Literature DB >> 34055578

MicroRNA-342 Promotes the Malignant-Like Phenotype of Endometrial Stromal Cells via Regulation of Annexin A2.

Dan Sun1, Yiting Wang2, Li Wang1, Xin Guo1.   

Abstract

The relevance of miRNA- (miR-) 342 to endometriosis has been highlighted, while its function in regulating the malignant-like phenotype of endometrial stromal cells which demonstrate epigenetic abnormalities that alter expression of transcription factors, remains unclear. Therefore, we sought to characterize the effects of miR-342 in endometrial stromal cell proliferation by regulating Annexin A2 (ANXA2). We first characterized the levels of miR-342 and ANXA2 in 31 cases of normal endometrium from patients with grade II-III cervical intraepithelial neoplasia or patients with hysterectomy versus ectopic endometrial tissues of 42 patients with endometriosis. miR-342 was upregulated, while ANXA2 was downregulated in ectopic endometrial tissues. Bioinformatics website and dual-luciferase reporter assay revealed that miR-342 negatively modulated ANXA2 expression. Following loss- and gain-of-function approaches, CCK-8, Transwell, and flow cytometry demonstrated that overexpression of miR-342 markedly increased cell proliferation, migration, and invasion but inhibited cell apoptotic ratio of endometrial stromal cells, which was reversed by ANXA2 elevation. Further, overexpressed miR-342 activated the PI3K/AKT/mTOR signaling pathway, as evidenced by upregulated levels of p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR. Taken together, miR-342 targets ANXA2 to activate the PI3K/AKT/mTOR signaling pathway, thereby promoting the malignant-like phenotype of endometrial stromal cells, highlighting miR-342 inhibition as a promising approach for the treatment of endometriosis.
Copyright © 2021 Dan Sun et al.

Entities:  

Mesh:

Substances:

Year:  2021        PMID: 34055578      PMCID: PMC8143883          DOI: 10.1155/2021/1328682

Source DB:  PubMed          Journal:  Anal Cell Pathol (Amst)        ISSN: 2210-7177            Impact factor:   2.916


1. Introduction

Endometriosis, a frequently chronic illness haunting young women, is characterized by the endometrial stroma existence and glands outside the normal endometrium, accompanied by painful symptoms [1]. As endometriosis is characterized by endometrial-like lesions in the abdominal cavity [2], common treatment methods include destruction or cutting out of endometriosis lesions (cautery or laser) and radical excision to remove the lesion and surrounding tissue, but medical suppression of endometriosis remains poor [3]. Cell fate in endometriotic tissues has been explored predominantly at the level of the endometriotic stromal cell, which govern the lesion in terms of quantity and exhibit most of the key targetable molecular abnormalities of endometriosis [4]. Therefore, endometrial stromal cells were used in this study as an in vitro model. A better understanding of the molecular activity in endometrial stromal cells could potentially contribute to novel nonhormonal treatments of endometriosis. MicroRNAs (miRNAs) serve as mediators of the gene expression and biomarkers for several diseases, including endometriosis [5]. Intriguingly, miR-342-3p with higher level was identified to be one of the miRNA biomarkers for endometriosis, which is conducive to earlier identification and treatment of endometriosis [6]. Meanwhile, miR-342-3p has been demonstrated to reduce the metabolic gene expression in adipocytes of women with endometriosis [7]. Therefore, we hypothesized that miR-342 may be conducive for endometriosis amelioration. Of note, with miR-342 as the miRNA target of this study, our targeting binding prediction further verified Annexin A2 (ANXA2) as the downstream target of miR-342, though it has not been documented. ANXA2, a Ca2+-dependent phospholipid and membrane binding protein, functions as a pivotal player on various neoplasm survival and spread [8]. ANXA2 also serves as an important player between retrograded endometrial tissues and immune suppression during the pathology of endometriosis [9]. ANXA2 is contained by endometriosis-specific exosomes in peritoneal fluid of endometriosis patients [10]. In addition, suberanilohydroxamic acid, a histone deacetylase inhibitor, was found to reduce growth of the endometrial stromal sarcoma cells by inhibiting protein kinase B (PI3K)/AKT/mTOR cascade activation [11]. Besides, the PI3K/Akt/mTOR pathway is targeted by miR-342-3p in the context of prostate cancer [12]. Moreover, the PI3K/AKT/mTOR pathway is mentioned in the literature on intracellular kinases activated by the endometriotic environment [13]. These findings indicated the relations between the PI3K/Akt/mTOR pathway and miR-342 as well as between the PI3K/Akt/mTOR pathway and endometrial stromal cell growth. Based on existing literature, it is rational to pose the hypothesis that miR-342 targets ANXA2 to influence the PI3K/AKT/mTOR signaling pathway, thus modulating the biological behaviors of endometrial stromal cells.

2. Material and Methods

2.1. Bioinformatics Analysis

The microRNA expression microarrays regarding endometriosis GSE105765 and GSE153813 were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/gds). The GSE105765 microarray contained endometrial tissues from three normal subjects and five patients with endometriosis, and the GSE153813 microarray included endometrial tissues from six normal subjects and six patients with endometriosis. We first normalized and corrected the data from the microarrays using the Limma R package (http://www.bioconductor.org/packages/release/bioc/html/limma.html) and then analyzed the expression of miR-342 in both microarrays.

2.2. Sample Collection

From April 2015 to March 2018, 42 cases of ectopic endometrial (EN) tissues from patients with endometriosis were included. Inclusion criteria are as follows: (1) women at childbearing age (20-45 years); (2) women with regular menstrual period (21-35 days); (3) women without other endocrine, immune, metabolic, or surgical diseases; (4) women without treatment of gonadotropin-releasing hormone agonists or other hormonal drugs for at least three months prior to surgery; and (5) women with intraoperative visualization of ovarian endometriotic cysts and final diagnosis confirmed by paraffin pathology. Thirty-one cases of normal endometrial tissues from patients with grade II-III cervical intraepithelial neoplasia (CIN) or received hysterectomy were collected as controls (excluding patients combined with endometriosis). All tissue samples were harvested during surgery in Heilongjiang Provincial Hospital. All patients submitted written informed consents prior to surgery, and the experiment was approved by the Ethical Committee in Heilongjiang Provincial Hospital. The samples were stored in liquid nitrogen upon collection.

2.3. Isolation and Culture of Cells

The ectopic endometrial tissues from patients with endometriosis were watered-bath in Hank's balanced salt solution supplemented with HEPES (25 mmol/mL), 1% penicillin/streptomycin, collagenase (1 mg/mL, 15 U/mg), and deoxyribonuclease (0.1 mg/mL, 1500 U/mg) in a shaking table at 37°C for 60 min. The dispersed endometrial stromal cells were separated through a 40 μm cell filter (Falcon, New York, USA). Endometrial stromal cells and HEK-293T (China Center for Type Culture Collection, Wuhan, Hubei, China) were cultured in 75 cm2 Falcon tissue culture flasks (BD Biosciences, San Jose, CA, USA) and then in F12/Dulbecco's modified Eagle's medium (DMEM; 1 : 1). Afterwards, both cell lines were added with heat-inactivated 10% fetal bovine serum (FBS; Gibco BRL, Gaithersburg, MD, USA) and antibiotics (100 IU/mL penicillin, 100 μg/mL streptomycin), followed by an incubation (37°C) in an environment containing 5% CO2. The cells at third to fifth passage were utilized for subsequent experiments.

2.4. Cell Grouping and Transfection

Endometrial stromal cells were treated with plasmids containing miR-342 mimic, miR-342 inhibitor, miR-342 mimic + ANXA2 vector, or miR-342 mimic + a PI3K/AKT/mTOR signaling pathway inhibitor LY294002 or without treatment. The plasmids used for cell transfection were designed and constructed by Shanghai GenePharma Co., Ltd. (Shanghai, China). In brief, the subcultured endometrial stromal cells were seeded in 6-well plates at 1 × 106 cells/well overnight and added with 50 pmol plasmids or inhibitor (the final volume of 25 μL). Cells were transfected as per the instruction of Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA, USA). Cells at different time point posttransfection were collected for subsequent use.

2.5. Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)

Cells in each group were collected and wash twice with cold phosphate buffer saline (PBS). Total RNA from cells was extracted using Trizol. A portion of the RNA was taken and reversely transcribed using a PrimeScript ™ RT kit (Takara, Tokyo, Japan). The reversed complementary DNA (cDNA) was applied for subsequent assessment of ANXA2 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression. Another portion of the RNA was taken for reverse transcription using a miR reverse transcription kit (Hifun Bio, Shanghai, China), and the reversed cDNA was adopted for determination of miR-342 and snRNA U6 expression. The diluted cDNA was subjected to RT-qPCR using the SYBR Premix Ex Taq II kit (Takara). The primers are listed in Table 1. The relative expression was normalized to GAPDH (mRNA) or U6 (miRNA) expression and was calculated using 2- method.
Table 1

Primer sequences for RT-qPCR.

Target genePrimer sequences (5′-3′)
miR-342F: TCTCACACAGAAATCGCACCCGT
R: GTGCAGGGTCCGAGGT

ANXA2F: TCTACTGTTCACGAAATCCTGTG
R: AGTATAGGCTTTGACAGACCCAT

U6F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT

GAPDHF: AACGGATTTGGTCGTATTGG
R: CTTCCCGTTCTCAGCCTTG

miR-342: microRNA-342; ANXA2: Annexin A2; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; RT-qPCR: reverse transcription quantitative polymerase chain reaction; F: forward; R: reverse.

2.6. Dual-Luciferase Reporter Gene Assay

The synthesized wild-type ANXA2 3′-untranslated region (3′-UTR) (ANXA2-WT) and mutated ANXA2 (ANXA2-MUT) reporter plasmids were constructed by VectorBuilder (Guangzhou, Guangdong, China). Afterwards, ANXA2-WT and ANXA2-MUT were cotransfected into HEK-293T cells with NC mimic and miR-342 mimic, respectively, using Lipofectamine 2000 (Invitrogen). Luciferase activity was detected by a luciferase kit (E1910, Promega, Madison, WI, USA) at 48 h post-transfection. Briefly, each cell sample was added with 100 μL firefly luciferase working solution and 100 μL Renilla luciferase working solution to detect firefly luciferase and Renilla luciferase, respectively. With Renilla luciferase as an internal reference, the activation of the target reporter gene was expressed as the ratio of the firefly luciferase activity to Renilla luciferase activity.

2.7. Western Blot Analysis

The cells were washed thrice with prechilled PBS before the total protein of the cells were isolated using radio-immunoprecipitation assay (P0013K, Beyotime Biotechnology, Shanghai, China). After cells were added with protein loading buffer, denatured in boiling water bath, and centrifuged, the supernatant was adopted for subsequent analysis. Afterwards, 20 μg protein was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to PVDF membranes. The membrane was blocked for 2 h and probed with primary antibodies against PI3K (133612, Novopro Biotechnology Co., Ltd., Shanghai, China), phosphorylated (p)-PI3K (G320, Everydaybio Biotechnology Co., Ltd., Shanghai, China), AKT (ab179463, Abcam, La Jolla, CA, USA), p-AKT (ab38449, Abcam), mTOR (ab32028, Abcam), p-mTOR (ab109268, Abcam), and ANXA2 (H00000302-M02, AmyJet Co., Ltd., Wuhan, Hubei, China). The protein bands were observed using enhanced chemiluminescence (ECL) detection kits (Tanon, Shanghai, China). Finally, the protein was normalized to GAPDH (1 : 2500, ab9485, Abcam) and quantified with an ECL instrument (Tanon). The gray value was analyzed using the ImageJ software version 1.8.0 (National Institutes of Health, Bethesda, USA).

2.8. Flow Cytometry

Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) dual-labeled staining was utilized to determine the cell apoptosis. Briefly, after the cells were collected 48 h after transfection, the cell concentration was adjusted to 1 × 106 cells/mL, and cells were fixed with prechilled 70% ethanol solution overnight (4°C). A total of 100 μL cell suspension (no less than 106 cells/mL) was centrifuged and resuspended in 200 μL binding buffer. Next, cells were reacted with 10 μL Annexin V-FITC and 5 μL PI in the dark (15 min). The mixture was added with 300 μL binding buffer, and finally, the apoptosis was detected at an excitation wavelength of 488 nm with a flow cytometer (Attune NxT, Thermo Fisher Scientific Inc., Waltham, MA, USA).

2.9. Counting Kit-8 (CCK8)

The CCK8 Kit (CCK-8; Bimake, Houston, TX, USA) was employed to measure the cell proliferation ability as per the instructions. After 24 h posttransfection, cells were reseeded onto 96-well plates (3000 cells/well). The optical density (OD) value was measured with a microplate reader at a wavelength of 450 nm.

2.10. Transwell Assays

Transwell chambers (pore size 8 μm; Corning Glass Works, Corning, N.Y., USA) coated with Matrigel (BD Biosciences) were applied to detect cell invasion. Transwell chambers without Matrigel were applied to assess cell migration. Cells at 48 h post-transfection were seeded in the apical chamber with serum-free medium, while medium containing 10% FBS was added to the basolateral chamber. Following a 24 h incubation, the noninvaded cells on the upper surface of the membrane were removed with a cotton swab, and the invaded cells on the lower surface were fixed with methanol and stained with crystal violet. Finally, the number of migrated cells and invaded cells was counted in 5 randomly selected fields of view (×400).

2.11. Statistical Analysis

All data, representative of three independent experiments in triplicate, are summarized by mean ± standard deviation and tested by SPSS 18.0 (Chicago, Illinois, USA), with p < 0.05 as a level of statistically significance. Unpaired t-test was performed to test the differences between two experimental groups. Two-way analysis of variance (ANOVA) was performed to test data among multiple groups. The correlation between miR-342 and ANXA2 expression in ectopic endometrial tissues was analyzed using Pearson's correlation test.

3. Results

3.1. miR-342 Expression Is Elevated in the Ectopic Endometrial Tissues

To determine the expression pattern of miR-342 in ectopic endometrium, we collected endometrial tissues from 42 patients with endometriosis and 31 controls with CIN at grades II-III or hysterectomy. Afterwards, RT-qPCR (Figures 1(a) and 1(b)) was carried out to determine the expression of miR-342 in the tissues. miR-342 level was elevated in the ectopic endometrial tissues in comparison with the controls. Analyzing the expression of miR-342 in the microarrays GSE105765 and GSE153813 of endometriosis in the GEO database, we found that the expressions of miR-342 in GSE105765 and GSE153813 microarrays were significantly higher in ectopic endometrial tissues than in normal tissues (Figures 1(b) and 1(c)).
Figure 1

miR-342 expression is elevated in the ectopic endometrial tissues. (a) The expression of miR-342 in the endometrial tissues of patients with endometriosis (n = 42) and controls (n = 31) determined by RT-qPCR. (b, c) Expression of miR-342 in GSE105765 (b) and GSE153813 (c) microarrays. In (a), each dot represents one patient. Data in (b, c), representative of three independent experiments in triplicate, are shown as mean ± standard deviation. Unpaired t-test was adopted to analyze the differences between two experimental groups. RT-qPCR: reverse transcription quantitative polymerase chain reaction; miR: microRNA.

3.2. miR-342 Promotes the Malignant-Like Phenotype of Endometrial Stromal Cells

To better clarify the effects of miR-342 on endometriosis, we isolated endometrial stromal cells, which were then transfected with plasmids containing miR-342 mimic, miR-342 inhibitor, NC mimic, or NC inhibitor. RT-qPCR validated the success transfection of miR-342 (Figure 2(a)). CCK-8, Transwell, and flow cytometry were employed to assess cell proliferation (Figure 2(b)), migration (Figure 2(c)), invasion (Figure 2(d)), and proportion of PI−/Annexin+ (early apoptosis) and PI+/Annexin V+ (late apoptosis) cells (Figure 2(e)). It was found that elevation of miR-342 markedly increased cell proliferation, migration, and invasion but inhibited cell apoptotic ratio of endometrial stromal cells compared with NC mimic. Conversely, strikingly reduced cell proliferation, migration, and invasion as well as promoted cell apoptotic ratio were observed in cells treated with miR-342 inhibitor in comparison with NC inhibitor. The abovementioned results suggest that miR-342 promotes the malignant-like phenotype of endometrial stromal cells.
Figure 2

miR-342 promotes the malignant-like phenotype of endometrial stromal cells. The endometrial stromal cells were treated with miR-342 mimic or miR-342 inhibitor. (a) The transfection efficiency of miR-342 mimic or miR-342 inhibitor validated using RT-qPCR. (b) Cell proliferation determined using CCK-8. (c) Cell migration assessed using Transwell migration assay. (d) Cell invasion assessed using Transwell invasion assay. (e) Cell apoptosis determined using flow cytometry. ∗p < 0.05vs. NC mimic; #p < 0.05vs. NC inhibitor. All data, representative of three independent experiments in triplicate, are shown as mean ± standard deviation. Unpaired t-test was adopted to analyze the differences between two experimental groups. Two-way ANOVA, followed by Tukey's multiple comparison test, was performed to test data among multiple groups. RT-qPCR: reverse transcription quantitative polymerase chain reaction; miR: microRNA; CCK8: cell counting kit-8; NC: negative control; ANOVA: analysis of variance.

3.3. miR-342 Negatively Regulates ANXA2 Expression

To explore the downstream mechanism of miR-342 in endometriosis, we sought to identify its downstream target. The binding sites between miR-342 and ANXA2 were identified using the bioinformatics website (http://starbase.sysu.edu.cn/) (Figure 3(a)), which was then verified using dual-luciferase reporter assays. The results displayed that the co-transfection of miR-342 mimic strikingly inhibited the luciferase of ANXA-WT relative to co-transfection of NC mimic (Figure 3(b)). After miR-342 was overexpressed or inhibited, RT-qPCR and Western blot analysis exhibited that miR-342 elevation resulted in remarkable reductions in the ANXA2 expression, whereas an opposite trend was observed in response to miR-342 inhibitor compared with NC inhibitor (Figures 3(c)–3(e)). Further, we adopted RT-qPCR to detect the mRNA expression of ANXA2 in normal and ectopic endometrial tissues. As revealed in Figure 3(f), ANXA2 level in ectopic endometrial tissues was markedly downregulated compared with normal endometrial tissues. As expected, correlation analysis identified the negative correlation between the expression of miR-342 and ANXA2 (Figure 3(g)). Taken together, miR-342 targets and negatively mediates the ANXA2 expression in endometriosis.
Figure 3

miR-342 targets and inhibits ANXA2 expression. (a) The binding sites between miR-342 and ANXA2 predicted by a bioinformatics website (http://starbase.sysu.edu.cn/). (b) The targeting relationship between miR-342 and ANXA2 validated using dual-luciferase reporter assays. (c) The mRNA expression of ANXA2 determined using RT-qPCR after miR-342 was overexpressed or inhibited in cells. (d, e) The protein expression of ANXA2 determined using Western blot analysis after miR-342 was overexpressed or inhibited in cells. (f) The mRNA expression of ANXA2 in normal (n = 31) and ectopic endometrial tissues (n = 42) assayed using RT-qPCR. (g) The expression correlation between miR-342 and ANXA2 analyzed by Pearson's correlation analysis. ∗p < 0.05vs. NC mimic; #p < 0.05vs. NC inhibitor. &p < 0.05vs. normal endometrial tissues. All data, representative of three independent experiments in triplicate, are shown as mean ± standard deviation. Unpaired t-test was adopted to analyze the differences between two experimental groups. One-way ANOVA, followed by Tukey's multiple comparison test, was performed to test data among multiple groups. RT-qPCR: reverse transcription quantitative polymerase chain reaction; miR: microRNA; ANXA2: Annexin A2; NC: negative control.

3.4. miR-342 Promotes the Malignant-Like Phenotype of Endometrial Stromal Cells by Inhibiting ANXA2 Expression

To define the roles of miR-342/ANXA2 axis in the occurrence of endometriosis, we co-transfected endometrial stromal cells with NC mimic + NC vector, miR-342 mimic + NC vector, NC mimic + ANXA2 vector, or miR-342 mimic + ANXA2 vector, respectively. Initially, RT-qPCR detected the expression of miR-342 and ANXA2 in cells (Figure 4(a)). The potent rise in miR-342 and reduction in ANXA2 were observed in cells transfected with miR-342 mimic + NC vector, while cells treated with NC mimic + ANXA2 vector showed the upregulated ANXA2 expression without marked change in miR-342 expression compared with NC mimic + NC vector. The upregulated ANXA2 expression without marked change in the miR-342 expression was observed after ANXA2 overexpression in miR-342 mimic-treated cells compared with cells treated with miR-342 mimic + NC vector.
Figure 4

miR-342 enhances the malignant-like phenotype of endometriosis by targeting ANXA2. The endometrial stromal cells were transfected with NC mimic + NC vector, miR-342 mimic + NC vector, NC mimic + ANXA2 vector, or miR-342 mimic + ANXA2 vector. (a) The expression of miR-342 and ANXA2 determined using RT-qPCR. (b) Cell proliferation determined using CCK-8. (c) Cell migration assessed using Transwell migration assay. (d) Cell invasion assessed using Transwell invasion assay. (e) Cell apoptosis determined using flow cytometry. ∗p < 0.05vs. NC mimic + NC vector; #p < 0.05vs. miR-342 mimic + NC vector. All data, representative of three independent experiments in triplicate, are shown as mean ± standard deviation. Unpaired t-test was adopted to analyze the differences between two experimental groups. Two-way ANOVA, followed by Tukey's multiple comparison test, was performed to test data among multiple groups. RT-qPCR: reverse transcription quantitative polymerase chain reaction; miR: microRNA; ANXA2: Annexin A2; CCK8: cell counting kit-8; NC: negative control; ANOVA: analysis of variance.

Subsequently, CCK-8 (Figure 4(b)), Transwell (Figures 4(c) and 4(d)), and flow cytometry (Figure 4(e)) revealed that overexpressed miR-342 markedly increased cell proliferation, migration, and invasion but inhibited cell apoptotic ratio of NC vector-transfected cells, whereas ANXA2 elevation led to an opposite trend in NC mimic-treated cells. Suppressed cell proliferation, migration, and invasion but promoted cell apoptotic ratio were witnessed after ANXA2 overexpression in miR-342 mimic-treated cells in comparison with miR-342 mimic + NC vector. Coherently, miR-342 promotes the malignant-like phenotype of endometrial stromal cells, and ANXA2 elevation reversed these trends.

3.5. miR-342 Promotes the Malignant-Like Phenotype of Endometrial Stromal Cells by Activating the PI3K/AKT/mTOR Pathway

To better understand the underlying mechanism of miR-342/ANXA2 axis, we adopted Western blot analysis to determine the ratios of p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR (Figures 5(a) and 5(b)). Results demonstrated that after overexpression of miR-342, the PI3K/AKT/mTOR signaling pathway in cells was activated, as evidenced by the significantly increased levels of phosphorylated PI3K, AKT, and mTOR. However, after further overexpression of ANXA2, the phosphorylation level of PI3K/AKT/mTOR signaling pathway in cells was significantly blocked. These results indicated that miR-342/ANXA2 axis could regulate the PI3K/AKT/mTOR signaling pathway. After cells were treated with LY294002 (a PI3K/AKT/mTOR signaling pathway inhibitor), the activation of PI3K/AKT/mTOR signaling pathway in cells caused by overexpression of miR-342 was significantly impaired (Figures 5(c) and 5(d)).
Figure 5

miR-342 downregulation inhibits the malignant-like phenotype of endometrial stromal cells by blocking the PI3K/AKT/mTOR signaling pathway. (a, b) The level of p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR assessed using Western blot analysis after miR-342 mimic and/or ANXA2 vector. (c, d) The level of p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR assessed using Western blot analysis after LY294002 treatment in the presence of miR-342 mimic. (e) Cell proliferation determined using CCK-8 after LY294002 treatment. (f) Cell migration assessed using Transwell migration assay after LY294002 treatment. (g) Cell invasion assessed using Transwell invasion assay after LY294002 treatment. (h) Cell apoptosis determined using flow cytometry after LY294002 treatment. In (a, b), ∗p < 0.05vs. NC mimic + NC vector; #p < 0.05vs. miR-342 mimic + NC vector. In (c–h), &p < 0.05vs. NC mimic; $p < 0.05vs. miR-342 mimic. All data, representative of three independent experiments in triplicate, are shown as mean ± standard deviation. Unpaired t-test was adopted to analyze the differences between two experimental groups. Two-way ANOVA, followed by Tukey's multiple comparison test, was performed to test data among multiple groups. miR: microRNA; ANXA2: Annexin A2; CCK8: cell counting kit-8; NC: negative control; ANOVA: analysis of variance.

CCK-8 (Figure 5(e)), Transwell (Figures 5(f) and 5(g)), and flow cytometry (Figure 5(h)) exhibited that LY294002 treatment markedly inhibited cell proliferation, migration, and invasion but promoted cell apoptotic ratio in cells in the presence of miR-342 mimic. Coherently, miR-342 promotes the malignant-like phenotype of endometrial stromal cells by activating the PI3K/AKT/mTOR signaling pathway.

4. Discussion

Endometriosis, a common gynecologic disorder plaguing female population at the reproductive-age, has been regarded as a precursor lesion of different malignancies and endometriosis-related carcinoma clinically [14]. Even though tremendous effort has been devoted for several decades, the understanding of the pathogenesis and etiology of endometriosis remains superficial, and the exploration of new drugs, including antioxidants, kinase inhibitors, and miRNAs, to target specific pathways might offer hope for personalized treatment [15]. Moreover, the increased basal and promoted invasion of endometrial stromal cells are associated with ectopic implant formation [16]. Therefore, more knowledge regarding the function of miRNAs in regulating endometrial stromal cell properties is necessary. The findings derived from our in vitro studies revealed that miR-342 targets and inhibits the expression of ANXA2 to promote malignant-like phenotype of endometrial stromal cells by activating the PI3K/AKT/mTOR signaling pathway. Initially, we exhibited that miR-342 was expressed at a high level in the ectopic endometrial tissues relative to normal endometrial tissues. Consistently, miR-342-3p has been documented to be elevated in patients with endometriosis based on a comprehensive array-based analysis [17]. miR-342-3p with higher level was identified to be one of the miRNA biomarkers for endometriosis, which is conducive to earlier identification and treatment of endometriosis [6]. Moreover, miR-342 has been validated as one of the potential molecular biomarkers of chemo- and radio-resistance in locally advanced cervical cancer patients [18]. Functionally, miR-342-3p has been demonstrated to regulate the metabolic gene expression in adipocytes of women with endometriosis [7]. Furthermore, we displayed that overexpressed miR-342 contributed enhanced malignant-like phenotype of endometriosis. Similarly, the inhibition of miR-342-3p regulated by lncRNA H19 reduced the percentage of T17 cells/CD4+ and T cells and inhibited endometrial stromal cell viability to relieve endometriosis [19]. Another key finding of our study was that miR-342 binds to and negatively regulates the ANXA2 expression, which has rarely been reported. ANXA2 (also termed p36, calpactin I heavy chain, and lipocortin II), a 36 kDa protein participating in a large repertoire of cellular processes, is a member of the Annexin family consisting of 160 unique Annexin proteins [20]. Dysregulation of ANXA2 is tightly associated with a broad spectrum of prevalent diseases, involving autoimmune and neurodegenerative diseases, antiphospholipid syndrome, diabetes mellitus, and different malignant tumors [21]. The negative correlation between miR-206 and ANXA2 was identified in rats with hepatopulmonary syndrome [22]. Our study also suggested that the level of ANXA2 in ectopic endometrial tissues was markedly downregulated compared with normal endometrial tissues, and inhibited ANXA2 expression was correlated with the enhanced malignant-like phenotype of endometriosis. In concert with our finding, ANXA2 levels were suppressed during in vitro decidualization of human endometrial stromal cells in the context of severe preeclampsia [23]. ANXA2 has also been proposed to be expressed at a low level in peritoneal macrophages isolated from women with endometriosis [9]. In the subsequent study, we displayed that inhibition miR-342 blocked PI3K/AKT/mTOR signaling pathway, as evidenced by inhibited p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR ratios. The phosphorylation of PI3K/AKT/mTOR signaling pathway-related factors has been regarded as the marker for the activation of these pathways [24]. Moreover, LY294002 (a PI3K/AKT/mTOR signaling pathway inhibitor) treatment also inhibited the malignant phenotype of endometriosis. In line with our results, activation of PI3K/AKT/mTOR signaling pathway promoted epithelial-mesenchymal transition in endometrial cancer [25]. PI3K/AKT/mTOR signaling pathway was activated in women with endometriosis and may modulate the survival and proliferation of endometriotic cells [26]. More recently, PI3K/AKT/mTOR signaling pathway targeted by the miR-199a-5p/ZEB1 axis could inhibit the epithelial-mesenchymal transition of ovarian ectopic endometrial stromal cells during endometriosis [27]. Therefore, these results supported our finding that miR-342 promoted the malignant-like phenotype of endometrial stromal cells by activating the PI3K/AKT/mTOR signaling pathway.

5. Conclusion

In conclusion, our findings validated the hypothesis that miR-342 targets and inhibits the expression of ANXA2 to activate the PI3K/AKT/mTOR signaling pathway, thereby promoting the malignant-like phenotype of endometrial stromal cells (Figure 6). In vitro results elucidated that miR-342 is essential in regulation of malignant-like phenotype of endometrial stromal cells during endometriosis. Still, more investigations should be done to deeply understand the regulatory role of miR-342 in an animal setting. Base on the current evidences, developing miR-342 inhibitor may be a feasible strategy in the narrow window time for endometriosis treatment.
Figure 6

The graphical summary of the function and mechanism of miR-342 in endometriosis. miR-342 inhibits ANXA2 level to activate PI3K/AKT/mTOR signaling pathway, thereby promoting malignant-like phenotype of endometrial stromal cells. miR: microRNA; ANXA2: Annexin A2.

  27 in total

1.  Accurate diagnosis of endometriosis using serum microRNAs.

Authors:  Sarah Moustafa; Martina Burn; Ramanaiah Mamillapalli; Sepide Nematian; Valerie Flores; Hugh S Taylor
Journal:  Am J Obstet Gynecol       Date:  2020-03-09       Impact factor: 8.661

2.  Downregulation of lncRNA ZEB1-AS1 Represses Cell Proliferation, Migration, and Invasion Through Mediating PI3K/AKT/mTOR Signaling by miR-342-3p/CUL4B Axis in Prostate Cancer.

Authors:  Teng Ma; Hua Chen; Peilong Wang; Ningqiang Yang; Junsheng Bao
Journal:  Cancer Biother Radiopharm       Date:  2020-04-09       Impact factor: 3.099

3.  LncRNA MEG3 contributes to adenosine-induced cytotoxicity in hepatoma HepG2 cells by downregulated ILF3 and autophagy inhibition via regulation PI3K-AKT-mTOR and beclin-1 signaling pathway.

Authors:  Zejin Pu; Lingfei Wu; Yitian Guo; Guoping Li; Mengqi Xiang; Lixuan Liu; Haolian Zhan; Xiaotao Zhou; Hui Tan
Journal:  J Cell Biochem       Date:  2019-05-29       Impact factor: 4.429

4.  Macrophage ERα promoted invasion of endometrial cancer cell by mTOR/KIF5B-mediated epithelial to mesenchymal transition.

Authors:  Xuanxuan Jing; Jin Peng; Yu Dou; Jintang Sun; Chao Ma; Qingjie Wang; Lin Zhang; Xia Luo; Beihua Kong; Yun Zhang; Lijie Wang; Xun Qu
Journal:  Immunol Cell Biol       Date:  2019-03-14       Impact factor: 5.126

5.  Surgical Management of Superficial Peritoneal Adolescent Endometriosis.

Authors:  Marc R Laufer; Jon I Einarsson
Journal:  J Pediatr Adolesc Gynecol       Date:  2019-01-29       Impact factor: 1.814

Review 6.  Kinase signalling pathways in endometriosis: potential targets for non-hormonal therapeutics.

Authors:  Brett D McKinnon; Vida Kocbek; Kostantinos Nirgianakis; Nick A Bersinger; Michael D Mueller
Journal:  Hum Reprod Update       Date:  2016-01-05       Impact factor: 15.610

7.  Suppression of annexin A2 by prostaglandin E₂ impairs phagocytic ability of peritoneal macrophages in women with endometriosis.

Authors:  Meng-Hsing Wu; Pei-Chin Chuang; Yiu-Juian Lin; Shaw-Jenq Tsai
Journal:  Hum Reprod       Date:  2013-01-22       Impact factor: 6.918

8.  A microRNA expression signature for clinical response in locally advanced cervical cancer.

Authors:  Abraham Pedroza-Torres; Jorge Fernández-Retana; Oscar Peralta-Zaragoza; Nadia Jacobo-Herrera; David Cantú de Leon; Jorge F Cerna-Cortés; Cesar Lopez-Camarillo; Carlos Pérez-Plasencia
Journal:  Gynecol Oncol       Date:  2016-07-14       Impact factor: 5.482

9.  MiR-199a-5p Targets ZEB1 to Inhibit the Epithelial-Mesenchymal Transition of Ovarian Ectopic Endometrial Stromal Cells Via PI3K/Akt/mTOR Signal Pathway In Vitro and In Vivo.

Authors:  Yong Liu; Chang Lu; Linyuan Fan; Jingxuan Wang; Ting Li; Zhaohui Liu; Jie Sheng; RuiYa Qian; Aihong Duan; Dan Lu
Journal:  Reprod Sci       Date:  2020-01-01       Impact factor: 3.060

10.  Characterization of exosomes in peritoneal fluid of endometriosis patients.

Authors:  Hannah M Nazri; Maria Imran; Roman Fischer; Raphael Heilig; Sanjiv Manek; Rebecca A Dragovic; Benedikt M Kessler; Krina T Zondervan; Thomas T Tapmeier; Christian M Becker
Journal:  Fertil Steril       Date:  2020-02       Impact factor: 7.329

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.