Literature DB >> 34003875

LINC00958 promotes proliferation, migration, invasion, and epithelial-mesenchymal transition of oesophageal squamous cell carcinoma cells.

Biqi Wang1, Duo Tang1, Zijia Liu1, Qian Wang1, Shan Xue1, Zijie Zhao1, Dongdong Feng1, Chao Sheng1, Jintao Li1, Zhixiang Zhou1.   

Abstract

Oesophageal cancer is one of the deadliest cancers in the world. Oesophageal squamous cell carcinoma (ESCC) is the most prevalent histological type of oesophageal cancer. Oesophageal cancer has a poor prognosis because of its invasiveness. Thus, it is especially important to seek effective treatment methods. Research indicates that long non-coding RNAs (lncRNAs) play a significant role in the occurrence and development of oesophageal cancer. The aim of this study was to describe the role of LINC00958 in ESCC. Bioinformatics and real-time quantitative polymerase chain reaction (RT-qPCR) methods were utilized to predict and verify the expression of LINC00958 in ESCC. Related functional experiments, including cell proliferation, migration and invasion, were performed. In addition, a western blot and a dual luciferase reporter gene experiment were used to study the detailed carcinogenic mechanism of LINC00958. The results indicated there was a high expression of LINC00958 in ESCC, which promoted proliferation, migration, invasion and Epithelial-Mesenchymal Transition (EMT) of ESCC cells, and this effect may be via regulating miR-510-5p.

Entities:  

Year:  2021        PMID: 34003875      PMCID: PMC8130937          DOI: 10.1371/journal.pone.0251797

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Oesophageal cancer (EC) is the seventh most common cancer in the world. It is estimated that there are 604,100 new diagnoses of EC every year [1]. Oesophageal squamous cell carcinoma (ESCC) is the main histological type of EC. The occurrence of EC may be related to many factors, including smoking, drinking, eating salty food, and viral infections [2,3]. EC is one of the deadliest cancers because of its invasiveness and low survival rate. Data show that the 5-year survival rate for EC is only 15–25% [4]. The incidence of EC increases every year and is highest in Asia and Africa [5]. According to research statistics, the number of global cases of EC is expected to increase to 808,508 in 2035 [6]. Therefore, it is particularly important to understand the mechanisms of the occurrence and development of EC, and to seek effective therapeutic targets. Long non-coding RNAs (lncRNAs) are a type of non-coding RNA that are greater than 200 nt in length; lncRNAs play a variety of important biological roles in cells [7]. For example, lncRNAs compete with microRNA (miRNA) by functioning as competitive endogenous RNA (ceRNA), thereby regulating the downstream target of miRNA [8]. Currently, evidence shows that an abnormal expression of lncRNA is closely related to the occurrence, metastasis and stage of tumours [9]. One study showed that lncRNA MALAT1 regulates the expression of HMGB1 by competing with miR-129-5p, which promotes the development of colon cancer [10]. In ESCC, lncRNA NEAT1 regulates the proliferation and invasion of ESCC through the miR-129/CTBP2 axis [11]. A recent study showed that LINC00958 is involved in the carcinogenesis of bladder cancer [12]. The high expression of LINC00958 has also been shown to promote the occurrence and development of certain cancers, including bladder cancer, oral cancer, pancreatic cancer, gastric cancer, cervical cancer and glioma [13-18]. However, the relevant mechanism of LINC00958 in EC, especially ESCC, has not yet been determined. In present study, we determined the upregulated expression of LINC00958 in ESCC cell lines, and functional studies showed that LINC00958 exerted enhanced actions on proliferation, migration, invasion and EMT of ESCC cells. In addition, we verified miR-510-5p, a tumour suppressor [19] to be a target miRNA of LINC00958, and suggested that the antitumor effect of miR-510-5p might be related to its target gene SPOCK1 [20]. Therefore, it is our expectation that the results of this study will provide new strategies for the treatment of EC.

Materials and methods

Cell culture and transfection

Three ESCC cell lines, EC109, EC9706 and KYSE180, and an immortal oesophageal epithelial cell line, Shantou Human Embryonic Oesophageal Epithelial (SHEE) cell line, were obtained from the Institute of Virology of the Chinese Academy of Preventive Medicine, Beijing, China. The cells were cultured in Gibco Dulbecco’s Modified Eagle Medium (DMEM; Thermo Fisher Scientific Inc., Waltham, MA, USA) with 10% foetal bovine serum (FBS; Thermo Fisher Scientific Inc.) and HyClone penicillin-streptomycin (100 U/mL and 100 μg/mL, respectively) (Cytiva, USA), and placed in a 5% CO2 cell culture incubator (Thermo Fisher Scientific Inc.) at a constant temperature of 37°C. The pcDNA3.1 plasmid that overexpressed the LINC00958 gene was constructed and named pcDNA3.1-LINC00958. The empty pcDNA3.1 vector was regarded as the control. For the knockdown of LINC00958, siRNA-LINC00958-1 CCUUUGUUUCCAAAGGUUACC, siRNA-LINC00958-2 GCCUUAAAACUCACAUAGAGA and siRNA-LINC00958-3 GCGAAACUCCAUCUAAAAAAA (KeyGEN BioTECH, Nanjing, China) were designed and synthesised. The jetPRIME transfection reagent (PolyPlus transfection, Illkirch, France) was used according to the manufacturer’s instructions for transfection. After 48 hours, the cells were collected.

RNA extraction and real-time qPCR

Total RNA was extracted from the cells using Invitrogen TRIzol (Thermo Fisher Scientific Inc.) according to the manufacturer’s instructions. The Ambion Protein and RNA Isolation System (PARIS™) kit (Thermo Fisher Scientific Inc.) was used to isolate nucleoplasmic RNA. Primers were found through the PrimerBank website (https://pga.mgh.harvard.edu/primerbank/) or designed using Oligo7 software (Table 1). The PrimeScript RT Reagent Kit with gDNA Eraser (Takara Bio Inc., Dalian, China) was used to synthesize 1 μg of total RNA with a final volume of 20 μL to synthesise the cDNA. SYBR® Premix DimerEraser™ (Takara,) was used to detect gene expression using the ViiA 7 Real-Time PCR System (Thermo Fisher Scientific Inc.). GAPDH and U6 were used as endogenous controls for the cytoplasm and nucleus. The SHEE cell line was used as the experimental control. The 10-μL RT-qPCR reaction was repeated 4 times for each gene. The 2–ΔΔCt method was used to calculate the relative gene expression levels.
Table 1

Primer sequences for real-time fluorescence-based quantitative-PCR.

SymbolOligonucleotide (5′ to 3′)
GAPDHForwardTGTTGCCATCAATGACCCCTTC
ReverseAGCATCGCCCCACTTGATTTTG
U6ForwardCTCGCTTCGGCAGCACA
ReverseAACGCTTCACGAATTTGCGT
LINC00958ForwardCACGTTTTATTTCTGACTGCT
ReverseAGTGGACTCATCTTTGCCT

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; U6, U6 small nuclear RNA; LINC00958, long intergenic non-protein coding RNA 958.

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; U6, U6 small nuclear RNA; LINC00958, long intergenic non-protein coding RNA 958.

Wound healing assay

The wound healing assay was used to determine cell migration. A sterile 10-μL pipette tip was used to produce wounds in approximately 90% of the cells 24 hours after transfection. The cells were incubated at 37°C and 5% CO2 for 24 hours. An inverted Axio Observer A1 fluorescence microscope (ZEISS, Jena, Germany) was used to assess the migration of cells into the wound at 0 hours and at 24 hours. The cell migration distance in μm was calculated using ImageJ software. The assay was repeated at least three times.

Bioinformatics analysis

The bioinformatics-based ENCORI (The Encyclopedia of RNA Interactomes) website (http://starbase.sysu.edu.cn/) was used to predict the binding site of LINC00958 and miR-510-5p [21]. The TargetScan website (http://www.targetscan.org) was used to predict the potential downstream mRNA targets of miR-510-5p. The GEPIA (Gene Expression Profiling Interactive Analysis) website (http://gepia.cancer-pku.cn/) was used to analysis data from TCGA (The Cancer Genome Atlas) [22].

Dual luciferase reporter gene assay

The sequences of LINC00958-wt site and LINC00958-mut site were synthesised (Tsingke Biological Technology, Beijing, China) and constructed into the PmirGLO plasmid (Promega Corp., Madison, WI, USA), named PmirGLO-LINC00958 and PmirGLO-NC, and co-transfected with synthetic miR510-5p mimic (Tsingke Biological Technology, Beijing, China) into EC109 cells. After 48 hours, a Dual Luciferase Reporter Gene Detection kit (YuanPingHao Bio, Beijing, China) was used to detect the activity of luciferase according to the manufacturer’s instructions.

Clone formation assay

Forty-eight hours after transfection, the cells were seeded in a 6-well plate (Corning, New York, USA) at a density of 3,000 cells/well. After 14 days, the cells were washed twice with phosphate-buffered saline (PBS) (Thermo Fisher Scientific Inc., Waltham, MA, USA) and fixed with 4% paraformaldehyde for 30 minutes. A 0.1% crystal violet staining solution was used to dye the cells for 10 minutes. The number of cell clones was then calculated.

xCELLigence RTCA DP system

The xCELLigence Real-Time Cell Analyzer (RTCA) DP system (ACEA Biosciences, San Diego, CA, USA) was used to detect the effect that LINC00958 had on the proliferation and invasion of the ESCC cell lines. Forty-eight hours after transfection, the cells were collected. To detect the invasion of the cells, 168 μL of DMEM with 10% FBS was added to the lower chamber of a CIM-Plate 16 (ACEA Biosciences), and 30 μL of DMEM without FBS was added to the upper chamber. The reference value was measured after the CIM-Plate was placed at 37°C for 1 hour. The cells were seeded in a CIM-Plate 16 at a density of 30,000 cells/well. The medium in the upper chamber was supplemented to 100 μL, and performed for 24 hours; the invasion data was tested at regular time intervals. To determine the proliferation of the cells, 50 μL of DMEM with 10% FBS was added to an E-Plate 16 (ACEA Biosciences) to measure the reference value. The cells were seeded in the E-Plate 16 at a density of 2,000 cells/well. The medium in the upper chamber was supplemented to 200 μL, and performed for 72 hours; the proliferation data was tested at regular time intervals.

Flow cytometry cell cycle analysis

Forty-eight hours after transfection, the cells were collected and washed twice with PBS and then fixed overnight in cold ethanol at 4°C. Before the experiment, the cells were washed twice with PBS and incubated with RNase A (Thermo Fisher Scientific Inc., Waltham, MA, USA) for 30 minutes at 37°C. The cells were then stained with propidium iodide A flow cytometer (FACScan system; BD Biosciences, San Jose, CA, USA) was used to analyse the stained cells.

Western blot

Forty-eight hours after transfection, each group of cells was washed twice with ice-cold PBS; a RIPA lysis buffer (Cell Signaling Technology, Danvers, MA, USA) containing a protease inhibitor mixture (Roche, Basel, Switzerland) was used for processing. The sample was centrifuged at a rate of 12,000 rpm for 10 minutes at 4°C, and the supernatant was extracted. A BCA protein assay kit (Solarbio Science & Technology Co., Ltd., Beijing, China) was used to measure the total protein concentration of the sample; the sample was diluted with PBS to ensure the concentration was consistent. A 5 × loading buffer (Applygen Technologies Inc., Beijing, China) was added, and the mixture was boiled in a water bath at 100°C for 5 minutes. The protein sample was added to 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) for processing. The semidry method was used to transfer the gel to the polyvinylidene fluoride (PVDF) membrane (Millipore Simga, Shanghai, China). A 5% skimmed milk powder diluted with Tris buffered saline with Tween 20 (TBST) (Applygen, Beijing, China) was used for sealing for 1 hour. The membrane was then incubated with a diluted primary antibody overnight. The primary antibody included: rabbit polyclonal antibody SPOCK1 (1:1000, BD-PN2270, Biodragon, Beijing, China); rabbit polyclonal antibody E-Cadherin (1:1000, #9782, Cell Signaling Technology); rabbit polyclonal antibody Vimentin (1:1000, #9782, Cell Signaling Technology); rabbit polyclonal antibody ZO-1 (1:1000, #9782, Cell Signaling Technology); rabbit polyclonal antibody Occludin (1:1000, #9782, Cell Signaling Technology); and rabbit polyclonal antibody GAPDH (1: 5000, 10494-1-AP, Proteintech). The membrane was washed 3 times with TBST for 10 minutes each time. The secondary KPL antibody was incubated with marked DyLight 800 (KPL, California, USA) for 1 hour. Finally, the Odyssey infrared imaging system (LI-COR Biosciences, Lincoln, NE, USA) was used for the detection and quantification of the cells using ImageJ software.

Statistical analysis

All data graphs were obtained using GraphPad Prism 7.04 software. All statistical analyses were performed using GraphPad Prism 7.04 and IBM SPSS Statistics software. The results were expressed as the mean ± standard deviation (SD). All data were analysed and compared using the t-test, ANOVA analysis or chi-square test. P values < 0.05 were considered to be significant.

Results

LINC00958 was upregulated in ESCC

To study the expression of LINC00958 in ESCC, the GEPIA website was used to analyse the difference in gene expression between the tumour tissues and normal tissues. As expected, there was a high expression of LINC00958 in 182 tumour tissues compared with 13 normal oesophageal tissues (Fig 1A). We used RT-qPCR to detect the expression of LINC00958 in the ESCC cell lines, EC109, EC9706 and KYSE180. SHEE cells with a normal oesophageal cell phenotype was used as the control. We found a high expression of LINC00958 in the ESCC cell lines (Fig 1B). The data indicated that LINC00958 is upregulated in ESCC, which may be related to the development of EC.
Fig 1

Expression of LINC00958 in ESCC cell lines and tissues.

(A) The mean expression of LINC00958 in ESCA patients (GEPIA). The mRNA expression of pattern of LINC00958 in 182 ESCA tumour tissues (T) and 13 normal tissues (N) (* P < 0.05). (B) The RT-qPCR detection of LINC00958 in ESCC cells (*** P < 0.001, n = 3).

Expression of LINC00958 in ESCC cell lines and tissues.

(A) The mean expression of LINC00958 in ESCA patients (GEPIA). The mRNA expression of pattern of LINC00958 in 182 ESCA tumour tissues (T) and 13 normal tissues (N) (* P < 0.05). (B) The RT-qPCR detection of LINC00958 in ESCC cells (*** P < 0.001, n = 3).

Downregulation of LINC00958 inhibited cell proliferation and induced cell cycle arrest in the G1 phase

The knockdown and overexpression of LINC00958 were used to verify the biological effects on ESCC cell lines. Three siRNAs were designed for the knockdown of LINC00958. We found that siRNA-LINC00958-2 and siRNA-LINC00958-3 had significant knockdown effects (Fig 2A). After pcDNA3.1-LINC00958 was transfected into EC109 cells, the overexpression effect of LINC00958 was significant (Fig 2B). The results showed that the overexpression of LINC00958 promoted the proliferation of ESCC, which was detected using the xCELLigence RTCA DP system, while the knockdown of LINC00958 inhibited the proliferation of ESCC (Fig 2C and 2D). Similar results were obtained in the clone formation assay (Fig 2E and 2F). In addition, the results of the cell cycle analysis showed that the number of cells in the G1 phase was significantly reduced due to the overexpression of LINC00958, while the number of cells in the S phase was significantly increased (Fig 2G and 2I). The knockdown of LINC00958 caused a significant increase in the number of cells in the G1 phase and a significant decrease in the number of cells in the S phase (Fig 2H and 2I). These results indicated that the downregulation of LINC00958 can induce cell cycle arrest in ESCC in the G1 phase.
Fig 2

Effects of LINC00958 on the proliferation and cell cycle of ESCC.

(A) The expression of LINC00958 after transfection of EC109 cells with siRNA. (B) The expression of LINC00958 after transfection of EC109 cells with pcDNA3.1-LINC00958. (C and D) Real-Time Cell Analyzer DP system was used to detect the effect of LINC00958 on the real-time proliferation of EC109 cells. (E and F) The effect of LINC00958 on the clonal formation of EC109 cells. (G, H and I) Flow cytometry was used to detect the effect of LINC00958 on the cell cycle of EC109 (* P < 0.05, ** P < 0.01 and *** P < 0.001, n = 3).

Effects of LINC00958 on the proliferation and cell cycle of ESCC.

(A) The expression of LINC00958 after transfection of EC109 cells with siRNA. (B) The expression of LINC00958 after transfection of EC109 cells with pcDNA3.1-LINC00958. (C and D) Real-Time Cell Analyzer DP system was used to detect the effect of LINC00958 on the real-time proliferation of EC109 cells. (E and F) The effect of LINC00958 on the clonal formation of EC109 cells. (G, H and I) Flow cytometry was used to detect the effect of LINC00958 on the cell cycle of EC109 (* P < 0.05, ** P < 0.01 and *** P < 0.001, n = 3).

LINC00958 regulated migration, invasion and EMT of ESCC

We verified the effect of LINC00958 on migration and invasion of ESCC. The wound healing assay was used to determine the effect of LINC00958 on the migration of the ESCC EC109 cells. The knockdown of LINC00958 significantly inhibited the migration ability of ESCC, while the overexpression of LINC00958 significantly promoted the migration ability (Fig 3A–3C). The xCELLigence RTCA DP system was used to measure the invasion of ESCC EC109 cells. After knockdown of LINC00958, the invasion ability of the EC109 cells was significantly reduced (Fig 3D). To determine whether LINC00958 regulated the EMT of ESCC, we used a western blot to detect the expression of EMT-related proteins. The results showed that the downregulation of LINC00958 could increase the expression of E-Cadherin, Occludin and ZO-1 and could decrease the expression of Vimentin (Fig 3E and 3F). The upregulation of LINC00958 could reduce the expression of E-Cadherin, Occludin and ZO-1, and increase the expression of Vimentin (Fig 3G and 3H). These results indicated that LINC00958 could regulate migration, invasion and EMT of ESCC.
Fig 3

Effects of LINC00958 on migration, invasion and EMT of ESCC.

(A, B and C) The effect of LINC00958 on EC109 cell migration was detected using a wound healing assay. (D) RTCA DP system was used to detect the effect of LINC00958 on the real-time invasion of EC109 cells. (E, F, G and H) The effect of LINC00958 on the expression of EMT-related proteins was detected using a western blot (* P < 0.05, ** P < 0.01 and *** P < 0.001, n = 3).

Effects of LINC00958 on migration, invasion and EMT of ESCC.

(A, B and C) The effect of LINC00958 on EC109 cell migration was detected using a wound healing assay. (D) RTCA DP system was used to detect the effect of LINC00958 on the real-time invasion of EC109 cells. (E, F, G and H) The effect of LINC00958 on the expression of EMT-related proteins was detected using a western blot (* P < 0.05, ** P < 0.01 and *** P < 0.001, n = 3).

LINC00958 regulated the expression of SPOCK1 by sponging miR-510-5p

To further study the function of LINC00958, we used the ENCORI website to predict the relationship between LINC00958 and miR-510-5p (Fig 4A). A dual luciferase reporter gene experiment was used to verify that the miR-510-5p mimics significantly inhibited the luciferase activity of the PmirGLO-LINC00958 plasmid, but had no effect on the PmirGLO-NC plasmid (Fig 4B). Subsequently, we used the TargetScan website to predict the downstream mRNA of miR-510-5p, and we focused on SPOCK1. In addition, we predicted that there was a significant correlation between LINC00958 and SPOCK1 in EC through the GEPIA website (Fig 4C). We also studied the influence of the expression of SPOCK1 in EC109 cells through the knockdown and overexpression of LINC00958. The western blot results showed that the expression of SPOCK1 significantly increased when LINC00958 was overexpressed (Fig 4D and 4E), and significantly decreased when LINC00958 was downregulated (Fig 4F and 4G). We synthesised miR-NC and miR-510-5p mimics and transfected them into EC109 cells. Compared with the control group, miR-510-5p significantly inhibited the expression of SPOCK1 (Fig 4H and 4I). The results indicated that LINC00958 could regulate the expression of SPOCK1 by competing with miR-510-5p in ESCC.
Fig 4

LINC00958 targeted miR-510-5p to regulate SPOCK1 expression.

(A) The targeting relationship between LINC00958 and miR-510-5p was predicted by the ENCORI website. (B) A dual luciferase reporter gene experiment was used to verify the targeting relationship between LINC00958 and miR-510-5p. (C) The GEPIA website predicted a correlation between LINC00958 and SPOCK1. (D, E, F and G) The relationship between LINC00958 and SPOCK1 was verified by a western blot. (H and I) The relationship between miR-510-5p and SPOCK1 was verified by a western blot. (** P < 0.01, *** P < 0.001, and ****P < 0.0001, n = 3).

LINC00958 targeted miR-510-5p to regulate SPOCK1 expression.

(A) The targeting relationship between LINC00958 and miR-510-5p was predicted by the ENCORI website. (B) A dual luciferase reporter gene experiment was used to verify the targeting relationship between LINC00958 and miR-510-5p. (C) The GEPIA website predicted a correlation between LINC00958 and SPOCK1. (D, E, F and G) The relationship between LINC00958 and SPOCK1 was verified by a western blot. (H and I) The relationship between miR-510-5p and SPOCK1 was verified by a western blot. (** P < 0.01, *** P < 0.001, and ****P < 0.0001, n = 3).

Discussion

EC is one of the deadliest and most aggressive cancers. Currently, the main treatment is an oesophagectomy. However, at the late stage, EC cannot be cured by surgical resection due to its high invasiveness. Therefore, multimodality treatment methods are particularly important [23]. LncRNAs play an important biological role in the occurrence and development of cancer. They mainly compete with miRNA in the form of ceRNA [9,24]. Experiments have proven that lncRNAs also play an important role in EC. For example, lncRNA SNHG6 regulates the expression of HIF-1α by competing with miR-186-5p and, thus, promotes the proliferation, migration and invasion of EC cells [25]. LINC00152 increases the expression of FYN by competing with miR-153-3p to promote the proliferation of EC cells [26]. In recent years, the function of LINC00958 has been widely studied. For example, Chen et al. reported that LINC00958 upregulates NUAK1 through sponging miR-625 to promote the malignant development of nasopharyngeal carcinoma [27]. Luo et al. found that LINC00958 promotes the occurrence of non-small cell lung cancer by activating the JNK/c-JUN signalling pathway [28]. Zuo et al. confirmed that a high expression of LINC00958 in liver cancer upregulates the expression of hepatic cancer-derived growth factor (HDGF) by competing with miR-3619-5p, thereby promoting the progression and adipogenesis of hepatocellular carcinoma [29]. Thus, LINC00958 can be considered to be a therapeutic target for the systemic treatment of hepatocellular carcinoma using siRNA. Although the general function of LINC00958 in cancer has become clear, the specific role of LINC00958 in EC has not yet been determined. In our current work, we found that LINC00958 showed a high expression in EC tumour tissues through the TCGA analysis. We also detected an upregulated expression of LINC00958 in ESCC cells, and verified that LINC00958 promoted proliferation, migration, invasion and EMT of ESCC. To verify the function of LINC00958 in ESCC, we predicted that there was a targeting relationship between LINC00958 and miR-510-5p using the ENCORI website (S1 Fig). Studies have reported that miR-510-5p acts as a tumour suppressor in renal cell carcinoma and, thus, inhibits cell proliferation and migration, and promotes cell apoptosis [30,31]. It can be speculated that miR-510-5p may act as a tumour suppressor in ESCC and play a similar role to that in renal cell carcinoma. SPOCK1 is a member of the SPARC family and plays an important role in cell proliferation, adhesion and migration [32,33]. Through the TargetScan website, we predicted that there was a targeting relationship between miR-510-5p and SPOCK1. Our experimental results showed that miR-510-5p is the upstream miRNA of SPOCK1. Currently, a number of studies have shown that SPOCK1 acts as an oncogene in various cancers. SPOCK1 promotes the proliferation and migration of cancer cells, regulates the cell cycle and inhibits apoptosis through the PI3K/Akt pathway [34-36]. The upregulation of SPOCK1 is also related to the advanced T stage or Gleason score of some cancers [37]. Research has also been done on SPOCK1-related functions in ESCC. For example, Xiaopeng et al. reported that SPOCK1 promotes the migration and invasion of EC109 cells through the EMT pathway [20]. Miao et al. reported that SPOCK1 affects the EMT pathway by acting on the transforming growth factor-β1 (TGF-β) [38]. Yusaku et al. reported that silencing of SPOCK1 by small interfering RNA inhibited ESCC cells migration and invasion [39] Therefore, we suggested that LINC00958 might regulate the expression of SPOCK1 by its sponging of miR-510-5p, and involve proliferation, migration, invasion and EMT of ESCC. However, these results provided only a small glimpse into the complex functions of LINC00958 in EC. Using the ENCORI website, we predicted that there could be as many as 52 possible miRNAs competing with LINC00958, and we only verified a small sample (S1 Table). In conjunction with the TargetScan website, we also predicted that there was a targeting relationship among a variety of LINC00958, miRNAs and mRNAs. For example, the adsorption of miR-185-5p, miR-625-5p/CPSF7 axis and miR-625-5p/LRRC8 axis have been confirmed, although the feasibility of the rest needs subsequent verification (S2 Table) [15,18,40].

Conclusions

In this article, we investigated the role of LINC00958 in ESCC and verified LINC00958 promoted proliferation, migration, invasion and EMT of ESCC via regulating miR-510-5p. It is hoped that our results will provide new strategies for the treatment of EC.

CeRNA network of LINC00958, miRNA and mRNA interaction was predicted using the ENCORI and TargetScan websites.

(TIF) Click here for additional data file.

LINC00958 is mainly concentrated in the cytoplasm of EC109 cells.

(TIF) Click here for additional data file.

CCK8 detected the effect of LINC00958 on the proliferation of EC109 cells.

(TIF) Click here for additional data file.

Interactions of LINC00958 and miRNA, as predicted by the ENCORI website.

(XLS) Click here for additional data file.

Interaction of LINC00958, miRNA and mRNA, as predicted by the TargetScan website.

(XLSX) Click here for additional data file. (PDF) Click here for additional data file. 26 Jan 2021 PONE-D-20-41067 LINC00958 upregulated SPOCK1 expression to promote the development of esophageal squamous cell carcinoma by sponging miR-510-5p PLOS ONE Dear Dr. Wang, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Acceptance for publication is based on criteria which can be accessed on our website. These include 1. Conclusions must be supported and based on the data presented. 2. The manuscript must be written in standard English. As this point, the manuscript contains statements that are not supported by experimental data including that LINC00958 contributes to ESCC development through upregulation of SPOCK, which would require to show that overexpression of LINC00958 indeed leads to the upregulation of SPOCK, but more so additional experimentation to assess the oncogenic effects. Please, see more detailed comments by the reviewers. The aspect of sponging is also not supported by the data presented. Additionally, quantification of Western Blot or new endpoints are needed for experiments where data show minor changes, but the effect is interpreted to be the causal to ESCC cell proliferation. Extensive language editing is necessary. Please, review our full criteria for publication on the PLOS ONE website. Please submit your revised manuscript by April 1, 2021. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Claudia D. Andl, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In their manuscript “LINC00958 upregulated SPOCK1 expression to promote the development of esophageal squamous cell carcinoma by sponging miR-510-5p”, Wang, et al. determine that LINC00958 is upregulated in esophageal squamous cell carcinoma and evaluate the consequences of this phenomenon. Given the growing body of evidence implicating long noncoding RNAs in cancer development, this manuscript is of interest to the field of esophageal biology. However, I have significant concerns regarding the mechanism proposed in this work that must be addressed through major revision prior to publication of this article. Major concern: The data are too preliminary to support the central conclusion of this manuscript – that LINC00958-mediated ‘sponging’ of miR-510-5p results in elevated SPOCK1 expression, driving ESCC development. More work is needed to support this claim. The following questions need to be addressed to conclude that LINC00958 contributes to ESCC development through upregulation of SPOCK1: 1. Does SPOCK1loss-of-function reduce the oncogenic effects (growth, invasion, EMT) of LINC00958 overexpression? 2. Does SPOCK1 overexpression rescue the oncogenic effects (growth, invasion, EMT) of LINC00958 silencing? 3. Does LINC00958 overexpression result in an upregulation of SPOCK1? The following questions need to be addressed in order to conclude that LINC00958 “sponging” of miR-510-5p is resulting in the SPOCK1-mediated oncogenic effects described in this manuscript: 1. Does overexpression of miR-510-5p reduce the oncogenic effects (growth, invasion, EMT) of LINC00958 overexpression? 2. Does miR-510-5p loss-of-function rescue the oncogenic effects (growth, invasion, EMT) of LINC00958 silencing? Additionally, more evidence must be given to conclude that miR-510-5p and LINC00958 interact. Minor concerns: 1. The manuscript requires significant editing for clarity and grammar. 2. Some of the data images are of poor quality. 3. Additional concerns that are articulated on a figure-by-figure basis below: Figure 1: The conclusion “These data indicated that LINC00958 may play an important role in the occurrence and development of esophageal cancer” is not supported by the data. These data only indicate that LINC00958 is upregulated in ESCC compared with normal esophagus. Figure 2: EC109 cells already have elevated LINC00958 expression, which dampens the impact of panels E, G, and I. Demonstrating that LINC00958 expression increases the growth rate of the normal SHEE cell line that does not already have elevated LINC00958 expression would be more convincing. C: Most of the differences in the cell index between the two samples occur within the first ten hours, which is too short of a time period for these differences to be a result of increased proliferation. After the first ten hours, the two samples exhibit the same rate of proliferation. C, D: Both siRNA-N and PCDNA3.1-N should exhibit similar growth rates given that both are EC109 cells transfected with negative controls. The discrepancy between the two growth rates should be addressed. E, F: The colony formation assays are overgrown, preventing the accurate quantification of single colonies. A better-quality image is needed. Figure 3: Similar to the comment for figure 2: These experiments should be performed in SHEE cells that overexpress LINC00958. A: What do the scale bars represent? E: Need a higher quality western blot. Figure 4: More discussion is required to explain why miR-510-5p and SPOCK1 were evaluated in this manuscript. D: Need a higher quality western blot. E: SPOCK1 is misspelled in the Y-axis label. Reviewer #2: Esophageal cancer is a highly lethal malignancy with a 5-year overall survival rate less than 20%. In this manuscript, Wang et al. described the roles of a long non-coding RNA, LINC00958, in esophageal cancer. LINC01296 was shown to promote esophageal squamous cell carcinoma cell proliferation and invasion previously (Am J Cancer Res. 2018; 8(10): 2020–2029). Using a combination of in vitro experiments, the authors showed a potential oncogenic role of LINC00958 via competing with miR-510-5p to regulate SPOCK1 expression. My major concern is that there is no in vivo experiments in this study. I also would recommend the authors to request a native English speaker to reedit this manuscript. 1. In figure 1A, there are several horizontal lines, do they represent medium value or mean of the TCGA data? It needs to describe clearly in the figure legend. 2. In figure 2G-I, what is the mechanism of inducing G1 cell cycle arrest? Are there any apoptosis-dependent cell death here? 3. The authors demonstrated a little effect on the ESCC cell proliferation by overexpression or knockdown of LINC00958 (Figure 2C-D) within 3 days. This minimal effect most likely will go away in the long term if you look at the trend of the curve. In vivo experiments need to be performed to show if manipulation of LINC00958 has any meaningful effect. 4. In the figure 3, the effect of LINC00958 on EMT proteins is also minimal based on the WB results, suggesting LINC00958 may not be the major regulator of ESCC invasion. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 1 Apr 2021 Dear reviewers and editor, Re: Resubmission of manuscript reference No.PONE-D-20-41067. Thank you for inviting us to submit a revised draft of our manuscript entitled, " LINC00958 upregulated SPOCK1 expression to promote the development of esophageal squamous cell carcinoma by sponging miR-510-5p" to PLOS ONE. We also appreciate the time and effort you and each of the reviewers have dedicated to providing insightful feedback on ways to strengthen our paper. Thus, it is with great pleasure that we resubmit our article for further consideration. We have incorporated changes that reflect the detailed suggestions you have graciously provided. Since it has been reedited by native English speaking editors, the title is now changed to “LINC00958 upregulates SPOCK1 expression to promote the development of oesophageal squamous cell carcinoma by sponging miR-510-5p”. We also hope that our edits and the responses we provide below satisfactorily address all the issues and concerns you and the reviewers have noted. If there is anything inappropriate in the revision, please point it out and we will revise it seriously. To facilitate your review of our revisions, the following is a point-by-point response to the questions and comments delivered in your letter dated Jan 26 2021. Editor’s Suggestions: 1. [Conclusions must be supported and based on the data presented. The manuscript contains statements that are not supported by experimental data including that LINC00958 contributes to ESCC development through upregulation of SPOCK, which would require to show that overexpression of LINC00958 indeed leads to the upregulation of SPOCK, but more so additional experimentation to assess the oncogenic effects.] RESPONSE: Thank you for providing these insights. We agree with you and have incorporated this suggestion throughout our paper. We also improved the expression of the experimental data in the subsequent revision of the manuscript. Western blotting assay was added to determine the effect of LINC00958 on the expression of SPOCK1.The results showed that the over-expression of LINC00958 increased the expression of SPOCK1, while the Knock-down expression of LINC00958 decreased the expression of SPOCK1. The data showed that LINC00958 could regulate the expression of SPOCK1. (page 14, lines 277-281) 2. [The aspect of sponging is also not supported by the data presented.] RESPONSE: The high expression of LINC00958 has an important relationship with the occurrence and development of esophageal cancer. In order to verify the function ways of LINC00958 in ESCC, we predicted up to 52 miRNAs competing with LINC00958 in ENCORI website (S1 Table), but we only verified the interested part. Then, we have predicted the competitive binding relationship between LINC00958 and miR-510-5p through the ENCORI website (Fig 4A). A dual luciferase reporter gene experiment was used to verify that the miR-510-5p mimics significantly inhibited the luciferase activity of the PmirGLO-LINC00958 plasmid, but had no effect on the PmirGLO-NC plasmid (Fig 4B). The results showed that LINC00958 sponging miR-510-5p. Chen et al. ( Downregulated microRNA-510-5p acts as a tumor suppressor in renal cell carcinoma), and Sun et al. (CircRNA SCARB1 Promotes Renal Cell Carcinoma Progression Via Mir- 510-5p/SDC3 Axis) have reported that miR-510-5p acts as a tumor suppressor in renal cell carcinoma, inhibiting cell proliferation and migration, and promoting cell apoptosis. According to our experimental results, LINC00958 acts through the miR-510-5p/SPOCK1 axis. It can be speculated that miR-510-5p may act as a tumor suppressor in ESCC and play a similar role to that in renal cell carcinoma. Through the Target Scan website, we predicted the targeting relationship between miR-510-5p and SPOCK1, and the experimental results also showed that miR-510-5p was the upstream miRNA of SPOCK1. Therefore, we proposed that LINC00958 could regulate the expression of SPOCK1 by adsorbing miR-510-5p through sponge to promote the development of ESCC. However, these results are just the tip of the iceberg for the complex function of LINC00958 in cancer. Combined with the Target Scan website, we also predicted the targeting relationships among various LINC00958, miRNAs and mRNAs, such as the absorption of miR-185-5p, miR-625-5p/ CpsF7 and miR-625-5p/ LRRCC8 axis, which have been confirmed, and the feasibility of the rest still needs subsequent verification (S2 Table). 3. [ Quantification of Western Blot or new endpoints are needed for experiments where data show minor changes, but the effect is interpreted to be the causal to ESCC cell proliferation.] RESPONSE: Thank you for your suggestions. We conducted new experiments on Western Blot and new antibodies were used to ensure higher quality images and to make the data more descriptive. Our results indicated that LINC00958 could regulate the migration and invasion by the EMT pathway (Fig 3E, F, G and H) and the expression of SPOCK1 (Fig 4D, E, F and G) in ESCC. 4. [ Extensive language editing is necessary. The manuscript must be written in standard English.] RESPONSE: Thank you for your suggestion. In order to improve the manuscript, we have edited for proper English language, grammar, punctuation, spelling, and overall style by one or more of the highly qualified native English speaking editors at International Research Promotion English Language Editing Services (IRP-ELES). The Certificate Verification Key is IRP-2021-ELES-26672. 5. [If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results.] RESPONSE: Thank you for your advice. We will deposit our laboratory protocols in protocols.io according to the standards. 6. [Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.] RESPONSE: Thank you for your suggestions. We have modified the name of the manuscript and the document according to the style requirements of PLOS ONE. The title is now changed to “LINC00958 upregulates SPOCK1 expression to promote the development of oesophageal squamous cell carcinoma by sponging miR-510-5p”. 7. [PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files.] RESPONSE: Thank you for your advice. We have submitted the original uncropped and unadjusted blot and gel results images as the supporting information (S1_raw_images). Reviewer#1 Suggestions: [Major concern] 1. [Does SPOCK1loss-of-function reduce the oncogenic effects (growth, invasion, EMT) of LINC00958 overexpression?] RESPONSE: Thank you for your affirmation of our work, and thank you very much for your valuable suggestions. You raise an important question. The western blot results showed that the expression of SPOCK1 significantly increased when LINC00958 was overexpressed (Fig 4D and 4E), and significantly decreased when LINC00958 was downregulated (Fig 4F and 4G). The function of SPOCK1 has been thoroughly studied. Yusaku et al. (Regulation of SPOCK1 by dual strands of pre-miR-150 inhibit cancer cell migration and invasion in the growth of squamous cell carcinoma) and Song et al. (Up-regulation of SPOCK1 induces epithelial-mesenchymal transition and promotes migration and invasion in esophageal squamous cell carcinoma) have reported that SPOCK1 can regulate the migration and invasion of esophageal squamous cell carcinoma through EMT, while the overexpression or functional loss of SPOCK1 will affect the migration and invasion of esophageal squamous cell carcinoma. 2. [Does SPOCK1 overexpression rescue the oncogenic effects (growth, invasion, EMT) of LINC00958 silencing?] RESPONSE: Thanks for your advice. Changes in the expression of LINC00958 will lead to changes in the expression of SPOCK1, which has been verified by western blot experiment (Fig 4D and E). SPOCK1 could regulate the migration and invasion of esophageal squamous cell carcinoma through EMT, while the loss of function of SPOCK1 would affect the migration and invasion of esophageal squamous cell carcinoma. We also confirmed the upstream and downstream relationship between LINC00958 and SPCOK1 through dual luciferase assay, suggesting that LINC00958 can indeed regulate the function of esophageal squamous cell carcinoma by acting on SPOCK1. LINC00958 is a long and complex lncRNA, and we have predicted hundreds of possible functions. LINC00958-SPOCK1 is one of the ones we have verified successfully, but this segment may also be the tip of the iceberg to reveal the function of LINC00958. For example, LINC-ROR is a well-studied lncRNA in esophageal squamous cell carcinoma, which can promote the progression of esophageal squamous cell carcinoma through MDM2, SOX9 and other pathways. Thank you for your criticism and correction. We will improve the results of the paper. Please continue to pay attention to us. 3. [Does LINC00958 overexpression result in an upregulation of SPOCK1?] RESPONSE: Thanks for your suggestion. We did the relevant Western blot experiment, which proved that when LINC00958 was overexpressed, the expression of SPOCK1 was significantly up-regulated, and when LINC00958 was knocked down, the expression of SPOCK1 was significantly down-regulated. (page14, lines277-281) 4. [Does overexpression of miR-510-5p reduce the oncogenic effects (growth, invasion, EMT) of LINC00958 overexpression?] RESPONSE: Thank you for your suggestion. According to our experimental results, overexpression of LINC00958 will promote the growth, migration, invasion and EMT of esophageal squamous cell carcinoma cells, while knocking down LINC00958 will get the opposite result (Page 12, lines 243-259). The dual luciferase experiment was used to verify that miR-510-5p mimics significantly inhibited the luciferase activity of PmirGLO-LINC00958, but had no effect on PmirGLO-NC (Fig 4B) indicated that there was a competitive action relationship between LINC00958 and miR-510-5p. Therefore, the overexpression of miR-510-5p can reduce the oncogenic effect of LINC00958 through the competitive binding of LINC00958. 5. [Does miR-510-5p loss-of-function rescue the oncogenic effects (growth, invasion, EMT) of LINC00958 silencing?] RESPONSE: Thanks for your suggestion, Choi et al. (MicroRNA library screening identifies growth-suppressive microRNAs that regulate genes involved in cell cycle progression and apoptosis) have been identified that miR-510-5p has tumor suppressor function and can inhibit cell growth. The dual luciferase assay proved that LINC00958 had a competitive effect with miR-510-5p (page13, lines271-274). Theoretically, when the function of miR-510-5p was lost, it could no longer combine with LINC00958 competitively. Thus, the oncogenic effects of LINC00958 silencing can be rescue. 6. [More evidence must be given to conclude that miR-510-5p and LINC00958 interact.] RESPONSE: Thanks for your suggestion. We have predicted that there are as many as 52 possible miRNAs competing with LINC00958 in ENCORI, and we only verify the parts of our interest (S1 Table). We paid attention to miR-510-5p that had an active relationship with LINC00958 (Figure 4A). After that, the dual luciferase experiment was used to verify that miR-510-5p mimics significantly inhibited the luciferase activity of PmirGLO-LINC00958, but had no effect on PmirGLO-NC (Fig 4B), indicating that miR-510-5p and LINC00958 indeed have an interaction relationship. [Minor concerns] 1. [The manuscript requires significant editing for clarity and grammar.] RESPONSE: Thank you for your suggestion. In order to improve the manuscript, we have edited for proper English language, grammar, punctuation, spelling, and overall style by one or more of the highly qualified native English speaking editors at International Research Promotion English Language Editing Services (IRP-ELES). The Certificate Verification Key is IRP-2021-ELES-26672. 2. [Some of the data images are of poor quality.] RESPONSE: Thank you for your suggestions. We have made improvements for the pictures with poor quality in the article, and we hope they can meet the standards. [Figure 1] [The conclusion “These data indicated that LINC00958 may play an important role in the occurrence and development of esophageal cancer” is not supported by the data. These data only indicate that LINC00958 is upregulated in ESCC compared with normal esophagus.] RESPONSE: Thank you for your suggestion. LINC00958 is highly expressed in clinical samples and routine cell models of esophageal squamous cell carcinoma in the laboratory, and it is indeed impossible to confirm its role in the occurrence and development. We will change this result to indicate that LINC00958 is upregulated in ESCC, which may be related to the development of EC (page 10, lines 205-208). [Figure 2] [EC109 cells already have elevated LINC00958 expression, which dampens the impact of panels E, G, and I. Demonstrating that LINC00958 expression increases the growth rate of the normal SHEE cell line that does not already have elevated LINC00958 expression would be more convincing.] RESPONSE: Thank you for your advice. EC109 or other esophageal squamous cell carcinoma cells, such as EC9706 and KYSE150, all showed high expression of LINC00958 (Fig 1B). The function of LINC00958 was verified by overexpression and knockdown. In EC109 cells, the overexpression of LINC00958 under the condition of high expression did not significantly lower the knockdown effect, but the purpose of this was to make the overexpression and knockdown confirm each other and improve the reliability of data and conclusions. SHEE cells were not selected because they were esophageal immortalized cells, which had the phenotype of normal esophageal cells and could not be used to characterize esophageal cancer. [C: Most of the differences in the cell index between the two samples occur within the first ten hours, which is too short of a time period for these differences to be a result of increased proliferation. After the first ten hours, the two samples exhibit the same rate of proliferation.] RESPONSE: Thank you for your suggestion. We used RTCA for proliferation determination. Real-time cell analyzing (RTCA) systems use gold microelectrode biosensors in each well of microtiter plates to measure electrical impedance. The electrical potential creates an electrical field between the cells and microelectrodes. Increasing the number of adherent cells and changing conditions in the cell culture alter the impedance. The impedance gives quantitative information about the number, viability, morphology and migration of the cells. The impedance of gold microelectrodes in RTCA systems when cells are not present or not adhered onto the electrodes is determined with ionic cell culture medium solution. Adherent cells act as an insulator on the surface of the electrode and change the ionic medium of the electrode solution, increasing the impedance ( Türker Şener L, Albeniz G, Dinç B, Albeniz I. iCELLigence real-time cell analysis system for examining the cytotoxicity of drugs to cancer cell lines. Exp Ther Med. 2017;14(3):1866-1870. doi:10.3892/etm.2017.4781). It detects cell proliferation by using mechanical components at the bottom of a petri dish (https://www.agilent.com/en/technology/cellular-impedance). It shows a lot of sensitivity when the cells are small, and the EC109 cells are in good condition, and when we cultured them, they were able to double in 12 hours, so this may have resulted in the same rate of proliferation 10 hours later. At the beginning, PCDNA3.1-LINC00958 group showed significant difference in proliferation compared with the control group PCDNA3.1-N, and we also conducted CCK8 experiment to prove this, so as to improve the reliability of the data (S3 Fig). [C, D: Both siRNA-N and PCDNA3.1-N should exhibit similar growth rates given that both are EC109 cells transfected with negative controls. The discrepancy between the two growth rates should be addressed.] RESPONSE: Thank you for your advice. In C and D, we conducted several experiments and found that siRNA-N would indeed grow at the same rate as normal cells. However, the growth rate of PCDNA3.1-N was significantly lower than that of normal cells, because the total length of PCDNA3.1-N was 5428bp, which might increase the burden of cells after transplanting, thus reducing the growth rate. [E, F: The colony formation assays are overgrown, preventing the accurate quantification of single colonies. A better-quality image is needed.] RESPONSE: Thank you for your advice. We have carried out the experiment again and submitted a picture with better quality (Fig 2E and F). [Figure 3] [Similar to the comment for figure 2: These experiments should be performed in SHEE cells that overexpress LINC00958.] RESPONSE: Thanks for your advice. EC109 or other esophageal squamous cell cells, such as EC9706 and KYSE150, all have a high expression of LINC00958. The reason why SHEE cell was not selected is that it is an Oesophageal squamous cell, which has the phenotype of normal esophageal cells, so it cannot be used to characterize esophageal cancer. [A: What do the scale bars represent?] RESPONSE: Thank you for your criticism and correction. The scale lines in figure 3A are intended to give the reader a more intuitive view of the boundaries of the scratches. [E: Need a higher quality western blot.] RESPONSE: Thank you for your suggestion. As for the Western Blot, we have used better antibodies to carry out the experiment again, so as to obtain higher quality pictures (Fig 3E). [Figure 4] [More discussion is required to explain why miR-510-5p and SPOCK1 were evaluated in this manuscript.] RESPONSE: The high expression of LINC00958 has an important relationship with the occurrence and development of esophageal cancer. In order to verify the function ways of LINC00958 in ESCC, we predicted up to 52 miRNAs competing with LINC00958 in ENCORI website (S1 Table), but we only verified the interested part. We focus on miR-510-5p, and have predicted the competitive binding relationship between LINC00958 and miR-510-5p through the ENCORI website (Fig 4A).We used TargetScan to predict the downstream mRNA of miR-510-5p, and we focused on SPOCK1. In addition, it was predicted that there was a significant correlation between LINC00958 and SPOCK1 in esophageal cancer through GEPIA (Fig 4C). The western blot results showed that the expression of SPOCK1 significantly increased when LINC00958 was overexpressed (Fig 4D and 4E), and significantly decreased when LINC00958 was downregulated(Fig 4F and 4G). We synthesized miR-NC and miR-510-5p mimics and transfected them into EC109 cell. Compared with the control group, miR-510-5p significantly inhibited the expression of SPOCK1 (Fig 4H and 4I), so miR-510-5p and SPOCK1 were evaluated in our manuscript. In addition, we will conduct more specific experiments to explain the related functions of miR-510-5p and SPOCK1. Please keep following us. [D: Need a higher quality western blot.] RESPONSE: Thanks for your advice. We have carried out the experiment again and obtained higher quality pictures (Fig 4H). [E: SPOCK1 is misspelled in the Y-axis label.] RESPONSE: Thanks for your advice and we have corrected the incorrect spelling (Fig 4I). Reviewer#2 Suggestions: [major concern] [There is no in vivo experiments in this study. I also would recommend the authors to request a native English speaker to reedit this manuscript.] RESPONSE: Thank you very much for your affirmation of our work, at the same time for your suggestions also express heartfelt thanks. As for the in vivo experiment, we have started to prepare for it and will publish it in the next article. Thank you for your suggestions and hope you can continue to pay attention to us. At the same time, In order to improve the manuscript, we have edited for proper English language, grammar, punctuation, spelling, and overall style by one or more of the highly qualified native English speaking editors at International Research Promotion English Language Editing Services (IRP-ELES). The Certificate Verification Key is IRP-2021-ELES-26672. We hope that the quality of our articles can meet the standard. 1. [In figure 1A, there are several horizontal lines, do they represent medium value or mean of the TCGA data? It needs to describe clearly in the figure legend.] RESPONSE: Thank you for your criticism and correction. The TCGA data represents the mean value, and we will indicate it in the picture. (page 11, line 210) 2. [In figure 2G-I, what is the mechanism of inducing G1 cell cycle arrest? Are there any apoptosis-dependent cell death here?] RESPONSE: Thank you for your suggestion. The mechanism of LINC00958 inducing G1 block has not yet been identified as its downstream target. Through bioinformatics, we have predicted the downstream targets of LINC00958 have CDK5, CDK15, CDK18 and other genes regulating cell cycle (S1 Fig), but whether they are reliable still needs experimental verification. Please continue to pay attention to us. 3. [The authors demonstrated a little effect on the ESCC cell proliferation by overexpression or knockdown of LINC00958 (Figure 2C-D) within 3 days. This minimal effect most likely will go away in the long term if you look at the trend of the curve. In vivo experiments need to be performed to show if manipulation of LINC00958 has any meaningful effect.] RESPONSE: Thank you for your suggestion. We used RTCA for proliferation determination,Real-time cell analyzing (RTCA) systems use gold microelectrode biosensors in each well of microtiter plates to measure electrical impedance. The electrical potential creates an electrical field between the cells and microelectrodes. Increasing the number of adherent cells and changing conditions in the cell culture alter the impedance. The impedance gives quantitative information about the number, viability, morphology and migration of the cells. The impedance of gold microelectrodes in RTCA systems when cells are not present or not adhered onto the electrodes is determined with ionic cell culture medium solution. Adherent cells act as an insulator on the surface of the electrode and change the ionic medium of the electrode solution, increasing the impedance.( Türker Şener L, Albeniz G, Dinç B, Albeniz I. iCELLigence real-time cell analysis system for examining the cytotoxicity of drugs to cancer cell lines. Exp Ther Med. 2017;14(3):1866-1870. doi:10.3892/etm.2017.4781) It is through a dish at the bottom of the original mechanical test cell proliferation (https://www.agilent.com/en/technology/cellular-impedance). It shows a lot of sensitivity when the cells are small, and the EC109 cells are in good condition, and when we cultured them, they were able to double in 12 hours, so this may have resulted in the same rate of proliferation 10 hours later. At the beginning, PCDNA3.1-LINC00958 group showed significant difference in proliferation compared with the control group PCDNA3.1-N, and we also conducted CCK8 experiment to prove this, so as to improve the reliability of the data (S3 Fig). We are preparing for the in vivo experiment, which will be reported in the next article. Please continue to pay attention to us. 4. [In the figure 3, the effect of LINC00958 on EMT proteins is also minimal based on the WB results, suggesting LINC00958 may not be the major regulator of ESCC invasion.] RESPONSE: Thank you for your suggestion. We use Odyssey's fluorescent color development method, which leads to the background of imprinting is not as clear as that of chemical (HRP) color development method, thus causing great interference to statistics. We have carried out the experiment again and submitted the picture with better quality (Fig 3E and 3G). It is clear indicated that the downregulation of LINC00958 could increase the expression of E-Cadherin, Occludin and ZO-1 and could decrease the expression of Vimentin (Fig 3E and 3F). The upregulation of LINC00958 could reduce the expression of E-Cadherin, Occludin and ZO-1, and increase the expression of Vimentin (Fig 3G and 3H). These results all indicated that LINC00958 could regulate the migration and invasion by the EMT pathway in ESCC. Thank you for your correction. Submitted filename: Response to Reviewers.docx Click here for additional data file. 27 Apr 2021 PONE-D-20-41067R1 LINC00958 upregulates SPOCK1 expression to promote the development of oesophageal squamous cell carcinoma by sponging miR-510-5p PLOS ONE Dear Dr. Wang, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Overall, the revised version is improved and the manuscript strengthened, which both reviewers agreed upon. However, point 4 of the PLOS ONE publication criteria require that conclusions are supported by the data, yet the conclusion that LINC00958 is promoting growth by regulating SPOCK1 expression via its sponging of miR-510-5p is still not well supported by the data at this point. Ideally, more experimentation would be recommended to strengthen these claims prior to publication. Instead, I would suggest to focus on modifications in the presentation of the data and conclusions. For acceptance, it would be sufficient to change the title to focus on the role of LINC00958 instead of SPOCK1 and revising the statements mentioned by reviewer 1 which are not supported by the present data. Please submit your revised manuscript by May 26, 2021. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Claudia D. Andl, Ph.D. Academic Editor PLOS ONE Journal Requirements: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. Additional Editor Comments (if provided): Overall, the reviewers agreed that the revised version is improved and most concerns were addressed by the authors. However, point 4 of the PLOS ONE publication criteria require that conclusions are supported by the data and this point the authors’ conclusion that LINC00958 is promoting growth by regulating SPOCK1 expression via its sponging of miR-510-5p is still not well supported by the data. More experimentation would be required to strengthen these claims prior to publication: The newly added data demonstrate that LINC00958 is regulating SPOCK1 expression, but the magnitude is small and further evidence is drawn from the literature and published changes in SPOCK1 in regard to ESCC proliferation and EMT. The authors would be required to demonstrate that SPOCK1 knockdown or overexpression rescue the phenotypes observed as result of LINC00958 knockdown or overexpression. I would like to suggest to instead change the title to focus on the role of LINC00958 in directly measured outcomes, and focus on suggestions from reviewer 1 to: Include a legend for the graph in panel A. Change the writing to not overstate the results and drawn conclusion, e.g., LINC00958 regulates migration and the EMT pathway. However, more work is needed to conclude that the observed decrease in migration following LINC00958 modulation is specifically by the EMT pathway. Remove the statements regarding the role of SPOCK1 in ESCC to reflect that the experiments do not address this question. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: (No Response) Reviewer #2: (No Response) ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: (No Response) ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: (No Response) ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: (No Response) ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: (No Response) ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Wang, et al provide compelling evidence that LINC00958 is upregulated in ESCC and promotes ESCC proliferation and cell migration. Given the growing interest in the tumor promoting role for long noncoding RNAs in ESCC, this manuscript is of interest to the field. Further, the authors have addressed many of the concerns raised during the initial review and have produced a stronger manuscript. However, the authors’ conclusion that LINC00958 is promoting growth by regulating SPOCK1 expression via its sponging of miR-510-5p is still not well supported by the data. More experimentation is required to strengthen these claims prior to publication. Major concern: 1. One of the central conclusions of the manuscript – that LINC00958 is contributing to ESCC cell proliferation and migration by suppressing SPOCK1 expression via ‘sponging’ of miR-510-p – is not well supported by the data. While the authors have now added data that demonstrate that LINC00958 is regulating SPOCK1 expression, these data are not particularly convincing given the small (~25%) magnitude of the changes. While the authors argue that changes in SPOCK1 have been well-studied in ESCC and are associated with proliferation and EMT, this evidence likely does not extend to the small changes in SPOCK1 expression observed during LINC00958 over or underexpression. The authors need to address this discrepancy, ideally by determining if SPOCK1 knockdown or overexpression rescue the phenotypes observed by LINC00958 knockdown or overexpression. Minor concerns: 1. Panel A – Please include a legend for this graph. 2. Some conclusions need to be rewritten to be supported by the data: “These results all indicated that LINC00958 could regulate the migration and invasion by the EMT pathway” (line 257-259). These results indicate that LINC00958 regulates migration and the EMT pathway. However, more work is needed to conclude that the observed decrease in migration following LINC00958 modulation is specifically by the EMT pathway. Please discuss. “Thus, it was clear that SPOCK1 had a cancer-promoting function in ESCC” (285-286). These experiments do not address the role of SPOCK1 in ESCC. Please remove this conclusion. Reviewer #2: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 1 May 2021 Dear Dr. Andl and reviewers, Re: Resubmission of manuscript reference PONE-D-20-41067R1. Thank you for inviting us to submit a revised version of the manuscript entitled, " LINC00958 upregulates SPOCK1 expression to promote the development of oesophageal squamous cell carcinoma by sponging miR-510-5p" to PLOS ONE. Thank you for your approval of our previous revision, we also appreciate the time and effort you have dedicated to providing insightful feedback on ways to strengthen our paper. Thus, it is with great pleasure that we resubmit our article for further consideration. We have incorporated changes that reflect the detailed suggestions you have graciously provided. The title has now been changed to “LINC00958 promotes proliferation, migration, invasion, and Epithelial-Mesenchymal Transition of oesophageal squamous cell carcinoma cells”. We also hope that our revision and the responses we provide below satisfactorily address all the issues and concerns you and the reviewers have noted. If there is anything inappropriate in the revision, please point it out and we will revise it seriously. Thank you for your consideration. We look forward to hearing from you. Kind Regards, Biqi Wang, MA.Eng, +86 18811071427 Faculty of environment and life, Beijing University of Technology, Beijing 100124, China Email: 1585835414@qq.com To facilitate your review of our revisions, the following is a point-by-point response to the questions and comments delivered in your letter dated April 27, 2021. Journal Requirements: 1. [Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.] RESPONSE: We have reviewed the reference list and no retracted papers were cited in the manuscript. The changes to the reference list are as follows: 1. We’ve rescinded the use of the first quotation, and replace it with the current citation 1. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021.countries. due to the update of data. (page 2, line 41) 2. We’ve removed the previous citation [23] and change it to citation [39] which is cited in the discussion. (page 16, line 340) Additional Editor Comments: 1. [However, point 4 of the PLOS ONE publication criteria require that conclusions are supported by the data and this point the authors’ conclusion that LINC00958 is promoting growth by regulating SPOCK1 expression via its sponging of miR-510-5p is still not well supported by the data. More experimentation would be required to strengthen these claims prior to publication: The newly added data demonstrate that LINC00958 is regulating SPOCK1 expression, but the magnitude is small and further evidence is drawn from the literature and published changes in SPOCK1 in regard to ESCC proliferation and EMT. The authors would be required to demonstrate that SPOCK1 knockdown or overexpression rescue the phenotypes observed as result of LINC00958 knockdown or overexpression. I would like to suggest to instead change the title to focus on the role of LINC00958 in directly measured outcomes.] RESPONSE: Thank you for your suggestions. We agree with you and have changed the title of the article to “LINC00958 promotes proliferation, migration, invasion, and Epithelial-Mesenchymal Transition of oesophageal squamous cell carcinoma cells”. (page 1, lines 4-6) As for the question of the small magnitude of LIN00958 regulating the expression of SPOCK1, it have intuitively shows that the overexpression of LINC00958 significantly increases the expression of SPOCK1, while the knockdown of LINC00958 significantly reduces the expression of SPOCK1 in Fig. 4D and 4F. We used the ImageJ software again to conduct quantitative analysis on Fig. 4D 4F, and the results as shown in Fig. 4E and 4G were obtained. 2. [Focus on suggestions from reviewer 1 to:Include a legend for the graph in panel A.] ROSPONSE:Thank you for your suggestion.We have added the legend for the graph in panel A. (Fig 1A) (pages 10-11, lines 210-212) 3. [Change the writing to not overstate the results and drawn conclusion, e.g., LINC00958 regulates migration and the EMT pathway. However, more work is needed to conclude that the observed decrease in migration following LINC00958 modulation is specifically by the EMT pathway. Remove the statements regarding the role of SPOCK1 in ESCC to reflect that the experiments do not address this question.] RESPONSE: Thank you for your advice. We have changed the writing in the manuscript and have removed the statement regarding the role of SPOCK1 in ESCC. The specific modifications are as follows: 1. The results indicated there was a high expression of LINC00958 in ESCC, which promoted proliferation, migration, invasion and Epithelial–Mesenchymal Transition (EMT) process of ESCC cells, and this effect may be via regulating miR-510-5p. (page 2, lines 35-37) 2. These results indicated that LINC00958 could regulate migration, invasion and EMT of ESCC.(page 13, lines 256-257) 3. Therefore, we suggested that LINC00958 might regulate the expression of SPOCK1 by its sponging of miR-510-5p, and involve proliferation, migration, invasion and EMT process of ESCC. (page 16, lines 340-342) Reviewer#1 Suggestions: [Major concern] 1. [One of the central conclusions of the manuscript – that LINC00958 is contributing to ESCC cell proliferation and migration by suppressing SPOCK1 expression via ‘sponging’ of miR-510-p – is not well supported by the data.] RESPONSE: Thank you for your suggestion. In our manuscript, it can be concluded that LINC00958 can regulate the proliferation and migration of oesophageal squamous cell cancer cells, and LINC00958 can regulate the expression of SPOCK1 by sponging miR-510-5p, but the conclusion that LINC00958 is contributing to ESCC cell proliferation and migration by suppressing SPOCK1 expression via ‘sponging’ of miR-510-p is indeed not sufficiently supported by the data. After our discussion, the title of the manuscript has been changed to " LINC00958 promotes proliferation, migration, invasion, and Epithelial-Mesenchymal Transition of oesophageal squamous cell carcinoma cells". 2. [While the authors have now added data that demonstrate that LINC00958 is regulating SPOCK1 expression, these data are not particularly convincing given the small (~25%) magnitude of the changes. While the authors argue that changes in SPOCK1 have been well-studied in ESCC and are associated with proliferation and EMT, this evidence likely does not extend to the small changes in SPOCK1 expression observed during LINC00958 over or underexpression. The authors need to address this discrepancy, ideally by determining if SPOCK1 knockdown or overexpression rescue the phenotypes observed by LINC00958 knockdown or overexpression.] RESPONSE: Thank you for your advice. The western blot results have intuitively shows that the expression of SPOCK1 significantly increased when LINC00958 was overexpressed (Fig 4D), and significantly decreased when LINC00958 was downregulated (Fig 4F). We used the ImageJ software again to conduct quantitative analysis on Fig. 4D and 4F, and get a significant magnitude of change as shown in Fig. 4E (~125%) and 4G (~36%) were obtained. At the same time, we have changed the statement of the conclusion to: “These results indicated that LINC00958 could regulate migration, invasion and EMT of ESCC.” (page 13, lines 256-257) “The results indicated that LINC00958 could regulate the expression of SPOCK1 by competing with miR-510-5p in ESCC.” (page 14, lines 282-283) “Therefore, we suggested that LINC00958 might regulate the expression of SPOCK1 by its sponging of miR-510-5p, and involve proliferation, migration, invasion and EMT process of ESCC.” (page 16,lines 340-342) [Minor concerns:] 1. [Panel A – Please include a legend for this graph.] RESPONSE: Thank you for your suggestion.We have added the legend for the graph in panel A. (Fig 1A) (pages 10-11, lines 210-212) 2. [Some conclusions need to be rewritten to be supported by the data:“These results all indicated that LINC00958 could regulate the migration and invasion by the EMT pathway” (line 257-259). These results indicate that LINC00958 regulates migration and the EMT pathway. However, more work is needed to conclude that the observed decrease in migration following LINC00958 modulation is specifically by the EMT pathway. Please discuss.] RESPONSE: Thank you for your suggestion. We have rewritten the conclusion to “These results indicated that LINC00958 could regulate migration, invasion and EMT of ESCC.”(page 13, lines 256-257) “We also detected an upregulated expression of LINC00958 in ESCC cells, and verified that LINC00958 promoted proliferation, migration, invasion and EMT process of ESCC.” (page 15,lines 318-320) 3. [“Thus, it was clear that SPOCK1 had a cancer-promoting function in ESCC” (285-286).These experiments do not address the role of SPOCK1 in ESCC. Please remove this conclusion.] RESPONSE: Thank you for your suggestion. We have removed the conclusion about SPOCK1 had a cancer promoting funtion in ESCC, and have rewritten the conclusion to “Therefore, we suggested that LINC00958 might regulate the expression of SPOCK1 by its sponging of miR-510-5p, and involve proliferation, migration, invasion and EMT process of ESCC.” (page 16, lines 340-342) Submitted filename: Response to Reviewers.docx Click here for additional data file. 4 May 2021 LINC00958 promotes proliferation, migration, invasion, and Epithelial-Mesenchymal Transition of oesophageal squamous cell carcinoma cells PONE-D-20-41067R2 Dear Dr. Wang, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Claudia D. Andl, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 10 May 2021 PONE-D-20-41067R2 LINC00958 promotes proliferation, migration, invasion, and Epithelial-Mesenchymal Transition of oesophageal squamous cell carcinoma cells Dear Dr. Wang: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Claudia D. Andl Academic Editor PLOS ONE
  40 in total

1.  Infection and esophageal cancer.

Authors:  Sahar Al-Haddad; Hala El-Zimaity; Sara Hafezi-Bakhtiari; Shanmugarajah Rajendra; Catherine J Streutker; Rajkumar Vajpeyi; Bin Wang
Journal:  Ann N Y Acad Sci       Date:  2014-09       Impact factor: 5.691

Review 2.  Esophageal cancer: Risk factors, screening and endoscopic treatment in Western and Eastern countries.

Authors:  María José Domper Arnal; Ángel Ferrández Arenas; Ángel Lanas Arbeloa
Journal:  World J Gastroenterol       Date:  2015-07-14       Impact factor: 5.742

3.  Silencing of Long Noncoding RNA SNHG6 Inhibits Esophageal Squamous Cell Carcinoma Progression via miR-186-5p/HIF1α Axis.

Authors:  Fang Du; Tao Guo; Chenghua Cao
Journal:  Dig Dis Sci       Date:  2019-12-18       Impact factor: 3.199

4.  SPOCK1 is up-regulated and promotes tumor growth via the PI3K/AKT signaling pathway in colorectal cancer.

Authors:  Jiaxuan Zhang; Xiaofei Zhi; Shiyu Shi; Ran Tao; Peisheng Chen; Shiyu Sun; Longjun Bian; Zhangyan Xu; Lilin Ma
Journal:  Biochem Biophys Res Commun       Date:  2016-11-23       Impact factor: 3.575

5.  MiR-129-5p influences the progression of gastric cancer cells through interacting with SPOCK1.

Authors:  Lei Yan; Kai Sun; Yang Liu; Jun Liang; Kerui Cai; Jinqiu Gui
Journal:  Tumour Biol       Date:  2017-06

Review 6.  The multilayered complexity of ceRNA crosstalk and competition.

Authors:  Yvonne Tay; John Rinn; Pier Paolo Pandolfi
Journal:  Nature       Date:  2014-01-16       Impact factor: 49.962

7.  GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses.

Authors:  Zefang Tang; Chenwei Li; Boxi Kang; Ge Gao; Cheng Li; Zemin Zhang
Journal:  Nucleic Acids Res       Date:  2017-07-03       Impact factor: 16.971

8.  SP1 induced long non-coding RNA LINC00958 overexpression facilitate cell proliferation, migration and invasion in lung adenocarcinoma via mediating miR-625-5p/CPSF7 axis.

Authors:  Longhai Yang; Lili Li; Zizi Zhou; Yi Liu; Jinyuan Sun; Xiaoming Zhang; Huiyu Pan; Song Liu
Journal:  Cancer Cell Int       Date:  2020-01-23       Impact factor: 5.722

9.  Knockdown of SPOCK1 Inhibits the Proliferation and Invasion in Colorectal Cancer Cells by Suppressing the PI3K/Akt Pathway.

Authors:  Ping Zhao; Hai-Tao Guan; Zhi-Jun Dai; Yu-Guang Ma; Xiao-Xu Liu; Xi-Jing Wang
Journal:  Oncol Res       Date:  2016-10-27       Impact factor: 5.574

Review 10.  On the classification of long non-coding RNAs.

Authors:  Lina Ma; Vladimir B Bajic; Zhang Zhang
Journal:  RNA Biol       Date:  2013-04-15       Impact factor: 4.652

View more
  2 in total

1.  LINC01232 serves as a novel biomarker and promotes tumour progression by sponging miR-204-5p and upregulating RAB22A in clear cell renal cell carcinoma.

Authors:  Qingling Liu; Chengbin Lei
Journal:  Ann Med       Date:  2021-12       Impact factor: 4.709

Review 2.  A Pleiotropic Role of Long Non-Coding RNAs in the Modulation of Wnt/β-Catenin and PI3K/Akt/mTOR Signaling Pathways in Esophageal Squamous Cell Carcinoma: Implication in Chemotherapeutic Drug Response.

Authors:  Uttam Sharma; Masang Murmu; Tushar Singh Barwal; Hardeep Singh Tuli; Manju Jain; Hridayesh Prakash; Tea Kaceli; Aklank Jain; Anupam Bishayee
Journal:  Curr Oncol       Date:  2022-03-26       Impact factor: 3.109

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.