Literature DB >> 31115363

The association of stromal antigen 3 (STAG3) sequence variations with spermatogenic impairment in the male Korean population.

Yeojung Nam1, Kyung Min Kang2, Se Ra Sung2, Ji Eun Park2, Yun-Jeong Shin2, Seung Hun Song3, Ju Tae Seo4, Tae Ki Yoon5, Sung Han Shim1,2.   

Abstract

The stromal antigen 3 (STAG3) gene, encoding a meiosis-specific cohesin component, is a strong candidate for causing male infertility, but little is known about this gene so far. We identified STAG3 in patients with nonobstructive azoospermia (NOA) and normozoospermia in the Korean population. The coding regions and their intron boundaries of STAG3 were identified in 120 Korean men with spermatogenic impairments and 245 normal controls by using direct sequencing and haplotype analysis. A total of 30 sequence variations were identified in this study. Of the total, seven were exonic variants, 18 were intronic variants, one was in the 5'-UTR, and four were in the 3'-UTR. Pathogenic variations that directly caused NOA were not identified. However, two variants, c.3669+35C>G (rs1727130) and +198A>T (rs1052482), showed significant differences in the frequency between the patient and control groups (P = 0.021, odds ratio [OR]: 1.79, 95% confidence interval [CI]: 1.098-2.918) and were tightly linked in the linkage disequilibrium (LD) block. When pmir-rs1052482A was cotransfected with miR-3162-5p, there was a substantial decrease in luciferase activity, compared with pmir-rs1052482T. This result suggests that rs1052482 was located within a binding site of miR-3162-5p in the STAG3 3'-UTR, and the minor allele, the rs1052482T polymorphism, might offset inhibition by miR-3162-5p. We are the first to identify a total of 30 single-nucleotide variations (SNVs) of STAG3 gene in the Korean population. We found that two SNVs (rs1727130 and rs1052482) located in the 3'-UTR region may be associated with the NOA phenotype. Our findings contribute to understanding male infertility with spermatogenic impairment.

Entities:  

Keywords:  linkage disequilibrium; meiotic-specific gene; single-nucleotide variations; spermatogenic impairment; stromal antigen 3 gene

Year:  2020        PMID: 31115363      PMCID: PMC6958972          DOI: 10.4103/aja.aja_28_19

Source DB:  PubMed          Journal:  Asian J Androl        ISSN: 1008-682X            Impact factor:   3.285


INTRODUCTION

Azoospermia affects approximately 1% of the male population, accounts for over 15% of all male infertility,123 and includes genital tract obstruction (obstructive azoospermia) and spermatogenic impairment (nonobstructive azoospermia, NOA).45 NOA is mainly caused by severely impaired spermatogenesis and is reported to account for more than 70% of azoospermia in Korean patients.6 Chromosomal abnormalities, such as Klinefelter syndrome, balanced chromosomal rearrangements, and Yq microdeletions, are well known genetic causes of NOA.7 In many cases, the genetic etiology remains unknown. Matzuk and Lamb8 reviewed many genes involved in spermatogenesis and mutations in some of those genes were identified in patients with NOA.91011 The stromal antigen 3 (STAG3) gene was mapped to chromosome 7 and consists of 34 exons encoding a protein involved in the meiotic cohesion complex.12 Human STAG3 is highly expressed in the testis and several other organs including the ovary.1314 During meiosis, STAG3 forms a cohesion core with three other proteins, structural maintenance of chromosome 3 (SMC3), structural maintenance of chromosomes 1β (SMC1β), and Rad21 cohesin complex component like 1 (Rad21L1).1516 In mice, defective Stag3 protein causes aberrant meiotic chromosomal features and infertility.1718 In humans, a homozygous 1-bp deletion in STAG3 has been found in a consanguineous family with premature ovarian failure (POF),18 and a homozygous donor splice-site mutation has been found in two sisters with premature ovarian insufficiency (POI).19 Therefore, STAG3 has been suggested as a strong candidate gene target for causing male infertility.142021 To date, no homozygous or compound heterozygotic mutations of STAG3 have been identified in patients with spermatogenic impairment, and studies of STAG3 mutations have not been examined in infertile male populations. In this study, we investigated whether STAG3 variations may be a genetic cause of spermatogenic impairment in Korean men.

PATIENTS AND METHODS

Subjects

A total of 120 Korean men with spermatogenic impairment (43 oligozoospermic and 77 azoospermic) and 245 normal controls were obtained from the Cha Gangnam Medical Center at Cha University, Seoul, Korea, between January 2010 and December 2012. General and clinical characteristics of patients and controls are presented in . Patients with tubule obstruction, chromosomal abnormalities, or microdeletion of the Y chromosome AZF region were excluded. Normal controls had a normal sperm concentration and no history of infertility. Testicular size was measured by a Prader orchidometer (Pro-Health Product Ltd., Guangzhou, China). Serum testosterone, follicle-stimulating hormone (FSH), and luteinizing hormone (LH) were measured on a Cobas e601 analyzer (Roche Dignostics, Penzberg, Germany) using electrochemiluminescence immunoassay (ECLIA) method. Semen analysis was performed according to the World Health Organization criteria (WHO, 2010).22 The study was approved by the Institutional Review Board of Cha Gangnam Medical Center, Seoul, Korea, and written informed consent was obtained from all participants. Participants’ clinical characteristics aData of the azoospermic patients were excluded. s.d.: standard deviation; Rt: right; Lt: left; FSH: follicle-stimulating hormone; LH: luteinizing hormone

DNA extraction

Genomic DNA was isolated from peripheral blood of the patient and control samples with the QuickGene DNA blood kit (KURABO industries, Neyagawa, Japan), according to the manufacturer's instructions. DNA yield was quantified with the NanoDrop™ spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The extracted DNA was stored at −80°C until further analysis.

Polymerase chain reaction

Coding regions of STAG3 (NM_001282716.1) were amplified for genetic screening by polymerase chain reaction (PCR), using primers for the 34 exons and their intron boundaries that were designed by Primer 3 (http://primer3.ut.ee). As this gene has multiple pseudogenes, we performed long-range PCR that produced eleven fragments and designed eleven primer pairs to cover the 34 exons and avoid pseudogene sequences. The locations and sequences of primer sets are presented in . The list of polymerase chain reaction primer and sequencing primer sequences PCR: polymerase chain reaction

Sequencing analysis

All eleven PCR products were purified with ExoSAP-IT (USB Corporation, Cleveland, OH, USA). To sequence the eleven fragments, we designed 30 sequencing primers to cover 34 exons (). All the samples were amplified by PCR and sequenced bidirectionally using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Austin, TX, USA) and BigDye® X-Terminator™ solutions (Applied Biosystems, Bedford, MA, USA) with standard conditions. The sample supernatant was loaded on the ABI 3130XL Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) and processed with a BigDye® X-Terminator run module. All assays were repeated once for confirmation and the results matched over 99.0%.

Statistical analyses and database search

For each sequence variation, the data were statistically analyzed with Statistical Package for the Social Sciences software (SPSS version 22, IBM Software Group, Chicago, IL, USA). To evaluate the association between patient and control groups, odds ratios (OR), 95% confidence intervals (95% CI), and the applied P values were calculated from both the Chi-squared test and Fisher's exact test (two-tailed). Applied P < 0.05 were considered statistically significant. Three databases, Polyphen-2, SIFT, and Mutation Tester, were used to predict potentially damaging effects due to amino acid changes. Multiple hypothesis testing was performed with the Benjamini–Hochberg method23 to control false discovery rate (FDR) in the logistic regression analysis. Calculating the FDR is a way to address problems associated with multiple comparisons, and FDR provides a measure of the expected proportion of false-positives in the data. Haplotype block structure was established by HaploView 4.1 software (https://www.broadinstitute.org) using the method of block definition of Gabriel et al.24 Haplotype association tests were also conducted with this software.

Molecular cloning

The entire 3’-untranslated region (3’-UTR) of STAG3 was amplified from genomic DNA, which contained the rs1052482 A or T alleles, using primers that included SacI and XbaI restriction sites. Primer sequences of the STAG3 3’-UTR were: forward: 5’-GAGCTCccgttgctgtgtcctgtgta, reverse: 5’-TCTAGAgaccaagaacctgacctcca (for a predicted 476 bp product). PCR products were cloned into the pmirGLO vector (Promega, Madison, WI, USA) via the SacI and XbaI sites and all constructs were verified by DNA sequencing.

Dual luciferase assay

HEK293T cells were seeded in 48-well plates (3 × 104 per well). After 24 h, 200 ng pmir-rs1052482A, pmir-rs1052482T, or pmir-empty vector was transiently transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The Renilla vector was used as an internal control for transfection efficiency. After 48 h, the transfected cells were harvested and lysed with a dual-luciferase reporter assay system (Promega), and the activities of Firefly and Renilla were measured in a Luminometer, Centro XS LB960 (Berthold Technologies, Bad Wildbad, Germany), and MikroWin2000 software (https://mikrowin-20001.software.informer.com). Transfection experiments were performed in triplicate, and activity measurements were done for three times. Relative luciferase activity was determined by normalizing firefly luciferase activity against Renilla luciferase activity. An average value of firefly/Renilla was calculated and then normalized to the average value of the empty vector to yield the vector-normalized ratio.

MicroRNAs (miRNAs)

Computational prediction of putative targets for STAG3 mRNA was performed by searching mirmap.ezlab.org, www.targetscan.org, www.microrna.org, and www.mirdb.org for the target prediction algorithms. From the potential miRNAs interacting with STAG3 mRNA 3’-UTR, we selected seven candidate miRNAs (miR-148a, miR-2909, miR-3162-5p, miR-33a-5p, miR-33b-5p, miR-4739, and miR-6508-3p) that allowed rs1052482A or T alleles to be included in the seed sequence. Seven miRNAs and their inhibitors were constructed by Bioneer (Daejeon, Korea). The prediction score of the seven miRNAs and the 3’-UTR of STAG3 and details for their in silico interactions are presented in and . Mimics (5–10 pmol) were transiently cotransfected with pmir-vectors with Lipofectamine 2000 according to the manufacturer's instructions. miRNA target-site prediction software score miRmap: miRmap score; TargetScan: context ++ score; microrna.org: mirSVR score; mirdb.org: Target Score

RESULTS

Thirty single-nucleotide variations (SNVs) in STAG3 were identified in this study. The locations, types, frequencies, and P values of the variations are presented in . The distributions of genotypes of all the SNVs followed the Hardy–Weinberg equilibrium in patients and controls. Seven were exonic, 18 were intronic, one was in the 5’-UTR, and four were in the 3’-UTR of the 30 variations. Three exonic variants were nonsynonymous and the other four variants were synonymous. Three variants were found in a patient but not in controls (c.1269C>T p. Asp423, +112G>A, +315C>T); two variants, c.3669+35C>G and +198A>T, showed significant differences in the frequency between patient and control groups (P = 0.021, OR: 1.79, 95% CI: 1.098–2.918). Haplotype analysis by HaploView 4.1 showed that nineteen variants were separated into five linkage disequilibrium (LD) blocks (). As shown in , in particular, the frequencies of G-C-A (case: control = 0.504: 0.606, P = 0.009), G-G-T (case: control = 0.162: 0.075, P < 0.001), and C-C-A (case: control = 0.075: 0.018, P < 0.001) haplotypes in block 5 were significantly different between patients and controls. Genotypes and allele distributions of STAG3 gene variations STAG3: stromal antigen 3; SNPs: single-nucleotide polymorphism; NOA: nonobstructive azoospermia; OR: odds ratio; CI: confidence interval; FDR-P: false discovery rate-adjusted P value; –: 0, NaN (not a number) or infinity LD pattern in the locus of STAG3 gene. Nineteen variants were separated into five LD blocks. Numbers in the squares indicate D’ index (level of LD) between the corresponding SNPs. STAG3: stromal antigen 3; SNPs: single-nucleotide polymorphism; LD: linkage disequilibrium. Haplotype analysis between the SNPs of STAG3 and nonobstructive azoospermia STAG3: stromal antigen 3; SNPs: single-nucleotide polymorphism; NOA: nonobstructive azoospermia; OR: odds ratio; CI: confidence interval; FDR-P: false discovery rate-adjusted P value shows a genetic model of the 3 SNVs (rs2246713, rs1727130, and rs1052482) between the cases and the controls. We found that the individuals with the CG genotype of rs1727130 and AT genotype of rs1052482 had an increased risk susceptibility to NOA in the codominant model, and those with the minor allele G of rs1727130 and T of rs1052482 had an increased risk susceptibility to NOA in the dominant model (P = 0.039, OR: 1.64, 95% CI: 1.030–2.608). The genotype distributions of STAG3 rs2246713, rs1727130, and rs1052482 in the cases and the controls STAG3: stromal antigen 3; SNPs: single-nucleotide polymorphism; OR: odds ratio; CI: confidence interval; FDR-P: false discovery rate-adjusted P value To determine whether variations in the 3’-UTR region affected miRNA-mediated gene expression regulation, miRNAs predicted to interact with STAG3 were examined by in silico analysis, and seven miRNAs, miR-148a, miR-2909, miR-3162-5p, miR-33a-5p, miR-33b-5p, miR-4739, and miR-6508-3p, were found potentially to interact with the 3’-UTR of STAG3 mRNA. The effect of these seven miRNAs on +198A>T variation (rs1052482) was examined by a luciferase assay. There was no significant difference in relative luciferase activities between rs1052482A and rs1052482T (), but a substantial decrease in luciferase activity was observed in cells cotransfected with pmir-rs1052482A and miR-3162-5p (mean ± standard deviation [s.d.]: 51.6% ± 2.5%, P = 0.002), compared with control vector pmir-GLO or pmir-rs1052482T (mean ± s.d.: 85.9% ± 3.6%, P = 0.061) (). A sequential decrease was observed in cells cotransfected with pmir-rs1052482A and miR-3162-5p in proportion to the amount of the mimic (rs1052482A [mean ± s.d.], 63.7% ± 1.7%: 45.0% ± 2.7%; rs1052482T [mean ± s.d.], 89.2 ± 5.0%: 78.3% ± 1.4%, respectively), and this reduction was inhibited when the mir-3162-5p inhibitor was cotransfected with pmir-rs1052482A and miR-3162-5p (). The data indicate that miR-3162-5p targets the rs1052482A sequence more efficiently than that of rs1052482T. Relative luciferase activities of pmir-rs1052482A and pmir-rs1052482T in HEK293T cells. a–c represent the mean RLU values ± s.d. of triplicates. (a) No significant differences in relative luciferase activity among three vectors. (b) Luciferase activity was substantially decreased in cells cotransfected with pmir-rs1052482A and miR-3162-5p compared to the cells cotransfected with pmir-control and miR-3162-5p (P < 0.01). (c) A sequential decrease was observed in cells cotransfected with pmir-rs1052482A and miR-3162-5p in proportion to the amount of the mimic and this reduction was rescued when the mir-3162-5p inhibitor was cotransfected with pmir-rs1052482A and miR-3162-5p. -: absence of the indicated one; +: presence of the indicated one; *P < 0.05 (pmir-rs1052482A + mir3162-5p [5 pmol] compared to pmir-rs1052482A); **P < 0.01 (pmir-rs1052482A + mir3162-5p [10 pmol] compared to pmir-rs1052482A). CTL: control; RLU: relative light unit; s.d.: standard deviation.

DISCUSSION

Many autosomal genes such as ring finger protein 212(Rnf212), testis expressed 15(Tex15), syntaxin 2(Stx2), and siah E3 ubiquitin protein ligase 1A(Siah1a)are reported to be crucial factors for the meiotic process and spermatogenesis in mouse studies.25262728 Human homologs of these genes also play a role in meiosis, and variations of these genes are thought to induce spermatogenic impairment.8293031 In recent studies, the homologous deletion of Stag3 has been shown to induce sterility associated with the premature arrest of meiotic prophase I in both male and female mice.1832 Therefore, we have investigated the association between STAG3 gene variations and male infertility. We identified 30 variations in the coding regions and intron boundariesof STAG3 in patients with NOA and in control samples. Of the 30 variations, seven were exonic and three were found only in different infertile patients. For these variations, we evaluated the potential pathogenic effects by three prediction methods, Polyphen-2, SIFT, and Mutation Taster (). Most variations (six of nine) were considered benign and three variations did not show consistent results in the three predictive programs. Minor allele frequencies (MAFs) of these variations were not significantly different between patients and controls, and these MAFs were similar to those of other Asian populations on the NCBI SNP database from the 1000 Genomes Project. Considering these data, the above-mentioned variations are unlikely to be related to the spermatogenic impairment in our Korean male population. Interestingly, two variations, c.3669+35C>G and +198A>T (rs1727130 and rs1052482) located in 3’-UTR, had a significantly different frequency between the patient and control groups. However, there is a discrepancy in this result. According to Yu et al.,33 there is no significant difference in the frequencies of allele and genotype at SNP rs1052482 between patients with NOA and controls and they suggested that this SNP is not associated with azoospermia. Two variants of rs1727130 and rs1052482 are close together (372 bp apart) and tightly linked, as shown in the LD block analysis. The allele distribution of 2 SNVs between the patient and control groups is more evident in the LD block analysis. On the basis of the data, we propose that multiple SNVs linked to a block can interact with each other to regulate gene function, rather than allowing each SNV to function independently. In silico analysis for exonic variations and three variations found only in patients ahttp://genetics.bwh.harvard.edu/pph 2/; bSIFT, http://siftdna.org/; cwww.mutationtaster.org. AA: amino acid; –: no result; SIFT: sorting intolerant from tolerant The presence of SNVs in the 3’-UTR of genes may interfere with mRNA stability and translation through effects on polyadenylation and regulatory protein–mRNA and miRNA–mRNA interactions, or may locally alter secondary structures of mRNAs, affecting the accessibility of binding sites for interacting transelements.343536 We investigated whether rs1052482, the SNV in the 3’-UTRof STAG3, could affect interaction with miRNAs and thus affect posttranscriptional repression of STAG3. When pmir-rs1052482A was cotransfected with miR-3162-5p, a substantial decrease was observed in luciferase activity compared with pmir-rs1052482T. This result suggests that rs1052482 is located within a binding site for miR-3162-5p in the STAG3 3’-UTR, and the minor rs1052482T allele may offset the inhibition by miR-3162-5p. According to Fukuda et al.,1737 STAG3 interacts with the three different α-kleisin subunits present in mammalian meiotic cells, depending on the temporal and spatial distribution. STAG3 combined with meiotic recombination protein (REC8), one of the α-kleisin subunits, and promoted synapsis between homologous chromosomes, while the same complexes inhibited synaptonemal complex assembly between sister chromatids. Therefore, we hypothesize that STAG3 with the rs1052482T variation reduces the normal inhibitory function of mir-3162-5p, thereby increasing the amount of STAG3 protein and ultimately disturbing synapses between homologous chromosomes or sister chromatids. However, it is unclear how elevated STAG3 may affect meiotic chromosome dynamics. In previous studies, mir-3162-5p was identified as a regulator of prostate or cervical antigen in cell carcinomas.383940 However, little is known about mir-3162-5p's regulation of human meiosis, because of the difficulties in uncovering the spatiotemporal and sequential expression of miRNAs in human germ cells, and identifying which miRNAs are the actual operators for the onset of meiosis or spermatogenesis.

CONCLUSION

We have identified 30 SNVs of STAG3 in the Korean population. Pathogenic variations that directly cause NOA were not identified. However, we found that two SNVs, rs1727130 and rs1052482, located in the 3’-UTR region may be associated with the NOA phenotype through the regulation of miRNA. Further studies are needed to determine whether variations in the 3’-UTR region of STAG3 actually affect gene expression through miRNAs, including mir-3162-5p in germ cells. While there is still much to learn about the exact mechanisms regulating human meiosis or spermatogenesis, our findings contribute to the understanding of spermatogenic impairment, as well as the identification of predictive susceptibility biomarkers.

AUTHOR CONTRIBUTIONS

SH Shim conceived and designed the article; SH Shim, YN, and KMK drafted the manuscript; YN, KMK, and SRS designed and performed the experiments; SRS, JEP, and YJS analyzed data and interpreted findings. SH Song collected the samples and performed andrology workup. JTS and TKY prepared the publication. All authors read, edited, and approved the final manuscript.

COMPETING INTERESTS

All authors declared no competing interests. Schematic diagram of luciferase reporter construct and in silico interaction of the potential microRNAs with rs1052482 of STAG3 Seven candidate miRNAs (miR-148a, miR-2909, miR-3162-5p, miR-33a-5p, miR-33b-5p, miR-4739, and miR-6508-3p) that allow rs1052482A or T alleles to be included in the seed sequence. STAG3: stromal antigen 3.
Table 1

Participants’ clinical characteristics

CharacteristicsPatients with spermatogenic impairment (43 oligozoospermia + 77 azoospermia)ControlsP
Patients (n)120245
Age (year), mean±s.d.33.9±3.733.5±2.60.783
Semen volumea (ml), mean±s.d.2.9±1.23.3±1.50.591
Sperm concentrationa (106), mean±s.d.10.0±5.474.9±28.0<0.01
Sperm motilitya (%), mean±s.d.26.8±12.645.7±11.10.013
Sperm morphologya (% normal forms), mean±s.d.2.0±1.36.4±2.1<0.01
Rt. testis volume (ml), mean±s.d.16.0±6.223.0±2.70.020
Lt. testis volume (ml), mean±s.d.17.0±6.223.0±2.70.025
Serum FSH (mIU ml−1), mean±s.d.17.6±10.74.4±1.6<0.01
Serum testosterone (ng ml−1), mean±s.d.4.0±1.13.6±1.50.486
Serum LH (mIU ml−1), mean±s.d.5.5±2.43.9±2.00.106

aData of the azoospermic patients were excluded. s.d.: standard deviation; Rt: right; Lt: left; FSH: follicle-stimulating hormone; LH: luteinizing hormone

Supplementary Table 1

The list of polymerase chain reaction primer and sequencing primer sequences

nRangePCR primer Sequence (5’ 3’)RangeSequencing primer Sequence (5’3’)
P1Exon1 (404bp)FCGCCCAATGGAGTAGGAGATExon1 (404bp)FCGCCCAATGGAGTAGGAGAT
RACCTGTCAGAGCCTGGAAGARACCTGTCAGAGCCTGGAAGA
P2Exon2-Exon5 (7,413bp)FTACCACACCCAGTGTGCAATExon2 (294bp)FGCCCTTTCTTCTCTTTCTTCC
RGGGGGTACCACAGCTACAGARTCCCACGCATATTATCATCAA
Exon3 (394bp)FAAAAAGACTTTGTCCCAACTTCC
RCGGCTCACTGCAAGCTCT
Exon4 (538bp)FGGTTCAGGTGATACGGTTCAT
RTGTTCACGTCAAATCAAGTTTGT
Exon5 (450bp)FTTGTTTACCTCCCAGGGTTG
RAGTGCCCGGCCTAAATAAGT
P3Exon6-Exon8 (7,971bp)FCTTATTGCCATGGCTTCGTTExon6 (297bp)FCCCACCTAAGCTCTTTGCAG
RCCTGTGGCACATTTTGGTAARTTCCTCCTTCTAAAAGCTACCC
Exon7 (365bp)FGCCCCTATGACTTCATGGAC
RAGCCAAGATGCAGGTAGGAA
Exon8 (395bp)FTCATTGCCCTTCTTTCCTTC
RACCCCTTACAGGATGGGTCT
P4Exon9-Exon13 (3,748bp)FTCCGAATAACCACATGCAGAExon9 (330bp)FCGGGGGTTCACACTATCCTA
RGCTCAGCACAACAGGAAACARATTTTTGCTCCAGCTGCATT
Exon10 (433bp)FCCATGAGAGGGAGTTATCTGG
RCTCCCCGTACCTCAGGTTTT
Exon11 (300bp)FAATGAGGGATCGGAGAGG
RGCTGGGATAGCCAAGACATC
Exon12 (399bp)FTCTTGGCTATCCCAGCATCT
RCCCCCTCAACATACTGCAAC
Exon13 (425bp)FTGCAGTATGTTGAGGGGGTA
RGCTGCGAGAAGAAAGGAGAC
P5Exon14-Exon17 (1,893bp)FATCTGCTGCTGCCCTACCTAExon14 (417bp)FTCTCCCTGGTGTCTCCTTTC
RAAGCAGCTGAGAAGCTGGAGRAGGCTGGTCTCAAACTCCTG
Exon15 (352bp)FAATGGAGAAGGATGGGAGTG
RCACCTTCCAACTCCAAGCTC
Exon16 (460bp)FTGCTGGAGAAGGACCAGAGT
RTGCTGGGATTATAGGCGTAA
Exon17 (400bp)FAAATCTCGTGGGAGCTACTGA
RAAGCAGCTGAGAAGCTGGAG
P6Exon18-Exon21 (1,082bp)FGGGGGTGGGAGTAGGAATTAExon18 (248bp)FGGGGGTGGGAGTAGGAATTA
RCTTCCTCGCTTTGTCCACTCRGGAACCCAAGTTCTTAGGAAAAA
Exon19 (387bp)FAATGCTTTTAACCCCGTTCC
RCAATAGCATTTCCCCCAGAA
Exon20~21 (526bp)FAGCAGGAGCTTGAAGAGCTG
RCTTCCTCGCTTTGTCCACTC
P7Exon22-Exon25 (1,237bp)FGAGTGGACAAAGCGAGGAAGExon22~23 (553bp)FGATGCCTCTGAAGAATGTCCA
RTTGGATATCCCCCACCTGTARAAAAGCCTGTAGGGGGAAAA
Exon24~25 (626bp)FGGAGCAACAAGGCGAGTATC
RTTGGATATCCCCCACCTGTA
P8Exon26-Exon29 (1,565bp)FTTATTTTGGGCTTTGCACCTExon26 (344bp)FGGAGTTTGGGAGGGAGACAT
RTACCCACACACAGCACCCTARAAGAATGAAGGAACCTATCACG
Exon27 (371bp)FCAAGGCCTTTGGAATTTCTG
RAAGGCATACCCACCCCTAAC
Exon28~29 (602bp)FGGGTATGCCTTTGGAGACAA
RCCCTGAATGACAGTAGATGCTC
P9Exon30-Exon32 (2,057bp)FAGCCCAGGGGTATGTCTCTTExon30 (427bp)FTAGGGCTATGCCCATTTGAG
RGGAGGATAGGGGGTCATGTTRACAGCAGGGAACCATGAAAC
Exon31 (387bp)FCTCCCACATTGTTGGGTTCT
RTGACAGGAAGTGCTCTGTGG
Exon32 (394bp)FCTCACCCATTGCCTCTCTGT
RTCTAGATTCATTCAGCTTTTCCA
P10Exon33 (307bp)FTTTGCGAAGTGACAGGAGTGExon33 (307bp)FTTTGCGAAGTGACAGGAGTG
RTACACAGGACACAGCAACGGRTACACAGGACACAGCAACGG
P11Exon34 (490bp)FGGGCTTTGAGGGTAACCCAGGGExon34 (490bp)FGGGCTTTGAGGGTAACCCAGGG
RCGATCTCAAGCCACACCTTGGRCGATCTCAAGCCACACCTTGG

PCR: polymerase chain reaction

Supplementary Table 2

miRNA target-site prediction software score

Softwaremirmap.orgTargetScanmicrorna.orgmirdb.org

Relevant score threshold

>90<−0.4<−0.1>60
miR-148a87.6−0.20−0.27
miR-290926.3
miR-3162-5p93.0−0.38
miR-33a-5p7.8
miR-33b-5p8.2
miR-473990.6−0.4055
miR-6508-3p46.7−0.19

miRmap: miRmap score; TargetScan: context ++ score; microrna.org: mirSVR score; mirdb.org: Target Score

Supplementary Table 3

Genotypes and allele distributions of STAG3 gene variations

ndb SNP IDGene LocationSNP functionGenotypeCase (n=120) (%)Control (n=245) (%)OR95% CIP (Fisher)*FDR-p
1rs188290003c.-125C>A5’-UTRCC117 (97.5)239 (97.6)1.000
CA3 (2.5)6 (2.4)1.0210.251–4.1561.0001.000
AA0 (0)0 (0)
A allele361.0210.253–4.1191.0001.000
2rs7457787c.-64-247A>CIntronAA101 (84.2)198 (80.8)1.000
AC19 (15.8)42 (17.1)0.8870.490–1.6040.7670.767
CC0 (0.0)5 (2.0)0.1740.432
C allele19520.7240.418–1.2550.2880.432
3rs12666107c.-64-97G>CIntronGG16 (13.3)37 (15.1)1.000
GC62 (51.7)111 (45.3)1.2920.665–2.5080.5111.000
CC42 (35.0)97 (39.6)1.0010.503–1.9951.0001.000
C allele1463050.9420.686–1.2940.7461.000
4rs11531577c.48G>Tp.Leu16PheGG105 (87.5)218 (89.0)1.000
GT15 (12.5)26 (10.6)1.1980.609–2.3570.7250.867
TT0 (0.0)1 (0.4)
T allele15281.10.576–2.1010.8670.867
5rs2272343c.106A>Cp.Thr36ProAA105 (87.5)218 (89.0)1.000
AC15 (12.5)26 (10.6)1.19780.609–2.3570.7250.867
CC0 (0.0)1 (0.4)
C allele15281.10.576–2.1010.8670.867
6rs6465764c.219+71G>AIntronGG16 (13.3)37 (15.1)1.000
GA62 (51.7)111 (45.3)1.29170.665–2.5080.5111.000
AA42 (35.0)97 (39.6)1.00130.503–1.9951.0001.000
A allele1463050.94210.686–1.2940.7461.000
7rs761620488c.198A>Cp.Lys66AsnAA120 (100.0)244 (99.6)1.000
AC0 (0.0)1 (0.4)
CC0 (0.0)0 (0)
C allele011.0001.000
8rs4729579c.220-64C>GIntronCC16 (13.3)37 (15.1)1.000
CG62 (51.7)111 (45.3)1.2920.665–2.5080.5111.000
GG42 (35.0)97 (39.6)1.0010.503–1.9951.0001.000
G allele1463050.9420.686–11.2940.7461.000
9rs2056726c.220-63G>AIntronGG105 (87.5)218 (89.0)1.000
GA15 (12.5)26 (10.6)1.1980.609–2.3570.7250.867
AA0 (0.0)1 (0.4)
A allele15281.1000.576–2.1010.8670.867
10rs6960458c.337-109G>TIntronGG16 (13.3)37 (15.1)1.000
GT62 (51.7)111 (45.3)1.29170.6651–2.50840.5111.000
TT42 (35)97 (39.6)1.0010.503–1.9951.0001.000
T allele1463050.9420.686–1.2940.7461.000
11rs2272344c.715+180C>TIntronCC16 (13.3)37 (15.1)1.000
CT62 (51.7)111 (45.3)1.2920.665–2.5080.5111.000
TT42 (35.0)97 (39.6)1.0010.503–1.9951.0001.000
T allele1463050.9420.686–1.2940.7461.000
12rs11764176c.716-104G>TIntronGG16 (13.3)37 (15.1)1.000
GT62 (51.7)111 (45.3)1.2920.665–2.5080.5111.000
TT42 (35.0)97 (39.6)1.0010.503–1.9951.0001.000

T allele1463050.9420.686–1.2940.7461.000
13rs200131656c.1035A>Gp.Leu345AA111 (92.5)225 (91.8)1.000
AG9 (7.5)20 (8.2)0.9120.402–2.0691.0001.000
GG0 (0)0 (0)
G allele9200.9160.410–2.0421.0001.000
14rs62482167c.1066-186C>GIntronCC105 (87.5)215 (87.8)1.000
CG15 (12.5)30 (12.2)1.0240.528–1.9851.0001.000
GG0 (0)0 (0)
G allele15301.0220.539–1.9391.0001.000
15rs3823642c.1245-26T>CIntronTT17 (14.2)39 (15.9)1.000
TC50 (41.7)96 (39.2)1.1950.615–2.3220.6210.934
CC53 (44.2)110 (44.9)1.1050.573–2.1330.8680.934
C allele1563161.0230.740–1.4130.9340.934
16rs755877186c.1269C>Tp. Asp423CC119 (99.2)245 (100.0)1.000
CT1 (0.8)0 (0.0)
TT0 (0)0 (0)
T allele100.3290.329
17rs3735241c.1293A>Cp.Pro431AA17 (14.2)38 (15.5)1.000
AC50 (41.7)96 (39.2)1.1950.615–2.3220.6210.934
CC53 (44.2)111 (45.3)1.1050.573–2.1330.8680.934
C allele1563181.0230.740–1.4130.9340.934
18rs2272345c.1573+41C>GIntronCC18 (15.0)41 (16.7)1.000
CG59 (49.2)107 (43.7)1.2560.663–2.3790.5261.000
GG43 (35.8)97 (39.6)1.0100.522–1.9541.0001.000
G allele1453010.9580.699–1.3150.8091.000
19rs13230744c.1678-67A>GIntronAA12 (10.0)35 (14.3)1.000
AG58 (48.3)96 (39.2)1.7620.847–3.6650.1620.485
GG50 (41.7)114 (46.5)1.2790.613–2.6680.5880.882
G allele1583240.9870.713–1.3671.0001.000
20rs117672080c.1678-58A>GIntronAA107 (89.2)221 (90.2)1.000
AG13 (10.8)23 (9.4)1.1670.569–2.3940.7100.860
GG0 (0)1 (0.4)
G allele13251.0650.535–2.1210.8600.860
21rs200967267c.2133-36C>AIntronCC117 (97.5)242 (98.8)1.000
CA3 (2.5)3 (1.2)2.0680.411–10.4050.3990.401
AA0 (0)0 (0)
A allele332.0550.412–10.2580.4010.401
22rs1043915c.2445T>Ap. Ile815TT14 (11.7)39 (15.9)1.000
TA63 (52.5)109 (44.5)1.610.812–3.1940.1890.556
AA43 (35.8)97 (39.6)1.2350.608–2.5080.6000.900
A allele1493031.0110.735–1.3891.0001.000
23rs150085849c.2395-20C>TIntronCC118 (98.3)241 (98.4)1.000
CT2 (1.7)4 (1.6)1.0210.184–5.6551.0001.000
TT0 (0)0 (0)
T allele241.0210.186–5.6141.0001.000
24rs79986079c.2803-206C>TIntronCC106 (88.3)216 (88.2)1.000
CT14 (11.7)28 (11.4)1.0190.515–2.0161.0001.000
TT0 (0.0)1 (0.4)
T allele14300.950.494–1.8271.0001.000
25rs2246713c.3081-38G>CIntronGG52 (43.3)114 (46.5)1.000
GC55 (45.8)106 (43.3)1.1380.717–1.8060.6380.847
CC13 (10.8)25 (10.2)1.1400.541–2.4040.8470.847
C allele811561.0910.786–1.5140.6140.847
26rs1727130c.3669+35C>GIntronCC36 (30.0)101 (41.2)1.000
CG67 (55.8)105 (42.9)1.791.098–2.9180.0210.063
GG17 (14.2)39 (15.9)1.2230.617–2.4260.5960.596

G allele1011831.2190.890–1.6700.2260.339
27rs188384958+112G>A3’-UTRGG119 (99.2)245 (100.0)1.000
GA1 (0.8)0 (0.0)0.3290.329
AA0 (0)0 (0)
A allele100.3290.329
28rs1052482+198A>T3’-UTRAA36 (30.0)101 (41.2)1.000
AT67 (55.8)105 (42.9)1.791.098–2.9180.0210.063
TT17 (14.2)39 (15.9)1.2230.617–2.4260.5960.596
T allele1011831.2190.890–1.6700.2260.339
29rs1727131+315C>T3’-UTRCC119 (99.2)245 (100.0)1.000
CT1 (0.8)0 (0.0)0.3290.329
TT0 (0)0 (0)
T allele100.3290.329
30rs12056000+370G>A3’-UTRGG105 (87.5)216 (88.2)1.000
GA13 (10.8)18 (7.3)1.4860.701–3.1470.3220.483
AA2 (1.7)11 (4.5)0.3740.081–1.7180.2380.483
A allele17400.8580.476–1.5470.6620.662

STAG3: stromal antigen 3; SNPs: single-nucleotide polymorphism; NOA: nonobstructive azoospermia; OR: odds ratio; CI: confidence interval; FDR-P: false discovery rate-adjusted P value; –: 0, NaN (not a number) or infinity

Table 2

Haplotype analysis between the SNPs of STAG3 and nonobstructive azoospermia

db SNP IDHaplotypeFrequencyOR (95% CI)P (Fisher)FDR-P

CaseControl
rs12666107 rs11531577 rs2272343 rs6465764 rs4729579 rs2056726 rs6960458 rs2272344 rs11764176Block 1
 CGAAGGTTT0.6080.6220.1360.7120.812
 GGAGCGGCG0.3290.3200.0560.8120.812
 GTCGCAGCG0.0620.0570.0830.7730.812
rs62482167 rs3823642 rs3735241Block 2
 CCC0.6500.6450.0180.8920.949
 CTA0.2870.2900.0040.9490.949
 GTA0.0620.0610.0050.9460.949
rs2272345rs13230744Block 3
 GG0.5950.6040.0470.8290.900
 CA0.3330.3280.0160.9000.900
 CG0.0630.0580.0860.7690.900
 GA0.0090.0110.0500.8230.900
rs1043915rs79986079Block 4
 AC0.6210.6180.0040.9490.991
 TC0.3210.3200.0000.9910.991
 TT0.0580.0610.2640.8780.991
rs2246713rs1727130rs1052482Block 5
 GCA0.5040.6066.8170.0090.012
 CGT0.2590.3001.3560.2440.244
 GGT0.1620.07513.0280.00030.001
 CCA0.0750.01814.4600.00010.0004

STAG3: stromal antigen 3; SNPs: single-nucleotide polymorphism; NOA: nonobstructive azoospermia; OR: odds ratio; CI: confidence interval; FDR-P: false discovery rate-adjusted P value

Table 3

The genotype distributions of STAG3 rs2246713, rs1727130, and rs1052482 in the cases and the controls

SNPsModelGenotypeCase, n (%)Control, n (%)P (Fisher)OR95% CIFDR-P
rs2246713CodominantGG52 (43.3)114 (46.5)
GC55 (45.9)106 (43.3)0.6381.1380.717–1.8060.638
CC13 (10.8)25 (10.2)0.8471.1400.541–2.4040.847
DominantGG52 (43.3)114 (46.5)
GC + CC68 (56.7)131 (53.5)0.5780.8790.566–1.3640.578
RecessiveCC13 (10.8)25 (10.2)
GC + GG107 (89.2)220 (89.8)0.8571.0690.526–2.1720.857
rs1727130CodominantCC36 (30.0)101 (41.2)
CG67 (55.8)105 (42.9)0.0211.7901.098–2.9180.032
GG17 (14.2)39 (15.9)0.5961.2230.617–2.4260.847
DominantCC36 (30.0)101 (41.2)
CG + GG84 (70.0)144 (58.8)0.0391.6371.030–2.6080.059
RecessiveGG17 (14.2)39 (15.9)
CG + CC103 (85.8)206 (84.1)0.7580.8720.471–1.6150.857
rs1052482CodominantAA36 (30.0)101 (41.2)
AT67 (55.8)105 (42.9)0.0211.791.098–2.9180.032
TT17 (14.2)39 (15.9)0.5961.2230.617–2.4260.847
DominantAA36 (30.0)101 (41.2)
AT + TT84 (70.0)144 (58.8)0.0391.6371.030–2.6080.059
RecessiveTT17 (14.2)39 (15.9)
AT + AA103 (85.8)206 (84.1)0.7580.8720.471–1.6150.857

STAG3: stromal antigen 3; SNPs: single-nucleotide polymorphism; OR: odds ratio; CI: confidence interval; FDR-P: false discovery rate-adjusted P value

Table 4

In silico analysis for exonic variations and three variations found only in patients

ndb SNP IDGene locationAA changeIn silico variant analysis

PolyPhen-2aSIFTbMutation Tasterc
1rs11531577c.48G>Tp.Leu16PheBenign (1.00/0.00)Not toleratedPolymorphism
2rs2272343c.106A>Cp.Thr36ProBenign (1.00/0.00)Not toleratedPolymorphism
3rs761620488c.198A>Cp.Lys66AsnBenign (0.98/0.44)ToleratedPolymorphism
4rs200131656c.1035A>Gp.Leu345ToleratedDisease causing
5rs755877186c.1269C>Tp.Asp423ToleratedPolymorphism
6rs3735241c.1293A>Cp.Pro431ToleratedPolymorphism
7rs1043915c.2445T>Ap.Ile815ToleratedPolymorphism
8rs188384958+112G>A3’-UTRPolymorphism
9rs1727131+315C>T3’-UTRPolymorphism

ahttp://genetics.bwh.harvard.edu/pph 2/; bSIFT, http://siftdna.org/; cwww.mutationtaster.org. AA: amino acid; –: no result; SIFT: sorting intolerant from tolerant

  40 in total

1.  The structure of haplotype blocks in the human genome.

Authors:  Stacey B Gabriel; Stephen F Schaffner; Huy Nguyen; Jamie M Moore; Jessica Roy; Brendan Blumenstiel; John Higgins; Matthew DeFelice; Amy Lochner; Maura Faggart; Shau Neen Liu-Cordero; Charles Rotimi; Adebowale Adeyemo; Richard Cooper; Ryk Ward; Eric S Lander; Mark J Daly; David Altshuler
Journal:  Science       Date:  2002-05-23       Impact factor: 47.728

2.  Sequence variants in the RNF212 gene associate with genome-wide recombination rate.

Authors:  Augustine Kong; Gudmar Thorleifsson; Hreinn Stefansson; Gisli Masson; Agnar Helgason; Daniel F Gudbjartsson; Gudrun M Jonsdottir; Sigurjon A Gudjonsson; Sverrir Sverrisson; Theodora Thorlacius; Aslaug Jonasdottir; Gudmundur A Hardarson; Stefan T Palsson; Michael L Frigge; Jeffrey R Gulcher; Unnur Thorsteinsdottir; Kari Stefansson
Journal:  Science       Date:  2008-01-31       Impact factor: 47.728

Review 3.  MicroRNA: key gene expression regulators.

Authors:  Juan Manuel Moreno-Moya; Felipe Vilella; Carlos Simón
Journal:  Fertil Steril       Date:  2013-12-05       Impact factor: 7.329

4.  Abnormal progression through meiosis in men with nonobstructive azoospermia.

Authors:  Fei Sun; Paul Turek; Calvin Greene; Evelyn Ko; Alfred Rademaker; Renée H Martin
Journal:  Fertil Steril       Date:  2006-11-29       Impact factor: 7.329

5.  Evaluation of the Stag3 gene and the synaptonemal complex in a rat model (as/as) for male infertility.

Authors:  M Bayés; I Prieto; J Noguchi; J L Barbero; L A Pérez Jurado
Journal:  Mol Reprod Dev       Date:  2001-11       Impact factor: 2.609

6.  Whole-exome sequencing identifies a homozygous donor splice-site mutation in STAG3 that causes primary ovarian insufficiency.

Authors:  W-B He; S Banerjee; L-L Meng; J Du; F Gong; H Huang; X-X Zhang; Y-Y Wang; G-X Lu; G Lin; Y-Q Tan
Journal:  Clin Genet       Date:  2017-08-17       Impact factor: 4.438

7.  t-SNARE Syntaxin2 (STX2) is implicated in intracellular transport of sulfoglycolipids during meiotic prophase in mouse spermatogenesis.

Authors:  Yasuhiro Fujiwara; Narumi Ogonuki; Kimiko Inoue; Atsuo Ogura; Mary Ann Handel; Junko Noguchi; Tetsuo Kunieda
Journal:  Biol Reprod       Date:  2013-06-06       Impact factor: 4.285

8.  Baseline expression profile of meiotic-specific genes in healthy fertile males.

Authors:  Carme Nogués; Cristina Fernández; Osvaldo Rajmil; Cristina Templado
Journal:  Fertil Steril       Date:  2008-08-15       Impact factor: 7.329

9.  Mutant cohesin in premature ovarian failure.

Authors:  Sandrine Caburet; Valerie A Arboleda; Elena Llano; Paul A Overbeek; Jose Luis Barbero; Kazuhiro Oka; Wilbur Harrison; Daniel Vaiman; Ziva Ben-Neriah; Ignacio García-Tuñón; Marc Fellous; Alberto M Pendás; Reiner A Veitia; Eric Vilain
Journal:  N Engl J Med       Date:  2014-03-06       Impact factor: 91.245

10.  Serum microRNA expression levels can predict lymph node metastasis in patients with early-stage cervical squamous cell carcinoma.

Authors:  Junying Chen; Desheng Yao; Yue Li; Hong Chen; Chanjuan He; Nan Ding; Yan Lu; Tingyu Ou; Shan Zhao; Li Li; Fengyi Long
Journal:  Int J Mol Med       Date:  2013-06-21       Impact factor: 4.101

View more
  3 in total

1.  Analysis of STAG3 variants in Chinese non-obstructive azoospermia patients with germ cell maturation arrest.

Authors:  Wen Liu; Xuan Gao; Haobo Zhang; Ran Liu; Yongzhi Cao; Ruimei Yu; Ge Fang; Jinlong Ma; Shidou Zhao
Journal:  Sci Rep       Date:  2021-05-12       Impact factor: 4.379

Review 2.  The gene regulatory role of non-coding RNAs in non-obstructive azoospermia.

Authors:  Guanqing Zhou; Mimi Zhang; Jingzhi Zhang; Yaofeng Feng; Zhishen Xie; Siyi Liu; Detu Zhu; Yumei Luo
Journal:  Front Endocrinol (Lausanne)       Date:  2022-08-18       Impact factor: 6.055

Review 3.  Genetic Landscape of Nonobstructive Azoospermia and New Perspectives for the Clinic.

Authors:  Miriam Cerván-Martín; José A Castilla; Rogelio J Palomino-Morales; F David Carmona
Journal:  J Clin Med       Date:  2020-01-21       Impact factor: 4.241

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.