Literature DB >> 33980954

Analysis of STAG3 variants in Chinese non-obstructive azoospermia patients with germ cell maturation arrest.

Wen Liu1,2,3,4,5, Xuan Gao1,2,3,4,5, Haobo Zhang1,2,3,4,5, Ran Liu1,2,3,4,5, Yongzhi Cao1,2,3,4,5, Ruimei Yu1,2,3,4,5, Ge Fang1,2,3,4,5, Jinlong Ma6,7,8,9,10, Shidou Zhao11,12,13,14,15.   

Abstract

STAG3 is essential for male meiosis and testis of male Stag3-/- mice shows the histopathological type of germ cell maturation arrest (MA). Whether variants of the STAG3 gene exist in Chinese idiopathic non-obstructive azoospermia (NOA) patients needs to be determined. We recruited 58 Chinese NOA men with MA who underwent testis biopsy and 192 fertile men as the control group. The 34 exons of the STAG3 gene were amplified using polymerase chain reaction (PCR) and sequenced. We identified eight novel single nucleotide polymorphisms (SNPs), including two missense SNPs (c.433T > C in exon2 and c.553A > G in exon3), three synonymous SNPs (c.539G > A, c.569C > T in exon3, and c.1176C > G in exon8), and three SNPs in introns. The allele and genotype frequencies of the novel and other SNPs have no significant differences between two groups. Our results indicated that variants in the coding sequence of the STAG3 gene were uncommon in NOA patients with MA in Chinese population. Future studies in large cohorts of different ethnic populations will be needed to determine the association between the STAG3 gene and NOA.

Entities:  

Year:  2021        PMID: 33980954      PMCID: PMC8115624          DOI: 10.1038/s41598-021-89559-9

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Infertility affects approximately 10–15% couples who consider having offspring[1]. Roughly, 30–40% of all cases could be attributed to male origin, 30–40% to female origin, and the remainder involves both problems[2]. The male infertility was proposed to have several etiologies, including endocrine disorders, spermatic duct obstruction, cryptorchidism, testicular damage, cytogenetic abnormalities and Y-chromosome microdeletion[3]. Azoospermia is a form of male infertility that affects 10–20% of infertile men[4], and nearly 50% of idiopathic azoospermia cases are considered to have a genetic basis[5,6]. There are two types of azoospermia, i.e., obstructive azoospermia and non-obstructive azoospermia (NOA)[7,8]. According to the testicular biopsy, NOA have four histopathological types, including normal spermatogenesis, hypospermatogenesis, germ cell maturation arrest (MA) and Sertoli cell only syndrome[2,9,10]. Many mouse models have linked hundreds of genes with azoospermia, but only a few studies have identified gene variants in humans with NOA, such as SYCP3, NR5A1, TEX11,CYP1A1,TDRD9, SOHLH1, USP26, ZMYND15 and PIWIL4[11-18]. MA is a form of azoospermia in which the cessation occurred at stage of germ cell formation and may have its own specific etiology[19,20]. The stromal antigen 3 (STAG3) is involved in formation of cohesin core with three other proteins including SMC1β and two α-kleisins (RAD21L and REC8), and required for synaptonemal complex formation during meiosis[21]. Stag3 male mice showed no overt phenotype apart from sterility, which is due to azoospermia and meiotic arrest[21,22]. Notably, Stag3–/– spermatocytes only reached zygotene-like stage of prophase I, and apoptosis occurred[23]. These results suggest that STAG3 plays an essential role in meiosis and may be a candidate gene for NOA patients with MA[24]. In this study, we investigated whether perturbations of the STAG3 gene were present in Chinese idiopathic NOA patients with MA histopathology.

Methods

Participants

In this study, male patients newly diagnosed with idiopathic NOA were recruited from the Center for Reproductive Medicine, Shandong University, from January 2014 to December 2018. All NOA patients were diagnosed on the basis of an andrological examination that included medical history, ultrasound, physical examination, hormone analysis, semen analysis, karyotype testing, and Y chromosome microdeletion screening. Subjects with known reasons or any relevant history may account for their infertility, such as childhood disease, cryptorchidism, environmental exposure, radiation, heat and other negative environmental exposure, varicocele, chromosomal abnormalities, hypogonadotropic hypogonadism, obstructive azoospermia, repeated infections, iatrogenic infertility, testicular trauma, abnormal karyotype, or Y-chromosome microdeletions, epididymitis, epididymo-orchitis, orchitis and/or sexualiy transmitted infections[25-27] were excluded. According to the WHO recommendations and standards[28], after two or more inspections of semen, testicular biopsies were performed in patients without available sperm. Biopsy samples were immersed in Bouin’s fluid and then sent for histopathology examination. MA histopathology in our study exhibited that spermatogenesis blocked at the spermatocyte stage (Supplemental Fig. S1). Participants include 58 Chinese MA patients, and their mean age was 28 ± 4.1 years. A total of 192 fertile men with normal sperm concentrations were used as control group, and their mean age was 29 ± 4.2 years. All samples were treated according to the National Regulation of Clinical Sampling in China. Informed consent was obtained from all participants. The study was approved by the Institutional Review Board of Reproductive Medicine of Shandong University on October 11, 2014 (document No. 42).

Polymerase chain reaction (PCR) and sequencing analysis

Genomic DNA from 58 MA patients and 192 control samples were extracted from peripheral blood. Thirty-four exons of the STAG3 gene (RefSeqGene NG_034114.1) were amplified by PCR using 26 pairs of primers (Table 1). PCR mix included Buffer (Mg2+ Plus), 2.5 mM dNTP Mixture, 5 μM of forward primer, 5 μM of reverse primer, DNA polymerase Taq (Hot Start Version), dH2O and genomic DNA in a final volume of 20 μl. PCR conditions were as follows: pre-denaturation 5 min at 95 °C, 35 cycles of denaturation 30 s at 95 °C, annealing 30 s at 58 °C (60 °C for exons 14, 19, and 20), and elongation 45 s at 72 °C, and finally end-elongation 7 min at 72 °C. PCR products were firstly analyzed by Agarose gel electrophoresis and then sequenced on an automated sequencer (PRISM 310; Applied Biosystems).
Table 1

The STAG3 gene-specific primer sequences.

NumberPrimer IDPrimer sequences (5′-3′)Primer reverse sequences (5′-3′)Product size (bp)
1Exon1AAATAGGGGCGTGGTCTCCAAGATTCCAGAAAAGCGCGG463
2Exon2GAGAAGTGCTGTGGTAGGAGGGCCACACAATGCAACATCT433
3Exon3ATGGAGGGAATAGGGTGGTTGTTCACGCCATTCTCCTGC427
4Exon4ACCAAGCGTTAATGTCACTGTTGGTATCAACAGAGGTGAGACA437
5Exon5CCTCCCAGGGTTGCTACTTAGGCTGGGAATTAGAAAGGGG327
6Exon6GGTCTTCTCATTCCCCACCTAGGATCCTGGTCATCTTCTTCC438
7Exon7TGACATCCAAGCCCCTATGACCAAGATGCAGGTAGGAAAGA436
8Exon8TCCTCTCTCCTCTGACCTCAAAGGGAAGGAAGAAGCAGGG433
9Exon9TAACCCGTTTCTCCCTGTCCATTCCATAACCAAAGGCCAGC433
10Exon10TGAGTTTGGAGAGAGGGTGGCGGAAAGGGAAACTGACTCG436
11Exon11,12GGGCGAGTAGAGTGTGGTTAGGAAGGGCAAAGGTCTGAGA513
12Exon13TTTCTGCTTTTCTGTGGGCAGCAGCAGATGGAGGAGAGAA438
13Exon14TGTTTCCTGTTGTGCTGAGCTCCTATGCACAACAGCCAGA431
14Exon15,16TAACTCCCCATGCACGTTCTGCTGACCTACCCACTCTACC503
15Exon17,18CCCTGCACCAGTGTTTCTTTAAGCAGCAAGGTATAGGAAATCT427
16Exon19,20CCACAGCACACCATCTTCTGATGGGGAAGAGGAGGAAAGC512
17Exon21AGTGGCTTTCCTCCTCTTCCCCAACCCATCTCTAGCCTGT417
18Exon22,23TCCCTCTCCTAACCCAAACCGATACTCGCCTTGTTGCTCC436
19Exon24,25-FCTCAAGTGGGAGCAACAAGGGGCTCACATGGAAGGCAAAA387
20Exon26CTTCCCCACTCTTTCCCCTCCTGAGTGGCTGAGGGTAGAC436
21Exon27CTGGACTTCTCTGTTTCCGCGGACACAACCTGCAACCAAT423
22Exon28,29GGAGGGAAGTGGGAAGAGACTACCCACACACAGCACCCTA500
23Exon30CCCTGGGCTGTGGTTAATGTACACCCAGATTCCCTCCATG428
24Exon31,32TGATCCTGCTTCATTCCCAGCTTGAGAGAGAAGGGCAGGG559
25Exon33TTTGCGAAGTGACAGGAGTGTTTGATGAGTGCACGGGTTG407
26Exon34CGTTGCTGTGTCCTGTGTATGACCAAGAACCTGACCTCCA505
The STAG3 gene-specific primer sequences.

Statistical analysis

The Sanger sequencing data were analyzed with Sequencer 4.9 software (Gene Codes Corporation, USA). Statistical analyses were carried out by the Statistical Package for Social Science for Windows (SPSS, version 22.0, IBM Corp., USA). The chi-squared test or Fisher's exact test was used when appropriate, and P < 0.05 was considered statistically significant.

Ethics approval and guideline statement

The study was approved by the Institutional Review committee of Reproductive Medicine of Shandong University on October 11, 2014 (document No. 42). All methods were carried out in accordance with relevant guidelines and regulations.

Consent for publication

The publication consent was obtained from all participants.

Results

We sequenced the STAG3 gene in 58 patients with idiopathic NOA with MA histopathology and the control 192 fertile men. As shown in Table 2, we found 12 single nucleotide polymorphisms (SNPs), including 4 known SNPs and 8 novel SNPs. The 8 novel SNPs included 2 missense SNPs (c.433T > C in exon2 and c.553A > G in exon3), 3 synonymous SNPs (c.539G > A, c.569C > T in exon3, and c.1176C > G in exon8), and 3 SNPs in introns region. The allele and genotype frequencies of all SNPs have no significant differences between the cases and control group. No plausible variants were identified.
Table 2

Allele and genotype frequencies of SNPs in Chinese men with MA (n = 58).

NumberLocationdbSNP IDSequence variationAmino acid /protein variationAlleleAllele frequency (n)GenotypeGenotype frequency (n)
MAControlMAControl
15′UTRrs188290003c.283C > AC99.1% (115)99.2% (381)CC98.3% (57)98.4% (189)
A0.9% (1)0.8% (3)CA1.7% (1)1.6% (3)
AA(0)(0)
2Exon2Novelc.433T > C

Missense

p.Val 9Ala

T59.5% (69)60.2% (231)TT20.7% (12)20.3% (39)
C40.5% (47)39.8% (153)TC77.6% (45)79.7% (153)
CC1.7% (1)0 (0)
3Exon3Novelc.539G > A

Synonymous

p.Leu44Leu

G68.1% (79)69.0% (265)GG37.9% (22)38.1% (73)
A31.9% (37)31.0% (119)GA60.3% (35)60.9% (117)
AA1.7% (1)1.0% (2)
4Exon3Novelc.553A > G

Missense

p.Asp49Gly

A69.8% (81)71.4% (274)AA39.7% (23)42.7% (82)
G30.2% (35)28.6% (110)AG60.3% (35)57.3% (110)
GG0 (0)0 (0)
5Exon3Novelc.569C > T

Synonymous

p.Asp54Asp

C69.0% (80)70.8% (272)CC39.7% (23)42.2% (81)
T31.0% (36)29.2% (112)CT58.6% (34)57.3% (110)
TT1.7% (1)0.5% (1)
6Intron3Novelc.626 + 59C > TC69.8% (81)71.4% (274)CC43.2% (25)43.2% (83)
T30.2% (35)28.6% (110)CT53.4% (31)56.3% (108)
TT3.4% (2)0.5% (1)
7Exon8Novelc.1176C > G

Synonymous

p.Glu256Glu

C70.7% (82)70.8% (272)CC41.4% (24)41.7% (80)
G29.3% (34)29.2% (112)CG58.6% (34)58.3% (112)
GG0 (0)0 (0)
8Exon13rs3735241c.1772A > T

Synonymous

p.Pro455Pro

A69.0% (80)68.2% (262)AA46.6% (27)47.4% (91)
T31.0% (36)31.8% (122)AT44.8% (26)41.7% (80)
TT8.6% (5)10.9% (21)
9Intron15Novelc.1727 + 129G > AG99.1% (115)99.2% (381)GG98.3% (57)99.0% (190)
A0.9% (1)0.8% (3)GA1.7% (1)0.5% (1)
AA0 (0)0.5% (1)
10Exon24rs1043915c.2852T > A

Synonymous

p.Ile815Ile

T61.2% (71)57.0% (219)TT32.8% (19)27.6% (53)
A38.8% (45)43.0% (165)TA56.9% (33)58.9% (113)
AA10.3% (6)13.5% (26)
11Intron33Novelc.3823 + 36C > GC61.2% (71)63.6% (244)CC32.8% (19)38.1% (73)
G38.8% (45)36.4% (140)CG56.9% (33)51.0% (98)
GG10.3% (6)10.9% (21)
123′UTRrs1052482c.4030A > TA61.2% (71)58.6% (225)AA32.8% (19)31.8% (61)
T38.8% (45)41.4% (159)AT56.9% (33)53.6% (103)
TT10.3% (6)14.6% (28)

SNP single nucleotide polymorphism, MA germ cell maturation arrest, – not applicable.

Allele and genotype frequencies of SNPs in Chinese men with MA (n = 58). Missense p.Val 9Ala Synonymous p.Leu44Leu Missense p.Asp49Gly Synonymous p.Asp54Asp Synonymous p.Glu256Glu Synonymous p.Pro455Pro Synonymous p.Ile815Ile SNP single nucleotide polymorphism, MA germ cell maturation arrest, – not applicable.

Discussion

The development of male gametogenesis includes the differentiation of spermatogonia, the process of spermatocyte meiosis, and spermatogenesis[29,30]. Meiosis is a critical stage in gametogenesis, in which alignment and synapsis of chromosome pairs occur, allowing the recombination of the maternal and paternal genomes[31]. Many of the gene variants in this process could have profound effects on gametogenesis and lead to male infertility[22]. Many gene knockout mouse models showed meiotic arrest in infertility, suggesting that they are candidate genes for NOA with MA histopathology[32]. The STAG3 gene encodes a critical subunit of the meiosis-specific cohesin complex, ensures sister chromatid cohesion and enables correct synapsis and segregation of homologous chromosomes during meiosis[19,27]. While variant in STAG3 was identified in premature ovarian failure and oocytes in Stag3 female mice were arrested at early prophase I, the knockout male mice were also infertile and showed meiotic arrest and azoospermia[33,34]. These findings indicated that STAG3 may be a potential candidate gene for NOA in human. In this study, we analyzed the STAG3 gene in 58 Chinese NOA patients with MA histopathology, which is coincided with the phenotype of the gene knockout mice[35]. Eight novel SNPs were identified, including two missense SNPs, three synonymous SNPs and three SNPs in intron region. Our findings suggest that variants in coding region of the STAG3 gene are uncommon in NOA patients with MA histopathology in China. However, it has been reported that two SNPs (rs1727130 and rs1052482) located in the 3’-UTR of the STAG3 gene were identified to be associated with NOA in Korean population[36]. Furthermore, homozygous or compound-heterozygous variants of the STAG3 gene have been identified in NOA patients from Germany, Spain, and Australia[37-39]. In this study, we did not identify the same variants which may be due to the small sample size and ethnic diversity. Consistently, whole-exome sequencing was performed in 314 Han Chinese patients with unrelated NOA and Severe Oligozoospermia, but no deleterious variants were found in STAG3[40].

Conclusions

The present study investigated variants in STAG3 in a cohort of idiopathic NOA with MA histopathology, and found no pathogenic variants. Our results suggest that variants in the STAG3 gene may not be responsible for NOA with MA in Chinese population. However, due to ethnic diversity, the exact role of STAG3 in the pathogenesis of NOA needs to be explored in large samples and other populations in the future. Supplementary Information.
  40 in total

1.  Meiotic chromosome behavior in a human male t(8;15) carrier.

Authors:  Hanwei Jiang; Liu Wang; Yingxia Cui; Zhipeng Xu; Tonghang Guo; Dongkai Cheng; Peng Xu; Wen Yu; Qinghua Shi
Journal:  J Genet Genomics       Date:  2014-01-28       Impact factor: 4.275

2.  X-linked TEX11 mutations, meiotic arrest, and azoospermia in infertile men.

Authors:  Alexander N Yatsenko; Andrew P Georgiadis; Albrecht Röpke; Andrea J Berman; Thomas Jaffe; Marta Olszewska; Birgit Westernströer; Joseph Sanfilippo; Maciej Kurpisz; Aleksandar Rajkovic; Svetlana A Yatsenko; Sabine Kliesch; Stefan Schlatt; Frank Tüttelmann
Journal:  N Engl J Med       Date:  2015-05-13       Impact factor: 91.245

3.  STAG3 is a strong candidate gene for male infertility.

Authors:  Elena Llano; Laura Gomez-H; Ignacio García-Tuñón; Manuel Sánchez-Martín; Sandrine Caburet; Jose Luis Barbero; John C Schimenti; Reiner A Veitia; Alberto M Pendas
Journal:  Hum Mol Genet       Date:  2014-03-07       Impact factor: 6.150

4.  Mutation in TDRD9 causes non-obstructive azoospermia in infertile men.

Authors:  Maram Arafat; Iris Har-Vardi; Avi Harlev; Eliahu Levitas; Atif Zeadna; Maram Abofoul-Azab; Victor Dyomin; Val C Sheffield; Eitan Lunenfeld; Mahmoud Huleihel; Ruti Parvari
Journal:  J Med Genet       Date:  2017-05-23       Impact factor: 6.318

5.  Studying meiotic cohesin in somatic cells reveals that Rec8-containing cohesin requires Stag3 to function and is regulated by Wapl and sororin.

Authors:  Peter G Wolf; Alexander Cuba Ramos; Julia Kenzel; Brigitte Neumann; Olaf Stemmann
Journal:  J Cell Sci       Date:  2018-06-11       Impact factor: 5.285

6.  Percutaneous epididymal sperm aspiration for men with obstructive azoospermia: predictors of successful sperm retrieval.

Authors:  Faysal A Yafi; Armand Zini
Journal:  Urology       Date:  2013-06-14       Impact factor: 2.649

Review 7.  Monogenic causes of non-obstructive azoospermia: challenges, established knowledge, limitations and perspectives.

Authors:  Laura Kasak; Maris Laan
Journal:  Hum Genet       Date:  2020-01-18       Impact factor: 4.132

8.  Azoospermia in patients heterozygous for a mutation in SYCP3.

Authors:  Toshinobu Miyamoto; Shiga Hasuike; Leah Yogev; Maria R Maduro; Mutsuo Ishikawa; Heiner Westphal; Dolores J Lamb
Journal:  Lancet       Date:  2003-11-22       Impact factor: 79.321

9.  Localization of two mammalian cyclin dependent kinases during mammalian meiosis.

Authors:  T Ashley; D Walpita; D G de Rooij
Journal:  J Cell Sci       Date:  2001-02       Impact factor: 5.285

10.  Association of PIWIL4 genetic variants with germ cell maturation arrest in infertile Spanish men.

Authors:  Xavi Muñoz; Mercedes Navarro; Ana Mata; Lluís Bassas; Sara Larriba
Journal:  Asian J Androl       Date:  2014 Nov-Dec       Impact factor: 3.285

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.