated in the skin of WT mice, but not in that of RAGE-/- mice following infection with venestatin-knockdown larvae, compared with those infected with control larvae (p < 0.0001; Fig 7). These data suggested that endogenous venestatin inhibited RAGE-mediated transcription of pro-inflammatory molecules.
Fig 6
Effects of endogenous venestatin on cytokine production in mouse skin tissues.
Quantitative RT-PCR analysis of pro-inflammatory molecules from skin tissues of wild-type (WT) or RAGE-null (RAGE-/-) mice was performed. Total RNA was extracted from mouse skin tissues at the larva inoculation site at 6 h p.i. with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). The mouse GADPH gene was used to normalize the amount of cDNA, and the expression level in naïve skin (no larva) was set as 1. Data are expressed as means ± SDs of three independent experiments with two technical replicates. *p < 0.01; **p < 0.001; ***p < 0.0001.
Fig 7
Effects of endogenous venestatin on adhesion molecule production in mouse skin tissues.
Quantitative RT-PCR analysis of adhesion molecules from skin tissues of wild-type (WT) or RAGE-null (RAGE-/-) mice was performed. Total RNA was extracted from mouse skin tissues at the larva inoculation site at 6 h p.i. with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). The mouse GADPH gene was used to normalize the amount of cDNA, and the expression level in naïve skin (no larva) was set as 1. Data are expressed as means ± SDs of three independent experiments with two technical replicates. ***p < 0.0001.
Effects of endogenous venestatin on cytokine production in mouse skin tissues.
Quantitative RT-PCR analysis of pro-inflammatory molecules from skin tissues of wild-type (WT) or RAGE-null (RAGE-/-) mice was performed. Total RNA was extracted from mouse skin tissues at the larva inoculation site at 6 h p.i. with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). The mouse GADPH gene was used to normalize the amount of cDNA, and the expression level in naïve skin (no larva) was set as 1. Data are expressed as means ± SDs of three independent experiments with two technical replicates. *p < 0.01; **p < 0.001; ***p < 0.0001.
Effects of endogenous venestatin on adhesion molecule production in mouse skin tissues.
Quantitative RT-PCR analysis of adhesion molecules from skin tissues of wild-type (WT) or RAGE-null (RAGE-/-) mice was performed. Total RNA was extracted from mouse skin tissues at the larva inoculation site at 6 h p.i. with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). The mouse GADPH gene was used to normalize the amount of cDNA, and the expression level in naïve skin (no larva) was set as 1. Data are expressed as means ± SDs of three independent experiments with two technical replicates. ***p < 0.0001.Finally, we performed histochemical analyses of mice skin after infection with control or venestatin-knockdown larvae. Cross-sections of larvae were observed in the dermal and subdermal tissues (Fig 8), revealing a substantial accumulation of inflammatory cells around venestatin-knockdown larvae, but not around control larvae in WT mice (Fig 8, black square). The accumulation of inflammatory cells differed significantly between miceinfected with control larvae (9 ± 3 cells/0.1 mm2) and venestatin-knockdown larvae (19 ± 5 cells/0.1 mm2, p < 0.0001). However, the skin of infectedRAGE-/- mice exhibited a slight accumulation of inflammatory cells around both control and venestatin-knockdown larvae. Next, we attempted to identify the types of inflammatory cells around the larvae via immunohistochemistry. Significantly higher numbers of anti-F4/80-specific macrophages and anti-myeloperoxidase (MPO)-specific neutrophils were detected in skin tissues around venestatin-knockdown larvae compared with that around control larvae (p < 0.0001; Fig 9). Anti-CD3-specific T cells were barely detected around the larvae, nor did anti-B220-specific B cells or anti-IL-5 receptor (IL-5R)-specific eosinophils accumulate around the larvae (S8 Fig). These results indicated that endogenous venestatin suppressed RAGE-mediated accumulation of macrophages and neutrophils around the larvae invading into host skin tissues. Based on these findings, we propose that venestatin induces an immune suppression response by binding to RAGE in the host skin (Fig 10).
Fig 8
Endogenous venestatin prevented accumulation of inflammatory cells in mouse skin tissues.
Histochemical analysis of skin tissues from wild-type (WT) or RAGE-null (RAGE-/-) mice was performed. The skin tissues were collected from the larva inoculation site at 6 h p.i. with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). The sections were subjected to H&E staining, and cells around the larvae (arrows) were then counted. Black square: high-magnification image around larvae. D, dermal tissue; S, subdermal tissue. Scale bar: 40 μm. Data are expressed as means ± SDs of 12 fields from two mice. ***p < 0.0001. NS, no significant difference.
Fig 9
Endogenous venestatin suppressed the accumulation of macrophages and neutrophils around S. venezuelensis.
Immunohistochemical analysis of skin tissues from wild-type (WT) mice was performed. Skin tissues were collected from the larval inoculation site at 6 h p.i. with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). The sections were subjected to immunostaining using anti-F4/80 (macrophages), anti-MPO (neutrophils), or anti-CD3 (T cells) antibodies, and positive cells (arrow heads) around the larvae (arrows) were then counted. Scale bar: 25 μm. Data are expressed as means ± SDs of 12 fields from two mice. ***p < 0.0001. ND, no detection.
Fig 10
Schematic diagram showing the roles of venestatin during larval migration of the nematode S. venezuelensis.
As RAGE ligands, damage-associated molecular patterns (DAMPs) are released from damaging skin tissues by invasion of S. venezuelensis larvae and then bind to RAGE. RAGE signaling induces the expression of cytokines and adhesion molecules, resulting in recruitment of macrophages and neutrophils to entrap or kill venestatin-knockdown larvae. Venestatin downregulates inflammatory responses to control larval invasion. Venestatin may prevent binding between DAMPs and RAGE. Consequentially, larvae secreting venestatin migrate to the lung.
Endogenous venestatin prevented accumulation of inflammatory cells in mouse skin tissues.
Histochemical analysis of skin tissues from wild-type (WT) or RAGE-null (RAGE-/-) mice was performed. The skin tissues were collected from the larva inoculation site at 6 h p.i. with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). The sections were subjected to H&E staining, and cells around the larvae (arrows) were then counted. Black square: high-magnification image around larvae. D, dermal tissue; S, subdermal tissue. Scale bar: 40 μm. Data are expressed as means ± SDs of 12 fields from two mice. ***p < 0.0001. NS, no significant difference.
Endogenous venestatin suppressed the accumulation of macrophages and neutrophils around S. venezuelensis.
Immunohistochemical analysis of skin tissues from wild-type (WT) mice was performed. Skin tissues were collected from the larval inoculation site at 6 h p.i. with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). The sections were subjected to immunostaining using anti-F4/80 (macrophages), anti-MPO (neutrophils), or anti-CD3 (T cells) antibodies, and positive cells (arrow heads) around the larvae (arrows) were then counted. Scale bar: 25 μm. Data are expressed as means ± SDs of 12 fields from two mice. ***p < 0.0001. ND, no detection.
Schematic diagram showing the roles of venestatin during larval migration of the nematode S. venezuelensis.
As RAGE ligands, damage-associated molecular patterns (DAMPs) are released from damaging skin tissues by invasion of S. venezuelensis larvae and then bind to RAGE. RAGE signaling induces the expression of cytokines and adhesion molecules, resulting in recruitment of macrophages and neutrophils to entrap or kill venestatin-knockdown larvae. Venestatin downregulates inflammatory responses to control larval invasion. Venestatin may prevent binding between DAMPs and RAGE. Consequentially, larvae secreting venestatin migrate to the lung.
Discussion
EF-hand Ca2+-binding proteins have been identified in various organisms, including bacteria, protozoa, helminths, arthropods, and mammals [29-31]. EF-hand proteins regulate calcium signaling in the cytosol to facilitate various cellular functions in both vertebrates and invertebrates [32-34]. Some EF-hand proteins are secreted from cells and exert critical extracellular functions [35-37]. Although there is very limited information regarding secretory EF-hand Ca2+-binding proteins in parasitic helminths, we previously identified and cloned a full-length cDNA encoding venestatin, a secretory Ca2+-binding protein having two EF-hand motifs from S. venezuelensis [24]. Venestatin homologs (83 orthologs) were identified from 69 nematode species (78 genome assemblies), including animal and plant parasitic nematodes, as well as free-living nematodes in WormBase Compara (http://parasite.wormbase.org) [24]. The wide distribution of venestatin orthologs in the phylum Nematoda indicates their crucial function in the nematode life cycle. In the current study, we demonstrated a novel parasitism mechanism through which venestatin suppressed RAGE-mediated immune responses in host skin, leading to successful larval migration. Venestatin orthologs may equip parasitic nematodes with specific functions during their evolution to adapt to the host skin environment.In the present study, we determined that r-venestatin bound to the C1 and C2 domains of RAGE, with comparable binding affinity to that of other established RAGE ligands. Furthermore, the RAGE C1 domain was found to be the predominant binding site of venestatin, which was dependent on Ca2+ ions. The RAGE extracellular domain is composed of a V type immunoglobulin-like domain (V) followed by two C type domains (C1 and C2) [38]. The V domain is the binding domain for most RAGE ligands, which induces downstream signaling [39]. Notably, however, few ligands have been shown to interact with either the C1 or C2 domains [40,41]. Among these, S100A6 and S100A12 have functional roles in cell proliferation and inflammation [42,43]. Characterized by two Ca2+-binding EF-hand motifs connected by a central hinge region [44], the presence of Ca2+ enhances the binding affinity of S100 proteins with RAGE [45]. Venestatin may specifically affect RAGE-mediated signaling via C1 and C2 domain-interacting RAGE ligands, but not V domain-interacting ligands. However, this possibility is highly unlikely as our data indicated that r-venestatin alleviated inflammation induced by the V domain-interacting ligand Gla-BSA in vivo. Binding between S100A6 and the RAGE C1 domain induces a dimeric conformation in RAGE that enables efficient signal transduction [46]. Thus, the C1 domain-binding venestatin may interfere with RAGE homodimerization, resulting in attenuation of V domain-mediated signaling. Although the function of the C2 domain against V domain-mediated signaling is unclear, our data indicates that the C2 domain could also interact with venestatin in a Ca2+-dependent manner. Functional analysis of the C2 domain in RAGE structural biology warrants further investigation.Mousefootpad edema and pneumonia models revealed that purified r-venestatin significantly suppressed inflammation induced by the RAGE ligand Gla-BSA in vivo. In contrast, carrageenan-induced inflammation was not alleviated by pretreatment with r-venestatin. We previously reported that carrageenan can induce inflammatory pathology, regardless of whether RAGE is expressed [27]. Our results indicated that venestatin functioned as a RAGE antagonist. Few RAGE antagonists have been identified from natural organisms, and venestatin is the first biological RAGE antagonist isolated from parasitic helminths. Many antagonistic chemical components targeting RAGE have been developed to date, almost all of which interact with the V domain [47]. Importantly, only a few RAGE antagonists have been evaluated in clinical trials, and the results have been inconclusive [48]. Thus, the crystal structure of the complex formed between venestatin and the C1 and C2 domains of RAGE will be valuable for designing novel RAGE antagonists.Gene silencing of venestatin in S. venezuelensis larvae was performed using RNAi to elucidate the role of endogenous venestatin during the migration process in the host. The use of RNAi in parasitic nematodes is known to be challenging, and the specific RNAi effector components associated with RNAi susceptibility are unknown [49]. A recent study reported that RNAi-mediated knockdown in S. ratti, a rodent parasitic nematode, could be successfully achieved by soaking with small interfering RNA (siRNA) [50]. Most animal parasitic nematodes, including Strongyloide spp., lack the genes required for dsRNA uptake, such as sid-1 and sid-2 [49,50], suggesting that siRNA may be better suited for RNAi-mediated knockdown than dsRNA. However, knockdown of specific genes has been achieved for some species of animal [51-53] and plant [54,55] parasitic nematodes by soaking with dsRNA, suggesting alternative dsRNA uptake proteins [56] and endocytotic dsRNA uptake processes [57] in parasitic nematodes. In the current study, we demonstrated that a soaking protocol using dsvenestatin efficiently silenced venestatin-specific mRNA expression and subsequent translation of venestatin in S. venezuelensis LL3 larvae. A pilot experiment determined that knockdown of venestatin was not successful in iL3s (S9 Fig). iL3s reportedly close their mouths and can survive for a long time without feeding [58], until suitable environmental conditions are provided by the host to open their mouths and resume feeding. For Ancylostoma caninum iL3s, resumption of feeding and release of secretory proteins is induced by incubation in RPMI 1640 tissue culture medium including canine serum and S-methyl-glutathione for 24 h at 37°C [59]. Incubation with serotonin stimulates pharyngeal pumping of Steinernema carpocapsae iL3s, leading to uptake of dsRNA to facilitate RNAi [60]. S. venezuelensis iL3s may be activated and lead to successful RNAi using these in vitro incubation techniques.Here, we demonstrated that silencing of the venestatin gene in larvae interfered with migration out of the host skin in WT mice, but not in RAGE-/- mice. Furthermore, venestatin-knockdown larvae that reached the lungs could migrate to the small intestine, mature into adult worms, and lay eggs, similar to control larvae. Thus, endogenous venestatin from larvae acted on RAGE to promote migration out of the mouse skin, but may not have affected other processes involved in migration, development, and reproduction of worms. These findings were consistent with those of our previous studies in which anti-venestatin serum interfered with larvae migration from the skin to the lungs, but not from the lungs to the small intestine, and with the observation that r-venestatin interacted with mouse endogenous RAGE [24,25]. Larval invasion into mouse skin tissues induced increased levels of some RAGE-ligands, including HMGB1, S100B, and S100A6, thus the RAGE/ligand axis was assumed to have triggered inflammatory responses in skin tissues after larval invasion. Indeed, the transcripts of pro-inflammatory cytokine TNF-α, pro-inflammatory enzyme COX2, and endothelial adhesion molecules VCAM-1, ICAM-1, and E-selectin were markedly upregulated in RAGE-expressing skin tissues invaded by venestatin-knockdown larvae. The interaction of RAGE-ligands with RAGE induces the expression of pro-inflammatory cytokines, pro-inflammatory enzymes, and adhesion molecules thorough activation of NF-κB [20]. Our findings suggest that silencing of venestatin may improve the environment into which inflammatory cells infiltrate. Furthermore, our histochemical analysis revealed massive accumulation of inflammatory cells around larvae following silencing of venestatin in the presence of RAGE. Taken together, our results strongly suggest that endogenous venestatin from larvae suppress the RAGE-mediated inflammatory responses of the host, thereby promoting migration out of the host skin. Alarmin cytokines, such as IL-25 and IL-33, from bronchial and intestinal epithelial tissues damaged by helminthic larvae activate type 2 innate lymphocytes (ILC2s), which abundantly secrete IL-5 and IL-13, thereby inducing the type 2 immune response [61]. ILC2s were not activated in skin tissues under our current experimental conditions (6 h p.i.), indicated by IL-5 and IL-13 transcript abundance being unaltered by larval invasion. However, the experimental timepoint may have been too short for induction of ILC2-mediated type 2 immunity in skin tissues [62].The skin-invading larvae of S. ratti induce cellular infiltration by macrophages, neutrophils, and eosinophils in mice and rats [63]. Although eosinophilia is a known feature of helminth infection and eosinophils can kill helminth larvae in vitro, protective effects against most helminth species are observed only after secondary infection in vivo [4]. Indeed, basophils infiltrate and trap skin-invading larvae of the rodent parasitic nematode Nippostrongylus brasiliensis after secondary infection, but not primary infection [23]. However, our immunohistochemical results indicated that macrophages and neutrophils accumulated around venestatin-knockdown larvae after primary invasion into WT mouse skin. S. stercoralis larvae were killed by macrophages, neutrophils, and complement in previous in vitro assays and ex vivo mouse models [64]. Moreover, neutrophil extracellular traps (NETs) are released from mouse neutrophils after S. stercoralisinfection and function to entrap larvae and prevent their movement without killing larvae in vitro and ex vivo [65]. Our data indicated that the number of larvae migrating to the lungs from the skin was reduced by silencing of the venestatin gene. The larvae could migrate to the small intestines from the lungs, and then larvae were hardly detected in the lungs, regardless of venestatin expression. Eventually, the worm burden of larvae arriving and mature worms settling in the small intestines was reduced by silencing of venestatin. These data imply that migration of some larvae from the skin was completely inhibited, not merely delayed, by silencing of venestatin. Our current findings and those previously reported suggest that venestatin may facilitate skin-invading larvae to escape from entrapment by NETs and assault by macrophages. Binding of RAGE ligands to RAGE on macrophages induces activation of macrophages [19]. However, alternatively activated macrophages (AAMs) more effectively kill larvae than naïve and classically activated macrophages [64]. Because AAMs have anti-inflammatory functions, the effects of venestatin on macrophage activation is an interesting topic in studies of the therapeutic potential of venestatin in RAGE-mediated inflammatory diseases, such as Alzheimer’s disease, rheumatoid arthritis, asthma, ulcerative colitis, and diabetes [66-Paediatr Respir Rev.. 2017 ">68].A venestatin homolog was highly conserved in the Strongyloides species, S. stercoralis [24]. The nematode species, Necator americanus, and the trematode species, Schistosoma mansoni, also conserve venestatin homologs in the genomic database. However, the function of venestatin homologs from human-infecting helminths, which migrate from the skin to the lungs, remains to be addressed. Although relationships have been reported between RAGE and some bacterial cutaneous infections, such as Mycobacterium leprae and Staphylococcus aureus [69,70], the biological significance of RAGE is poorly understood in humaninfectious diseases, particularly its significance with helminthiasis. A previous study demonstrated that RAGE expression was altered in the early stage of S. mansoni infection [71]. Our findings support a general mechanism of helminthic larvae invasion into skin tissues that express high levels of RAGE, enabling larvae to evade host immunity, although this hypothesis requires further research and validation. Elucidation of the functions of venestatin homologs during the skin invasion process is anticipated to contribute to strategies for controlling cutaneous infection by parasitic helminths in the future.In conclusion, the EF-hand Ca2+-binding protein venestatin, secreted by the helminth S. venezuelensis, binds to RAGE and downregulates RAGE-mediated inflammatory responses. Our findings indicate that venestatin plays a key role in immune evasion by S. venezuelensis larvae, consequently promoting larval migration from the skin to the lungs. Furthermore, the anti-inflammatory mechanism of venestatin may be targeted for the development of anthelminthics and immunosuppressive agents. The study findings warrant further investigation to assess the therapeutic effects of venestatin in RAGE-mediated pathological models.
Materials and methods
Ethics statement
Animal experiments were conducted in accordance with the guidelines of the Animal Laboratory Center of Kitasato University School of Medicine, and all efforts were made to minimize suffering. All animal procedures were approved by the Animal Laboratory Center of Kitasato University School of Medicine (permission-numbers 2018–067, 2019–066, 2020–131 and 2021–141).
Animals
Mice (Charles River Laboratories Japan, Yokohama, Japan) and rats (Japan SLC, Shizuoka, Japan) were housed in individual cages and in a temperature- and humidity-controlled environment with a 12-h dark-light cycle. The animals were given food and water ad libitum. Rats and mice were euthanized by carbon dioxide inhalation and cervical dislocation, respectively.
Parasites
S. venezuelensis HH1 was previously isolated [72] and has been maintained in our laboratories (Kitasato University School of Medicine and Faculty of Medicine, University of Miyazaki, Japan) by serial passaging in male 8-week-old Wistar rats. iL3s were prepared using the filter paper method [73] and administered by s.c. injection (30,000 iL3s/rat). LL3s were recovered from rat lungs at 72–75 h p.i. as previously described [28].
Production of r-venestatin and anti-venestatin antibodies
Production and purification of r-venestatin were performed as previously described [25] using the silkworm baculovirus expression system. For production of anti-venestatin antibodies, female 5-week-old BALB/c mice were immunized by s.c. injection of 50 μg r-venestatin emulsified with TiterMax Gold adjuvant (TiterMax USA, Norcross, GA, USA). A booster immunization was administered 2 weeks after the first immunization.
Microtiter plate binding assay of venestatin with RAGE
The binding of venestatin with RAGE was evaluated as previously described [27]. Briefly, r-venestatin (4 μg/mL) was coated onto enzyme-linked immunosorbent assay (ELISA) plates (Thermo Fisher Scientific, Waltham, MA, USA) and stored overnight at 4°C. After blocking, different concentrations of human recombinant RAGE (R&D Systems, Minneapolis, MN, USA) or TLR4 (R&D Systems) (0–4 μg/mL) were added to the wells and incubated with 50 μL buffer A (50 mM Tris-HCl, pH 7, 10 mM sodium chloride, and 5 mM calcium chloride) at ambient temperature for 1 h. Negative control wells were coated with BSA prior to incubation with human recombinant RAGE. The wells were washed, and bound proteins were incubated with anti-RAGE (1:500; Merck Millipore, Massachusetts, MA, USA) or anti-TLR4 (1:500; Proteintech Group, Rosemont, IL, USA) antibodies at ambient temperature for 1 h. The proteins were then incubated with horseradish peroxidase (HRP)-conjugated IgG and TMB One Solution (Promega, Madison, WI, USA) and the absorbance was measured using a POWERSCAN instrument (DS Pharma Biomedical, Osaka, Japan) at 450 nm (OD450). The KD value was calculated by a Scatchard plot. To compare the binding ability of venestatin with that of other ligands, including Gla-BSA (produced as previously described [74]), CML-BSA (Medical & Biological Laboratories, Nagoya, Japan), humanHMGB1, humanS100A6, and humanS100A12 (Abnova, Taipei, Taiwan), ELISA plates were coated with r-venestatin, RAGE ligands, or BSA (4 μg/mL). Plates were then blocked, and RAGE (1 μg/mL) was added, followed by binding with anti-RAGE antibodies (1:500). Bound RAGE was detected as described above.
Inhibition of binding by anti-RAGE and anti-venestatin antibodies
ELISA plates were coated with RAGE (4 μg/mL), incubated with anti-RAGE antibodies (1:100), and then treated with venestatin. Alternatively, venestatin (4 μg/mL) was pre-incubated with anti-venestatin sera (1:100), and the mixture was added to RAGE-coated wells. Bound venestatin was reacted with biotin-labelled anti-venestatin antibodies prepared using a Biotin-Labelled Kit-NH2 (Dojindo Laboratories, Kumamoto, Japan), followed by incubation with HRP-conjugated streptavidin (Sigma-Aldrich, St. Louis, MO, USA) and TMB One Solution. Bound venestatin was detected as described above.
Competitive binding assay
ELISA plates were coated with RAGE (4 μg/mL) and then incubated with venestatin (8 μg/mL) alone or a mixture of venestatin with other RAGE ligands (4 μg/mL) and 50 μL buffer A at ambient temperature for 1 h. Bound venestatin was detected with anti-venestatin sera (1:1000).
Domain binding assay
Recombinant V, C1, and C2 RAGE domains were expressed using Escherichia coli and then purified as previously described [75]. ELISA plates were coated with the domains (4 μg/mL) and then reacted with venestatin. Bound venestatin was detected with anti-venestatin sera. In the Ca2+-dependent RAGE domain binding assay, the C1 or C2 domains of RAGE (4 μg/mL) were coated on ELISA wells and then incubated with metal-free venestatin (8 μg/mL), prepared as described previously [27] in buffer A with or without 5 mM calcium chloride. The calcium chelating control was incubated in buffer A with 5 mM calcium chloride and 5 mM ethylenediaminetetraacetic acid (EDTA). Binding with venestatin was then evaluated.
Computational docking
Model structures of venestatin were built using hMCFD2 [PDB 2VRG] with the SWISS-MODEL program [76]. Computational docking of venestatin to humanRAGE [PDB 3O3U] was performed using ClusPro 2.0 software [77]. ClusPro 2.0 was run on docking mode with PDB 3O3U as Receptor and PDB 2VRG as Ligand.
RNA intervention
For RNAi of the venestatin gene in S. venezuelensis, dsRNA was prepared using the T7 RiboMAX Express RNAi System (Promega). The sequence encoding venestatin was cloned into T-Vector pMD-20 (Takara Bio, Otsu, Japan). The inserted sequence was amplified by PCR using the primers T7-VeneF7 (5′-TAATACGACTCACTATAGGTTTGGTTGGGTAGGATCAAT-3′) and T7-VeneR388 (5′-TAATACGACTCACTATAGGCTTCTGATGGTAATGGTGGA-3′), containing the T7 promoter sequences at either end. dsRNA complementary to the firefly luciferase gene was used as a negative control. The inserted sequence of luciferase encoded in the pGEM-lucDNA vector (Promega) was amplified by PCR using the primers T7-LucF (TAATACGACTCACTATAGGGCTTCCATCTTCCAGGGATACG) and T7-LucR; (TAATACGACTCACTATAGGCGTCCACAAACACAACTCCTCC), which also contained T7 promoter sequences. dsRNA complementary to the respective DNA inserts was synthesized by in vitro transcription using T7 RNA polymerase.S. venezuelensis iL3s or LL3s (1000–2000 larvae/well) were incubated in 48-well plates (Corning, NY, USA) containing 0.2 mL Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 50 μg/mL penicillin/streptomycin and 0.25 mg/mL dsRNA (dsvenestatin or dsluciferase). The iL3s and LL3s were incubated at 37°C in a humidified atmosphere containing 5% CO2 or 5% CO2 plus 5% O2, respectively. After 24 or 72 h of incubation with dsRNA, the larvae were incubated with DMEM without dsRNA for 24 h under the same incubation conditions. The larvae were then harvested for experimental infection, and total RNA was extracted for RT-PCR analysis. After incubation for 72 h, the culture supernatant was collected and concentrated more than 10-fold using Centrisart (Sartorius, Göttingen, Germany), with a molecular weight cut-off of 10 kDa. Aliquots were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and western blot analysis. After incubation for 72 h, the larvae were subjected to immunofluorescence staining with anti-venestatin antibodies.
Infection with venestatin-suppressed larvae
Male 8-week-old WT C57BL/6J mice and RAGE-/- mice were used for experimental infection with S. venezuelensis larvae treated with dsRNA. RAGE-/- mice were generated and maintained as previously described [78]. Two thousand LL3s were administered to the mice by s.c. injection. Mice were euthanized at 6, 24, and 48 h p.i. Histochemical analysis was conducted on skin samples at 6 h p.i., while RT-PCR analysis was performed on skin samples at 6, 24, and 48 h p.i. Lungs and small intestines were excised from mice euthanized at 72, 96, and 144 h p.i., and 96 h p.i., respectively, followed by minced using a surgical knife. Larvae were recovered using the Baermann technique as described previously [79] and larvae were counted under a stereomicroscope. Two independent trials of the experimental infection were conducted. At 168 h p.i., adult worms were recovered and counted from the small intestines and fecal egg output (eggs/g feces) was counted.
Inflammation models
First, either r-venestatin (100 μg) in 0.15 M PBS (pH 7.2, 50 μL) or PBS alone was injected into the hind footpad of a WT mouse. To evaluate the effects of venestatin on RAGE-independent or -dependent mousefootpad edema models [27], 2% carrageenan or Gla-BSA (100 μg) in saline (100 μL) was injected into the same footpad after 1 h. The footpads of saline-injected mice were used as negative controls. Mice were euthanized after 8 h, and footpads were collected, and fixed in 10% formalin in 75 mM phosphate buffer (pH 7.4).Next, WT mice were intranasally instilled with either r-venestatin (50 μg) in PBS (25 μL) or PBS alone, followed by 2% carrageenan or Gla-BSA (50 μg) in saline (50 μL) after 1 h. The lungs of saline-instilled mice were used as negative controls. Mice were euthanized after 48 h, and the lungs were collected and fixed.Serum cytokine levels (TNF-α and IFN-γ) were determined using commercial ELISA kits (FUJIFILM Wako Shibayagi, Gunma, Japan), following the recommendations of the manufacturer.
RT-PCR and quantitative RT-PCR
Total RNA was extracted from mouse skin tissues using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) following the manufacturer’s instructions. cDNA synthesis from total RNA was performed using the ReverTra-Plus-RT-PCR kit (TOYOBO, Osaka, Japan). A primer pair for S. venezuelensis actin-like protein (5′-CCATACGTTGATGGGAAATTGGTAGC-3′ and 5′-CCGTCGAAAACTGTCCTGGACTAAG-3′ [298 bp]) was used. PCR amplification was carried out using 0.1 μg of each cDNA product and oligonucleotides in a final volume of 20 μL. PCR was performed for 2 min at 94°C and for 30 cycles of 98°C for 10 s, 60°C for 30 s, and 68°C for 30 s, followed by a final elongation at 68°C for 5 min. RT-PCR products were subsequently electrophoresed on agarose gels. The expression level of mouse β-actin [NM_007393] was used as an internal control. For exact comparison of expression levels, quantitative RT-PCR was conducted using LightCycler Capillaries (Roche, Basel, Switzerland) with a 20 μL reaction volume containing 10 μL KOD SYBR qPCR Mix (TOYOBO), 0.2 μM each forward and reverse primer, and 1 μL cDNA. The actin-like protein and internal control primer pairs were the same as for RT-PCR analysis. Transcript abundance was measured using a LightCycler 1.5 instrument (Roche Instrument Center AG, Rotkreuz, Switzerland) according to the manufacturer’s instructions. PCR amplification was performed for 2 min at 98°C followed by 40 cycles of 10 s at 98°C, 10 s at 60°C, and 30 s at 68°C. Mouse β-actin was used to normalize the amount of cDNA. The data were analyzed using LightCycler Software Version 3.5 (Roche). Expression levels of mouse TNF-α, COX-2, IL-4, IL-5, IL-13, IFN-γ, RAGE, S100A6, S100B, HMGB1, VCAM1, and E-selectin were also analyzed by quantitative RT-PCR. Mouseglyceraldehyde-3-phosphate dehydrogenase (GADPH [NM_001289726]) was amplified according to the same procedures and used to normalize the amount of cDNA. The mouse primers are listed in S1 Table. Each analysis was carried out at least in triplicate with two technical replicates.For evaluation of RNAi, total RNA was extracted from larvae of S. venezuelensis after dsRNA treatment. cDNA was synthesized as described above. A venestatin-specific primer pair (5′-ATTTCCTGGACAACAACCACCTCTTC-3′ and 5′-GGATTTCTGTGAGCTTGATCTCGTTG-3′ [438 bp]) was used. mRNA abundance was calculated as the number of mRNA molecules per actin-like protein mRNA.
Western blot analysis
Larvae culture supernatant was subjected to SDS-PAGE under reducing conditions, and proteins were transferred to polyvinylidene difluoride membranes. The membranes were blocked with Blocking One (Nacalai Tesque, Kyoto, Japan) for 1 h at room temperature. The blots were then incubated overnight at 4°C with anti-venestatin antibodies (1:1000) [24] in 5% Blocking One and 0.05% Tween 20 in 0.15 M NaCl and 50 mM Tris-HCl (pH 8.0; TBS-T). The membranes were washed with TBS-T and incubated with an alkaline phosphatase-conjugated secondary antibody (1:5000; AP-conjugated secondary antibodies; Jackson, Carlsbad, CA, USA) for 1 h at room temperature. The membranes were then washed again, and bound proteins were visualized via staining with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (Promega).
Histochemical examination
Paraffin-embedded sections (5 μm thick) of fixed mouse tissues were prepared and subjected to hematoxylin and eosin staining or immunostaining, as previously described [80]. The number of inflammatory cells per square millimeter in the peribronchial and dermal tissues or per square 100 micrometers around a larval cross-section was analyzed in two sections from each mouse using Image J software (National Institutes of Health, Bethesda, Maryland, USA). For immunohistochemical staining, the sections were treated with one of the following primary antibodies (Abcam, Cambridge, UK): anti-F4/80 (1:1000), anti-CD3 (1:100), anti-MPO (1:100), anti-IL-5R (1:100), or anti-CD45R (B220) (1:100). Immunostaining was performed using the immune-enzyme polymer method with 3,3-diaminobenzidine as the chromogen. The sections were heated in 50 mM sodium citrate buffer (pH 6.0) using in a microwave 3x for 5 min each. Counterstaining was performed with methyl green. The number of immunostained cells around a larval cross-section per square 100 micrometer was also counted.Larvae were collected after incubation with dsRNA for 72 h and fixed with 10% formalin in 75 mM phosphate buffer (pH 7.4). Paraffin-embedded sections (5 μm thick) were prepared and subjected to immunofluorescence staining. Briefly, the sections were treated with mouse anti-venestatin sera (1:200) and then with secondary antibodies (Alexa Fluor 488 goat anti-mouseIgG (H+L); Invitrogen, Carlsbad, CA, USA). Slides were mounted with VECTASHIELD mounting medium containing DAPI (Vector Laboratories, Burlingame, CA, USA) and observed using an LSM710 confocal fluorescence microscope (Carl Zeiss, Oberkochen, Germany). Before treatment with sera, the sections were incubated with 0.1% trypsin solution in 50 mM Tris-HCl (pH 7.5) and 0.1% CaCl2 for 30 min at room temperature. Pre-immune mouse serum (1:200) was used as a control.
Statistical analysis
Data are presented as means ± standard deviations (SDs). Statistical significance was determined using the Student’s t tests with unequal variance or one-way analysis of variance with Tukey-Kramer’s test. P values < 0.01 were considered statically significant using Graph Pad 6.0 software (San Diego, CA, USA).
Inhibition of RAGE binding with anti-venestatin or anti-RAGE antibodies.
RAGE-coated wells were treated with or without anti-RAGE antibodies. Venestatin was pre-incubated with or without anti-venestatin antibodies and added the wells. After washing, bound venestatin was detected with biotin-labelled anti-venestatin. Data are expressed as means ± SDs of three independent experiments. *p < 0.01; **p < 0.001.(TIF)Click here for additional data file.
Venestatin did not affect cellular infiltration.
Venestatin or PBS was injected into the hind footpad and instilled intranasally each mouse. After 8 or 48 h, the footpads and lungs were collected, respectively, and sections were stained with H&E. Data are expressed as means ± SDs of 12 fields from two mice.(TIF)Click here for additional data file.
Serum cytokines (TNF-α and IFN-γ) in mouse inflammation models.
(A) Mousefootpad edema model. (B) Mousepneumonia model. Concentrations of cytokines in the serum were measured by ELISA. The minimum detectable concentrations of TNF-α and IFN-γ were 3.58 and 2.05 pg/mL, respectively. Data are expressed as means ± SDs of 3 mouse sera. ND, no detection.(TIF)Click here for additional data file.
Incubation with dsRNA did not affect the morphology of S. venezuelensis larvae.
Infective lung stage larvae (LL3s) of S. venezuelensis were incubated with dsluciferase or dsvenestatin. Differential interference contrast (DIC) images of larvae are shown. Scale bar: 50 μm.(TIF)Click here for additional data file.
Venestatin-knockdown adult S. venezuelensis showed productive maturation.
Wild-type (WT) or RAGE-null (RAGE-/-) mice were infected with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). Small intestinal adult worm burden and fecal egg output from WT or RAGE-/- mice at day 7 (168 h) p.i. are shown. Data are expressed as means ± SDs of 6 mice from two independent experiments. *p < 0.01.(TIF)Click here for additional data file.
Kinetics of larval migration of S. venezuelensis in mouse lungs.
Wild-type (WT) or RAGE-null (RAGE-/-) mice were infected with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). Lung worm burdens from WT or RAGE-/- mice at days 4 (96 h) and 6 (144 h) p.i. are shown. Data are expressed as means ± SDs of 6 mice from two independent experiments. *p < 0.01.(TIF)Click here for additional data file.
Expression of RAGE and RAGE ligands in mouse skin tissues infected with S. venezuelensis.
Quantitative RT-PCR analysis of RAGE and RAGE ligands (HMGB1, S100B, and S100A6) from skin tissue of wild-type (WT) mice was performed. Total RNA was extracted from mouse skin tissues at the larva inoculation site at 6 h p.i. with 2,000 LL3s treated with dsluciferase (CR) or dsvenestatin (KD). The mouse GADPH gene was used to normalize the amount of cDNA, and the expression level in naïve skin (no larva) was set as 1. Data are expressed as means ± SDs from three independent experiments with two technical replicates. *p < 0.01; **p < 0.001 from the no larva group.(TIF)Click here for additional data file.
B cells and eosinophils did not accumulate around S. venezuelensis larvae.
Immunohistochemical analysis of skin tissues from wild-type (WT) mice was performed. Skin tissues were collected from the larval inoculation site at 6 h p.i. with 2,000 LL3s treated with dsvenestatin (KD). The sections were subjected to immunostaining using anti-B220 (B cells) or anti-IL-5R (eosinophils) antibodies. Arrow heads show larval cross sections. Scale bar: 25 μm.(TIF)Click here for additional data file.
Quantitative RT-PCR analysis of venestatin transcripts of S. venezuelensis infective L3s (iL3s) incubated with venestatin dsRNA.
iL3s in the control group were incubated with luciferase dsRNA. The gene encoding S. venezuelensis actin-like protein (actin) was used as an internal control, and venestatin mRNA copies/actin was calculated. Data are expressed as means ± SDs for three independent experiments with two technical replicates.(TIF)Click here for additional data file.
List of mouse PCR primers.
(DOCX)Click here for additional data file.
Data file for the values used to build graphs.
(XLSX)Click here for additional data file.12 Mar 2021Dear Dr. Tsubokawa,Thank you very much for submitting your manuscript "Venestatin from parasitic helminths interferes with receptor for advanced glycation end products-mediated immune responses to promote larval migration" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.I believe there is concurrence among the reviewers that this paper constitutes a significant contribution to knowledge about immunomodulatory proteins elaborated by parasitic nematodes. Reviewer 3 was particularly effusive in his/her comments to the effect that this is an outstanding study of its kind. However, Reviewers 1 and 2 both bring up significant shortcomings in data gathered in existing experiments (eg. the need for additional controls) or, in the case of Reviewer 2, the need for some significant additional studies (cytokine profiles, worm migration kinetics and flow cytometric analysis of immune effector cells in inflammatory skin lesions) that should be carried out.I encourage the authors to carefully consider these comments in preparing a substantial revision of the paper.We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.When you are ready to resubmit, please upload the following:[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).Important additional instructions are given below your reviewer comments.Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,James B. LokReviews EditorPLOS PathogensP'ng LokeSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XMichael MalimEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-7699-2064***********************I believe there is concurrence among the reviewers that this paper constitutes a significant contribution to knowledge about immunomodulatory proteins elaborated by parasitic nematodes. Reviewer 3 was particularly effusive in his/her comments to the effect that this is an outstanding study of its kind. However, Reviewers 1 and 2 both bring up significant shortcomings in data gathered in existing experiments (eg. the need for additional controls) or, in the case of Reviewer 2, the need for some significant additional studies (cytokine profiles, worm migration kinetics and flow cytometric analysis of immune effector cells in inflammatory skin lesions) that should be carried out.I encourage the authors to carefully consider these comments in preparing a substantial revision of the paper.Reviewer's Responses to QuestionsPart I - SummaryPlease use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.Reviewer #1: Here Tsubokawa et al. demonstrate that venestatin binds to RAGE to evade host detection by suppressing the immune response. Binding experiments, RNAi, and immune assays support this conclusion. I found the work very interesting and novel as they employ various techniques to tease apart the mechanism of venestatin immune suppression. I also believe the conclusions are well supported by the authors experiments and findings.Reviewer #2: This is an interesting study examining the role of venestatin in the suppression of inflammation, larval migration in animal models of S. venezuelensisinfection. Overall, the findings are interesting but scattered.Reviewer #3: Mechanistic studies of parasitic nematode effectors are lacking, and thorough mechanistic studies are even rarer. This study represents the best and most detailed study of the mechanism of how a nematode effector dampens host immunity, of which I am aware. Frankly, this was a pleasure to read and is precisely the kind of study that needs to be replicated with more nematode effectors. This work builds on previous studies where venestatin was identified and shown to be upregulated during infection as iL3s migrate through the skin. Overall, the methods are well described and well controlled. The paper is well written, and the logical progression of experiments is clear and intuitive. The overarching message is that venestatin binds RAGE and by doing so it dampens host immunity. These conclusions are well-supported by the data presented. There are a few minor points of concern that, if addressed, would improve the quality of the paper. I don’t think that the few additional points of data I suggest below should be required for publication, but they are reasonable suggestions that would improve what has been presented.**********Part II – Major Issues: Key Experiments Required for AcceptancePlease use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".Reviewer #1: 1. Include RAGE only and Venestatin only controls for Fig. 1A2. Include Ca2+ chelating control experiments in Fig. 1F3. Include details in text or supplemental data demonstrating how widespread venestatin is within the Phylum Nematoda4. More detailed discussion/interpretation is required for the RNAi specificity for LL3 versus iL35. Do the worm actin primers cross-react with mice. Please elaborate as it appears the host response was also used as an internal control. If they cross-react, how do the authors know which species they are monitoring?6. Fig 2A: add a magnified inset that marks examples of inflammatory cells. Also, are the white bars the PBS counts? this was unclear7. Fig. 3B should include loading controls.8. Fig4B: RAGE mutant versus wt: are these significantly different? interpret? Also, the worm burden is still significant - how does this fit their model?Reviewer #2: The major comments that need to be addressed are as follows:1. In the RAGE mediated inflammation models - both foot edema and pneumonia - only cellular infiltrates are examined. No examination of local or systemic pro-inflammatory cytokines or other mediators is examined. This needs to be performed.2. In the experiments examining larval migration, kinetics of larval migration are not examined. While it is possible that migration is inhibited, it is also possible that migration is delayed and hence different time points post infection need to examined for worm burden etc.3. In terms of RAGE mediated inflammation of the skin, flow cytometry to examine different immune and non-immune cell types would be useful.Reviewer #3: I found no major issues.**********Part III – Minor Issues: Editorial and Data Presentation ModificationsPlease use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.Reviewer #1: 1. Line 69: include reference(s) for secreted immunomodulators2. Define HMGB13. line 147: estimate "the" role4. line 179: this sentence doesn't make sense. The authors state that soaking did not affect expression in iL3 and LL3s and conclude that soaking is specific to LL3s5 line 233: authors switch to italics for proteins in contrast to non-italicized earlier. Be consistent.6. please change "rvenestatin" to "r-venestatin" or just "recombinant venestatin" to make it clearer for the reader7. lines 438 and 445 and 449: insert space for new paragraph8. Include details of setting used with ClusPro 2.09. line 138: Sequence similarity - include percentageReviewer #2: 1. Typos in the manuscript need to be corrected.2. No discussion of the homologous proteins in either Strongyloides stercoralis or other lung migrating human helminths is done.3. What is the translational impact of this axis in humaninfections?Reviewer #3: The results presented in Figure 1A seem incomplete. Only 4 different concentrations are tested whereas the authors could perform a full curve that would allow them to calculate the strength of binding in the form of KD. Unless the protein is particularly difficult to produce, I can’t see a good reason to limit the data to what is included in the figure.Another aspect of the data that seemed incomplete is the lack of additional detail on the C2 domain. Figure 1D illustrates significant binding of venestatin to the C2 domain of RAGE (p<0.01), but this was not further explored. Was this binding also calcium-dependent? Including data for C2 in Figure 1F would be interesting and may add to the discussion point on the pathology induced by V domain interactions.In reading the section on RNAi phenotypes (170-189), I wanted to see this data performed using iL3s. However, I understand the difficulty of RNAi and iL3s and it was helpful that the authors included a brief discussion of this, justifying their use of LL3s for these experiments. I agree with their use of LL3s and I do not think iL3s need to be used for this paper. Moving forward, the authors should consider activating the iL3s in vitro, which may facilitate RNAi in this life stage. Several labs use different techniques for activation of parasitic IJs. Morris et al. 2017 used the addition of serotonin to facilitate RNAi in Steinernema carpocapsae IJs. Hawdon et al. 1999 describes an activation technique for Ancylostoma caninum, but which has been used in other parasitic nematodes as well. Perhaps these methods would allow for efficient RNAi in S. venezuelensis iL3s.There were a few minor textual issues as well. I did not catch all of them, but here are some suggested corrections:-Line 55, change to “downregulated…”Line 274, change to “extracellular functions.”References:Morris R, Wilson L, Sturrock M, Warnock ND, Carrizo D, Cox D, et al. (2017) A neuropeptide modulates sensory perception in the entomopathogenic nematode Steinernema carpocapsae. PLoS Pathog 13(3): e1006185.doi:10.1371/journal.ppat.1006185Hawdon JM, Narasimhan S, Hotez PJ: Ancylostoma secreted protein 2: cloning and characterization of a second member of a family of nematode secreted proteins from Ancylostoma caninum. Mol Biochem Parasitol 1999, 99:149-165**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoReviewer #3: Yes: Adler R. DillmanFigure Files:While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at .Data Requirements:Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.Reproducibility:To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see9 May 2021Submitted filename: PPATHOGENS-D-21-00200 Responses to Reviewers2.docClick here for additional data file.18 May 2021Dear Dr. Tsubokawa,We are pleased to inform you that your manuscript 'Venestatin from parasitic helminths interferes with receptor for advanced glycation end products (RAGE)-mediated immune responses to promote larval migration' has been provisionally accepted for publication in PLOS Pathogens.Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.Best regards,James B. LokReviews EditorPLOS PathogensP'ng LokeSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XMichael MalimEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-7699-2064***********************************************************This revised manuscripts has many strengths. It provides a solid body of evidence for venestatin as an immune modulator acting as an antagonist of the primary receptor mediating RAGE-related immune responses. There were a number of substantive points raised by the reviewers of the primary submission and the authors have done a very conscientious job of addressing these, in many cases returning to the lab to gather some essential control data. The only substantive request that was rebutted by the authors was the request by Reviewer 2 that they gather flow cytometric data on local skin sites of penetration by infective nematode larvae. The authors rebuttal, with which I concur, was that the isolation of single-cell suspensions from skin is highly problematic and that generating such suspensions in quantities sufficient for flow analysis would be very time consuming and, while representing a potentially fruitful line of inquiry, would not ultimately, be necessary to support the conclusions of the present paper.Reviewer Comments (if any, and for reference):27 May 2021Dear Dr. Tsubokawa,We are delighted to inform you that your manuscript, "Venestatin from parasitic helminths interferes with receptor for advanced glycation end products (RAGE)-mediated immune responses to promote larval migration," has been formally accepted for publication in PLOS Pathogens.We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.Best regards,Kasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XMichael MalimEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-7699-2064
Authors: Narayanam V Rao; Brian Argyle; Xiaoyu Xu; Paul R Reynolds; Jeanine M Walenga; Margaret Prechel; Glenn D Prestwich; Robert B MacArthur; Bradford B Walters; John R Hoidal; Thomas P Kennedy Journal: Am J Physiol Cell Physiol Date: 2010-04-07 Impact factor: 4.249
Authors: Fred D Finkelman; Terez Shea-Donohue; Suzanne C Morris; Lucy Gildea; Richard Strait; Kathleen B Madden; Lisa Schopf; Joseph F Urban Journal: Immunol Rev Date: 2004-10 Impact factor: 12.988
Authors: Peter Geldhof; Linda Murray; Annabelle Couthier; John S Gilleard; Gerard McLauchlan; David P Knox; Collette Britton Journal: Int J Parasitol Date: 2006-01-18 Impact factor: 3.981