Literature DB >> 33854524

EZH2-Mediated microRNA-375 Upregulation Promotes Progression of Breast Cancer via the Inhibition of FOXO1 and the p53 Signaling Pathway.

Xin Guan1, Aiping Shi1, Yabin Zou2, Meiyang Sun3, Yue Zhan1, Yi Dong3, Zhimin Fan1.   

Abstract

Breast cancer (BC) is the most common gynecologic tumor worldwide where aberrant expression of microRNAs (miRNAs) is frequently involved. Here, we evaluated the function of miR-375 on BC development and the molecules implicated. Differentially expressed genes between tumor and paired normal tissues from BC patients were screened out by microarray analyses. miR-375 was abundantly expressed in BC tissues and cells, and it was correlated with the poor prognosis of patients. Downregulation of miR-375 was introduced into BC cell lines MCF-7 and HCC1954, after which the viability, colony formation, migration, and invasion were suppressed, while the apoptosis of cells was increased, and the xenograft tumors in nude mice were reduced as well. EZH2 increased methylation and phosphorylation of signal transducer and activator of transcription 3 (STAT3) and increased transcription activity of miR-375, while miR-375 directly targeted FOXO1. Either overexpression of EZH2 or downregulation of FOXO1 blocked the functions of anti-miR-375 in cells and animals. FOXO1 was found as an activator of the p53 signaling pathway. This study showed that miR-375 is an important oncogene in BC. EZH2 is an upstream regulator of miR-375 through mediating the methylation of STAT3, while FOXO1 is a downstream target mRNA of miR-375 that activates the p53 signaling pathway to suppress BC development.
Copyright © 2021 Guan, Shi, Zou, Sun, Zhan, Dong and Fan.

Entities:  

Keywords:  breast cancer; enhancer of zeste homologue 2; forkhead box protein O1; miR-375; p53

Year:  2021        PMID: 33854524      PMCID: PMC8041054          DOI: 10.3389/fgene.2021.633756

Source DB:  PubMed          Journal:  Front Genet        ISSN: 1664-8021            Impact factor:   4.599


Introduction

Breast cancer (BC) is the most common gynecologic tumor (one in four cancer cases among women) and a major contributor to cancer death across the globe (Bray et al., 2018). It is attributed to the progressive accumulation of mutations that leads to the aberrant development of breast tissue cells (Mendes et al., 2018). BC is a heterogeneous disease implicating various clinical presentations and typical tumor characteristics (Perez-Garcia et al., 2018). According to the expression of Ki-67, human epidermal growth factor 2 (HER2), and hormone receptors (estrogen receptor and progesterone receptor), BC can be allocated into four subtypes: Luminal A, Luminal B, HER2-positive, and triple-negative subtypes (Inic et al., 2014). The mortality rate of BC has steadily declined during the past few decades, and a prompt diagnosis is vital for a better outcome (Cronin et al., 2018). In addition, exploring novel therapeutic options for BC control is still of great significance, which requires more understanding in the molecular mechanisms implicated in disease progression. A cancer cell is a final consequence of a complicated mixture of genetic and epigenetic changes, whose final interplay results in cancer onset and progression (Yen et al., 2016). Here, our integrated bioinformatic analyses suggested that p53 was a largely dysregulated signaling pathway in BC tissues. The p53 is a well-established tumor suppressor with important roles in response to DNA damage and oncogenic signaling, and its dysfunction is a common cause for cancer development (Ning et al., 2019). Activation of p53 signaling has been implicated to suppress the growth of BC as well (Zhang et al., 2019b). MicroRNAs (miRNAs), well-known for their primary function in mediating gene expression through direct binding to the target mRNAs, are the most studied non-coding RNAs whose aberrant expression is frequently involved in cancer development (Harrandah et al., 2018). In this study, miR-375, with high activity on the p53 signaling pathway, was screened to be significantly upregulated in tumor tissues from BC patients. miR-375 was suggested as either an oncogene (Shi et al., 2017) or a tumor suppressor (Shi et al., 2020), depending on the specific gene targets in different cancer types, yet its role in BC remains controversial. In addition, the subsequent bioinformatic analyses suggested that forkhead box protein O1 (FOXO1), a downregulated gene in BC, was a putative target gene of miR-375. Downregulation of FOXO1 regulated by miRNAs has been implicated in many human malignancies including BC (Liu et al., 2017; Zhang et al., 2019a). We therefore surmised that miR-375 possibly suppresses FOXO1 to affect BC development. Interestingly, enhancer of zeste homologue 2 (EZH2) was predicted as an upregulated gene in BC tissues and the only enriched epigenetic regulator on the p53 signaling pathway. EZH2 is a histone methyltransferase that catalyzes the tri-methylation of histone H3 at lys 27 (H3K27me3) to suppress gene expression through an epigenetic mechanism (Yan et al., 2017). In addition, EZH2 has been reported to mediate methylation of other substrates other than H3K27 including potential non-histone proteins (Xu et al., 2012). EZH2 is frequently abundantly expressed in human cancers and plays oncogenic roles, therefore serving as a potential target for anti-cancer treatments (Yamagishi and Uchimaru, 2017). Taken together, we hypothesized that there might be interactions among EZH2, miR-375, FOXO1, and p53, and this axis may play important roles in BC development.

Materials And Methods

Sample Collection

From June 2015 to January 2017, 51 patients with primary BC in the First Hospital of Jilin University were enrolled in this study. This research was performed in accordance with the Declaration of Helsinki and approved by the Ethics Committee of the First Hospital of Jilin University. Signed informed consent was obtained from each eligible respondent. All patients did not have any other chronic diseases or malignancy and were free of a history of chemotherapy or radiotherapy treatments before enrollment. The tumor and para-cancerous tissues (>5 cm) were collected during surgery and immediately preserved in liquid nitrogen. The clinical details of patients are listed in Table 1.
Table 1

Baseline characteristics of patients with BC.

CharacteristicsNumber of cases
Age (mean ± SD)49 ± 13.48
Lymph node metastasis
Positive28
Without23
Molecular subtypes
Luminal A16
Luminal B21
HER2-enriched9
Triple-negative5

BC, breast cancer; mean ± SD, mean ± standard deviation.

Baseline characteristics of patients with BC. BC, breast cancer; mean ± SD, mean ± standard deviation.

Microarray Analysis

Total RNA from BC tissues was extracted by TRIzol Reagent (Thermo Fisher Scientific Inc., Waltham, MA, United States) and purified using an miRNeasy kit (Qiagen, GmbH, Hilden, Germany). The RNA integrity was examined by electrophoresis, and the RNA concentration was determined by ultraviolet spectrophotometry. Then, the RNA was reversely transcribed into cDNA using a SuperScript™ III reverse transcriptase (Invitrogen, Thermo Fisher), which was further hybridized with the Affymetrix Human Genome 2.0 array (Affymetrix Inc., Santa Clara, CA, United States). The mixture (200 μl) containing 15 μg of cDNA was loaded on the array chip, which was hybridized at 45°C for 16 h and then scanned and analyzed using an Affymetrix GeneChip Scanner. The differentially expressed genes were screened out with |Log2FoldChange| > 2 and p < 0.01 as the thresholds.

Bioinformatics Analyses

The result of microarray analysis was obtained using the heatmap program (gplots) of an R Language Package (R version 3.6.3, R). The pathways of miRNA targeting genes were predicted on the mirPATH v.3 System. A Gene Ontology (GO) enrichment analysis of aberrantly activated pathways was performed. The promoter sequence of miR-375 was obtained from the UCSC Genome Browser. The putative binding site between STAT3 and the miR-375 promoter was obtained from ALGGEN. Putative binding site between miR-375 and FOXO1 was obtained on StarBase.

Cell Culture and Treatment

Human BC cell lines (MCF-7, HCC1954, and MDA-MB-231) and a non-tumorigenic cell line (MCF10A) were acquired from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cells were cultivated in Roswell Park Memorial Institute (RPMI)-1640 containing 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin (all from Gibco, Thermo Fisher) at 37°C with 5% CO2. The anti-miR-375, overexpression vector of EZH2 (EZH2-OE), small interfering (si)RNA of STAT3 (si-STAT3), si-FOXO1, and the negative control (NC) were purchased from GenePharma Co., Ltd. (Shanghai, China) and transfected into the vectors using the X-tremeGENE Regent (Roche Ltd., Basel, Switzerland), while the vectors were transfected into cells using a Lipofectamine™ 2000 kit (Invitrogen, Thermo Fisher) as per the kit’s instructions (Thermo Fisher).

Reverse Transcription Quantitative Polymerase Chain Reaction for RNA Quantification

Again, total RNA was extracted using the TRIzol Reagent and purified. The RNA quality was examined using an Agilent 2100 Biological analyzer (Agilent Technologies, Palo Alto, CA, United States) and a NanoDrop 1000 spectrophotometer (Thermo Fisher). Relative miRNA and mRNA expression was determined by qPCR using the TaqMan Fast Advanced Master Mix (Thermo Fisher) with a reaction system volume of 20 μl. The specific primers were purchased from Applied Biosystems (Thermo Fisher) and presented in Table 2, where U6 and GAPDH were used as internal references.
Table 2

Primer sequences for RT-qPCR.

ItemsPrimer sequence (5'-3')
EZH2F: CCCTGACCTCTGTCTTACTTGTGGA
R: ACGTCAGATGGTGCCAGCAATA
miR-375F: CTTACTATCCGTTTGTTCGTTCG
R: TATGGTTGTTCTCGTCTCTGTGTC
FOXO1F: TCGTGAAATGGAAGGGATGG
R: AGGTTTTGGGCTTGGGTC
ChIPF: GCCAAAGGTCCTTGAAT
R: GCAAAGGTCCTTGGAT
GAPDHF: GCACCGTCAAGGCTGAGAAC
R: TGGTGAAGACGCCAGTGGA
U6F: GCTTCGGCAGCACATATACTAAAAT
R: CGCTTCACGAATTTGCGTGTCAT

RT-qPCR, reverse transcription-quantitative polymerase chain reaction; EZH2, enhancer of zeste homologue 2; FOXO1, forkhead box protein O1; ChIP, chromatin immunoprecipitation; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Primer sequences for RT-qPCR. RT-qPCR, reverse transcription-quantitative polymerase chain reaction; EZH2, enhancer of zeste homologue 2; FOXO1, forkhead box protein O1; ChIP, chromatin immunoprecipitation; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Cell Counting Kit-8 (CCK-8) Method

A CCK-8 kit (Dojindo Laboratories, Kumamoto, Japan) was used to detect cell proliferation in accordance with the kit’s instructions. In brief, the transfected cells were seeded into 96-well plates at 3 × 103 cells per well and cultured at 37°C with 5% CO2 for 96 h. After that, each well was further loaded with 10 μl of CCL-8 solution for another 1 h of incubation. Then, the optical density (OD) value at 450 nm was determined using a spectrophotometer (BioTek, United States).

Colony Formation Assay

A total of 1 × 103 transfected MCF-7 and MDA-MB-231 cells were sorted in a culture dish precoated with 0.6% agar containing 20% FBS-supplemented medium. The cells were cultured at 37°C with 5% CO2 for 14 d and then stained with 0.04% crystal violet for 40 min. The number of colonies formed in each culture dish was recorded.

Transwell Assays

Aggressiveness (migration and invasion) of cells was examined by Transwell assays. For migration detection, 5 × 104 transfected cells were sorted in the apical chambers of the 24-well Transwell plates. The apical chambers were filled with 200 μl of Dulbecco’s modified Eagle’s medium (DMEM) containing 0.1% bovine serum albumin (BSA), and the basolateral cells were filled with 600 μl of 10% FBS-DMEM. The plates were placed in a 37°C incubator for 16 h, and then the migrated cells in basolateral chambers were fixed and stained for 10 min. Invasion of cells was determined in a similar manner with an additional 50 μl of Matrigel (Sigma-Aldrich Chemical Company St Louis, MO, United States) precoating in the apical chambers. The number of migrated or invaded cells were observed under a microscope (CX31-LV320, Olympus Optical Co., Ltd., Tokyo, Japan) with five random fields included.

Flow Cytometry

An Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) double staining kit (Beyotime, Biotechnology Co. Ltd., Shanghai, China) was utilized to measure cell apoptosis. In brief, the 1× binding buffer was prepared. Transfected cells were centrifuged at 1200 rpm for 5 min and then resuspended in cold phosphate-buffered saline (PBS). Cells were then stained with 5 μl of FITC at room temperature for 15 min and further with 5 μl of PI for 5 min. Then the staining of cells was determined on a BD FACScalibur flow cytometer (BD Biosciences, San Jose, CA, United States).

Xenograft Tumor Models

Thirty-six Sprague-Dawley nude mice (4–5 weeks old, 14 ± 2 g) acquired from SLAC Laboratory Animal Co., Ltd. (Shanghai, China) were fed at 22°C with ad libitum access to food and water. After a week of acclimation, the animals were assigned into 12 groups, three in each. Cells (1 × 107) with stable transfection were implanted into each mouse through subcutaneous injection at the armpit. Then, the volume (V) of tumors in mice was calculated and recorded every week, which was determined as follows: V = L × W2/2, where “L” indicates the length and “W” refers to the width. Four weeks later, the mice were euthanized by intraperitoneal injection of 1% pentobarbital sodium (150 mg/kg), and the xenograft tumors were collected and weighed. Animal experimental protocol was performed in line with the Guidelines for Animal Care and Use issued by the National Institutes of Health (Bethesda, Maryland, United States) and approved by the Committee on the Ethics of Animal Experiments of the First Hospital of Jilin University.

Immunohistochemical Staining

The collected tumor tissue samples from mice were routinely dehydrated, embedded, sectioned, dewaxed, and rehydrated. Then, the sections were treated with 3% H2O2 at room temperature for 15 min, and further treated with normal goat serum blocking solution for 15 min. Then, the sections were incubated with 50 μl of primary antibody against Ki67 (1:500, ab197234, Abcam Inc., Cambridge, MA, United States) at 4°C overnight and then with the secondary antibody (1:500, ab199091, Abcam) at 37°C for 15 min. Thereafter, the sections were incubated with 40 μl of horseradish peroxidase (HRP)-labeled streptavidin-working solution at 37°C for 15 min for color development by 3,3′-diaminobenzidine. Next, the sections were counterstained by hematoxylin for 30 min and mounted. The positive staining of Ki67 (stained in yellow or brown) in each section was observed under the microscope with five non-overlapping fields included.

Co-immunoprecipitation (Co-IP)

After 48 h, the cells were lysed in cell lysis buffer (Solarbio Science & Technology Co., Ltd., Beijing, China) on ice for 30 min and then centrifuged at 3000 rpm at 4°C for 30 min. Then, a part of lysates was collected for Western blot analysis, and the remaining lysates were incubated with primary antibody at 4°C overnight. After that, 10 μl of protein A agarose beads were washed with lysis buffer and centrifuged at 3000 rpm for 3 min. The pre-treated protein A agarose beads were added into the cell lysates and incubated with the antibody at 4°C for 4 h to conjugate the antibody with the agarose beads. After immunoprecipitation, the samples were centrifuged at 3000 rpm at 4°C for 3 min to precipitate the agarose beads. Thereafter, 15 μl of 2× sodium dodecyl sulfate (SDS) loading buffer and the protein level in the precipitates were examined by Western blot analysis.

Chromatin Immunoprecipitation Assay

Cells were cultivated in 15-cm culture dishes at 37°C with 5% CO2 until an 80% cell confluence was reached. A SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology, United States) was applied as per the kit’s instructions. Each culture dish with 20 ml of medium was further loaded with 540 μl of 37% methanol for a 10-min incubation, followed by further incubation with 2 ml of 10× glycine for 5 min. Then, the cells were centrifuged at 500 g at 4°C for 5 min to discard the supernatant. Next, 100 μl of nuclease-free water, 6 μl of NaCl (5 M), and 2 μl of RNAse were added into 50 μl of chromatin samples for a 30-min incubation, followed by further incubation with 2 μl of Proteinase K at 65°C for 2 h. Purified DNA samples were collected, and the chromatin samples were diluted in 1× ChIP buffer and co-incubated with 30 μl of Protein G magnetic beads at 4°C for 2 h. The precipitated Protein G magnetic beads were collected and washed, and the chromatin was eluted from the magnetic beads for decrosslinking. The DNA was purified, and the immunoprecipitated DNA level was calculated using a SYBR Green PCR Master Mix and normalized to input DNA.

Dual-Luciferase Reporter Gene Assay

The wild-type (WT) 3’UTR of FOXO1 containing a putative binding site with miR-375 was inserted into the firefly luciferase reporter gene (Thermo Fisher) vectors to construct pmirGLO-FOXO1-WT, and the corresponding mutant-type (MT) reporter was designed to construct the pmirGLO-FOXO1-MT vector. Well-constructed vectors were co-transfected with the anti-miR-375 inhibitor or the NC into HEK293T cells. After 48 h, the cells were lysed, and the luciferase activity was determined using a Dual Luciferase Assay System (Promega Corp., Madison, Wisconsin, United States).

Western Blot Analysis

Cells were washed in PBS and lysed in mammalian protein extraction reagent (Thermo Fisher) to collect total protein. The protein concentration was determined using a Pierce™ BCA Protein Assay Kit (Thermo Fisher). Then, an equal volume of protein samples (30 μg) was separated on SDS-polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore Corp., Billerica, MA, United States). The membranes were blocked in 5% BSA for 1 h and then incubated with the primary antibodies against FOXO1 (18592-1-AP, 1:800, Proteintech Group, Chicago, IL, United States), p53 (ab26, 1:1000, Abcam), and GAPDH (ab8245, 1:5000, Abcam) at 4°C overnight and further incubated with the HRP-labeled secondary antibody (ab205719, 1:5000, Abcam) at room temperature for 1 h. The protein blots were developed using Western Lightning Plus-ECL (PerkinElmer Inc., Boston, MA, United States), and relative protein expression was determined using the LAS-3000 (FUJIFILM).

Statistical Analysis

Measurement data were obtained from three independent experiments and exhibited as mean ± standard deviation (SD). Data were compared by the t test (two groups) and one-way or two-way analysis of variance (ANOVA; over two groups). The correlation between variables was determined by Spearman’s correlation analysis. The survival of patients was recorded by Kaplan-Meier analysis. Tukey’s multiple comparison’s test was used for the post hoc test, while the post statistical analysis was performed by a log rank test. SPSS 22.0 (IBM, Chicago, IL, United States) was used for data analysis. p < 0.05 represents significant difference.

Results

miR-375 Is a Possible Prognostic Biomarker of BC

A miRNA microarray analysis suggested that nine miRNAs were differentially expressed between tumor and normal tissues from BC patients, among which seven were upregulated while two were downregulated (Figure 1A). A pathway and gene cluster analysis was performed based on the target genes of the differentially expressed miRNAs, and a heatmap was produced (Figure 1B), which suggested that p53 signaling showed a high activity, while miR-375 was significantly overexpressed in this pathway compared to other genes or in other pathways. Therefore, miR-375 was selected as the subject of this study. First, the RT-qPCR results suggested that miR-375 expression was notably increased in tumor tissues compared to the adjacent tissues from BC patients (Figure 1C). Lymph node metastasis (LNM) is an important prognostic indicator of BC. Here, we analyzed the correlation between miR-375 expression and LNM in BC patients. The cancer tissues were allocated into LNM-positive and LNM-negative ones. It was found that miR-375 expression was higher in LNM-positive tissues than that in the LNM-negative tissues (Figure 1D). Since BC is a highly heterogeneous malignancy, we therefore investigated the correlation between miR-375 expression and the BC subtypes. According to the Ki-67, HER2, and hormone receptor expression, the BC was allocated into four subtypes: Luminal A, Luminal B, HER2-positive, and triple-negative subtypes. Consequently, it was found that miR-375 expression was increased in all subtypes (Figure 1E). Although the sample size of some subgroups (such as triple-negative) was too small to present a significant difference, it can be concluded that miR-375 is commonly highly expressed in BC regardless of the specific subtypes. According to a three-year follow-up study, patients with relatively higher miR-375 expression had a poorer survival rate and less survival time, namely, a worse prognosis (Figure 1F). In addition, the miR-375 expression in estrogen receptor-positive cell line MCF-7, HER-2-positive HCC1954, and triple-negative MDA-MB-231 was detected. The RT-qPCR results showed that the expression of miR-375 was notably increased in all BC cell lines compared to that in normal MCF10A cells (Figure 1G), while the highest expression of miR-375 was found in MCF-7 cells.
Figure 1

miR-375 is a possible prognostic biomarker of BC. (A) Differentially expressed miRNAs between cancer and normal tissues from BC patients screened out by a miRNA microarray analysis; (B) gene and pathway cluster analysis based on the target genes of the differentially expressed miRNAs; (C) miR-375 expression in cancer and normal tissues determined by RT-qPCR (* p < 0.05, paired t test); (D) miR-375 expression in LNM-positive cancer tissues and LNM-normal ones determined by RT-qPCR (* p < 0.05, one-way ANOVA); (E) miR-375 expression in different BC subtypes examined by RT-qPCR (* p < 0.05, one-way ANOVA); (F) survival rate of patients according to the follow-up study; (G) miR-375 expression in BC cells (MCF-7, HCC1954, and MDA-MB-231) and in normal MCF10A cells detected by RT-qPCR (* p < 0.05, one-way ANOVA). Data were presented as mean ± SD from three independent experiments.

miR-375 is a possible prognostic biomarker of BC. (A) Differentially expressed miRNAs between cancer and normal tissues from BC patients screened out by a miRNA microarray analysis; (B) gene and pathway cluster analysis based on the target genes of the differentially expressed miRNAs; (C) miR-375 expression in cancer and normal tissues determined by RT-qPCR (* p < 0.05, paired t test); (D) miR-375 expression in LNM-positive cancer tissues and LNM-normal ones determined by RT-qPCR (* p < 0.05, one-way ANOVA); (E) miR-375 expression in different BC subtypes examined by RT-qPCR (* p < 0.05, one-way ANOVA); (F) survival rate of patients according to the follow-up study; (G) miR-375 expression in BC cells (MCF-7, HCC1954, and MDA-MB-231) and in normal MCF10A cells detected by RT-qPCR (* p < 0.05, one-way ANOVA). Data were presented as mean ± SD from three independent experiments.

Anti-miR-375 Suppresses Activity of BC Cells

To further explore the functions of miR-375 in BC cells, downregulation of miR-375 was introduced into MCF-7 and HCC1954 cells through administration of anti-miR-375. The transfection efficacy was validated through RT-qPCR (Figure 2A). Then, we determined the viability of cells through the CCK-8 method, which suggested that the OD value of each well, namely the cell viability, was reduced after miR-375 downregulation (Figure 2B). Likewise, the colony formation assay suggested that the proliferation of cells, reflected by the number of colonies newly formed in a given time, was reduced as well (Figure 2C). In addition, the Transwell assays suggested that after miR-375 inhibition, the number of migrated (Figure 2D) and invaded (Figure 2E) cells in the basolateral cells was notably decreased, while the flow cytometry results showed that the number of Annexin V-FITC/PI double-positive cells was increased, indicating an increased apoptosis rate of both cells (Figure 2F).
Figure 2

Anti-miR-375 suppresses activity of BC cells. (A) Transfection efficacy of anti-miR-375 in MCF-7 and HCC1954 cells examined by RT-qPCR (* p < 0.05, two-way ANOVA); (B) viability of cells determined by the CCK-8 method (* p < 0.05, two-way ANOVA); (C) colony formation ability of cells determined by the colony formation assay (* p < 0.05, two-way ANOVA); (D,E) migration (D) and invasion (E) abilities of cells measured by the Transwell assays (* p < 0.05, two-way ANOVA); (F) apoptosis of cells determined by flow cytometry (* p < 0.05, two-way ANOVA). Data were presented as mean ± SD from three independent experiments.

Anti-miR-375 suppresses activity of BC cells. (A) Transfection efficacy of anti-miR-375 in MCF-7 and HCC1954 cells examined by RT-qPCR (* p < 0.05, two-way ANOVA); (B) viability of cells determined by the CCK-8 method (* p < 0.05, two-way ANOVA); (C) colony formation ability of cells determined by the colony formation assay (* p < 0.05, two-way ANOVA); (D,E) migration (D) and invasion (E) abilities of cells measured by the Transwell assays (* p < 0.05, two-way ANOVA); (F) apoptosis of cells determined by flow cytometry (* p < 0.05, two-way ANOVA). Data were presented as mean ± SD from three independent experiments.

Anti-miR-375 Suppresses Growth of Xenograft Tumors in vivo

Following the findings above, we further explored the function of miR-375 in vivo. MCF-7 and HCC1954 cells with stable transfection of anti-miR-375 or NC were implanted into mice, after which we found the weekly growth of xenograft tumors in mice was significantly slowed down upon miR-375 inhibition (Figure 3A). On the 28th day, the mice were euthanized and the tumor tissues were collected and weighed. It was found that the weight of xenograft tumors was reduced as well when miR-375 was suppressed (Figure 3B). The tumor sections were prepared for IHC staining, which suggested that anti-miR-375 led to a significant decline in the staining intensity of Ki-67 in the collected tissues (Figure 3C). Collectively, these results showed that anti-miR-375 showed an anti-oncogenic role in tumor growth in animals as well.
Figure 3

Anti-miR-375 suppresses growth of xenograft tumors in vivo. (A) The picture of the collected tumors and the growth rate of tumors (* p < 0.05, two-way ANOVA); (B) weight of the tumors on the 28th day (* p < 0.05, two-way ANOVA); (C) Ki-67 expression in the tumor sections determined by IHC staining from three independent experiments and exhibited as mean ± standard deviation (SD). Data were presented as mean ± SD from three independent experiments. n = 3 in each group.

Anti-miR-375 suppresses growth of xenograft tumors in vivo. (A) The picture of the collected tumors and the growth rate of tumors (* p < 0.05, two-way ANOVA); (B) weight of the tumors on the 28th day (* p < 0.05, two-way ANOVA); (C) Ki-67 expression in the tumor sections determined by IHC staining from three independent experiments and exhibited as mean ± standard deviation (SD). Data were presented as mean ± SD from three independent experiments. n = 3 in each group.

EZH2 Enhances miR-375 Expression Through STAT3 Methylation

Next, we aimed to explore the possible upstream regulators of miR-375. The differentially expressed mRNAs between cancer and normal tissues were screened out and a heatmap was produced as well (Figure 4A). Then, a GO enrichment analysis was performed (Figure 4B). Coincidently, an enrichment of p53 signaling pathway was also identified based on these differentially expressed genes. Furthermore, a Kyoto Encyclopedia of Genes and Genomes (KEGG)-based functional annotation was conducted using the genes in the p53 signaling pathway (Table 3), which found that EZH2 is the only epigenetic regulator with a function in methylation modification. We therefore speculated that EZH2 modifies miR-375 expression. Then, we first determined EZH2 expression in BC tissues. RT-qPCR results showed that EZH2 was highly expressed in BC tissues compared to the paired adjacent tissues (Figure 4C). Consistent results were observed in every subtype (Figure 4D). In addition, a correlation analysis suggested that miR-375 expression had a positive correlation with EZH2 expression in the cancer tissues (Figure 4E). Similarly, high expression of EZH2 was also identified in the BC cell lines (Figure 4F). Although histone methylation mediated by methyltransferases usually induces gene downregulation, EZH2 has been reported to positively regulate gene expression in cancers through direct methylation of potential non-histone proteins (Xu et al., 2012) including signal transducer and activator of transcription 3 (STAT3; Kim et al., 2013). The bioinformatic analysis suggested that STAT3 has a binding site with the miR-375 promoter (Figure 4G). Then, the Co-IP and western blot analysis results showed that the methylation and phosphorylation of STAT3 was significantly enhanced after EZH2 overexpression (Figure 4H). In addition, the ChIP assay confirmed an enrichment of STAT3 in the miR-375 promoter region (Figure 4I). Collectively, these results suggested that EZH2 positively regulates miR-375 expression in BC cells through methylation of STAT3. To further validate whether EZH2 mediates miR-375 expression through STAT3 methylation, EZH2-OE and si-STAT3 were administrated into MCF-7 and HCC1954 cells. After that, it was found that the expression of miR-375 was increased upon EZH2 overexpression but reduced after further silencing of STAT3. Meanwhile, overexpression of EZH2 did not affect the expression level of STAT3 in cells, while downregulation of STAT3 significantly reduced the expression of miR-375 (Figure 4J), indicating that STAT3 played a role as a histone-like protein during this process.
Figure 4

EZH2 enhances miR-375 expression through STAT3 methylation. (A) Differentially expressed mRNAs between cancer and normal tissues screened out by microarray analysis; (B) bioinformatic analysis of the enriched pathways of the differentially genes; (C) EZH2 expression in tumor and adjacent normal tissues examined by RT-qPCR (* p < 0.05, paired t test); (D) EZH2 expression in different BC subtypes determined by RT-qPCR (* p < 0.05, one-way ANOVA); (E) a positive correlation between EZH2 and miR-375 expression in BC tissues; (F) mRNA expression of EZH2 in BC and normal cells detected by RT-qPCR; (G) putative binding relationship between STAT3 and miR-375 promoter; (H) methylation of STAT3 mediated by EZH2 determined by a Co-IP assay; (I) binding relationship between STAT3 and the miR-375 promoter region determined by a ChIP assay (* p < 0.05, two-way ANOVA); (J) expression of miR-375 in MCF-7 and HCC1954 cells after EZH2-OE and si-STAT3 transfection determined by RT-qPCR (*# p < 0.05, two-way ANOVA; *EZH2-NC vs. EZH2-OE; #EZH2-OE+si-NC vs. EZH2-OE+si-STAT3). Data were presented as mean ± SD from three independent experiments.

Table 3

KEGG pathway annotations.

Gene nameKEGG IDAnnotation
EZH2K11430Lysine27 N-trimethyltransferase
IGFBP3K10138Insulin-like growth factor-binding protein 3
CDKN1AK06625Cyclin-dependent kinase inhibitor 1A
MDM2K06643E3 ubiquitin-protein ligase Mdm2
ZMAT3K10137Zinc finger, matrin type 3
THBS1K16857Thrombospondin 1
PTENK01110Phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase
BAXK02159Apoptosis regulator BAX
SESN2K20394Sestrin 2
TNFRSF10BK04722Tumor necrosis factor receptor superfamily member 10A/B
CASP3K02187Caspase 3
FOXO1K07201Forkhead box protein O1
SESN1K10141Sestrin1/3
CASP9K04399Caspase 9
CCND1K04503G1/S-specific cyclin-D1
EZH2 enhances miR-375 expression through STAT3 methylation. (A) Differentially expressed mRNAs between cancer and normal tissues screened out by microarray analysis; (B) bioinformatic analysis of the enriched pathways of the differentially genes; (C) EZH2 expression in tumor and adjacent normal tissues examined by RT-qPCR (* p < 0.05, paired t test); (D) EZH2 expression in different BC subtypes determined by RT-qPCR (* p < 0.05, one-way ANOVA); (E) a positive correlation between EZH2 and miR-375 expression in BC tissues; (F) mRNA expression of EZH2 in BC and normal cells detected by RT-qPCR; (G) putative binding relationship between STAT3 and miR-375 promoter; (H) methylation of STAT3 mediated by EZH2 determined by a Co-IP assay; (I) binding relationship between STAT3 and the miR-375 promoter region determined by a ChIP assay (* p < 0.05, two-way ANOVA); (J) expression of miR-375 in MCF-7 and HCC1954 cells after EZH2-OE and si-STAT3 transfection determined by RT-qPCR (*# p < 0.05, two-way ANOVA; *EZH2-NC vs. EZH2-OE; #EZH2-OE+si-NC vs. EZH2-OE+si-STAT3). Data were presented as mean ± SD from three independent experiments. KEGG pathway annotations.

miR-375 Directly Targets FOXO1 in BC Cells

Our following bioinformatic analyses suggested that FOXO1, which was poorly expressed in BC, was a target mRNA of miR-375 and a gene on the p53 signaling pathway (Figure 5A). The binding relationship between miR-375 and FOXO1 was validated through a dual-luciferase reporter gene assay (Figure 5B). Next, expression of FOXO1 in BC tissues and cells was further determined. Consequently, poor expression of FOXO1 was identified in either BC tissues and cells compared to the normal ones (Figures 5C,D), which presented a negative correlation with both miR-375 and EZH2 expression (Figure 5E). Overexpression of EZH2 increased the expression of miR-375 while it reduced the expression of FOXO1, and downregulation of miR-375 led to an increase in the expression of FOXO1 in BC cells (Figure 5F), indicating FOXO1 suppression is possibly implicated in EZH2/miR-375-mediated events in BC cells.
Figure 5

miR-375 directly targets FOXO1. (A) A Venn diagram for the targeting mRNA of miR-375; (B) binding relationship between miR-375 and FOXO1 validated through a dual-luciferase reporter gene assay (* p < 0.05, two-way ANOVA); (C) FOXO1 expression in tumor and normal tissues determined by RT-qPCR (* p < 0.05, paired t test); (D) FOXO1 expression in BC and normal cells detected by RT-qPCR (* p < 0.05, one-way ANOVA); (E) negative correlation between miR-375 and miR-375 and EZH2; (F) expression of miR-375 and FOXO1 in cells in the presence of anti-miR-375 or EZG2-OE determined by RT-qPCR (*# p < 0.05, *EZH2-NC vs. EZH2-OE; #NC vs. anti-miR-375; two-way ANOVA). Data were presented as mean ± SD from three independent experiments.

miR-375 directly targets FOXO1. (A) A Venn diagram for the targeting mRNA of miR-375; (B) binding relationship between miR-375 and FOXO1 validated through a dual-luciferase reporter gene assay (* p < 0.05, two-way ANOVA); (C) FOXO1 expression in tumor and normal tissues determined by RT-qPCR (* p < 0.05, paired t test); (D) FOXO1 expression in BC and normal cells detected by RT-qPCR (* p < 0.05, one-way ANOVA); (E) negative correlation between miR-375 and miR-375 and EZH2; (F) expression of miR-375 and FOXO1 in cells in the presence of anti-miR-375 or EZG2-OE determined by RT-qPCR (*# p < 0.05, *EZH2-NC vs. EZH2-OE; #NC vs. anti-miR-375; two-way ANOVA). Data were presented as mean ± SD from three independent experiments.

Interactions Among EZH2, miR-375, and FOXO1 in BC Development

To further validate the interactions among EZH2, miR-375, and FOXO1 in BC progression, altered expression of EZH2, miR-375, and FOXO1 was introduced in cells. The above experiments showed that downregulation of miR-375 reduced BC cell activity and tumor growth in nude mice. On this basis, EZH2-OE or si-FOXO1 was additionally administrated into cells, after which the EZH2 expression was increased while the FOXO1 expression was declined (Figure 6A). Then, it was found that the reduction in colony formation and increase in apoptosis of BC cells mediated by anti-miR-375 was blocked by EZH2-OE or si-FOXO1 (Figures 6B,C). Likewise, cells with stable transfection were transplanted into nude mice. It was found that the growth rate of xenograft tumors suppressed by anti-miR-375 was recovered following additional EZH2 overexpression or FOXO1 silencing (Figures 6D,E). A similar trend was shown regarding positive-Ki-67 staining in the collected tumor tissues, which was initially suppressed by anti-miR-375 but increased by EZH2-OE or si-FOXO1 (Figure 6F).
Figure 6

Interactions among EZH2, miR-375, and FOXO1 in BC development. (A) mRNA expression of FOXO1 in cells after EZH2-OE or si-FOXO1 transfection determined by RT-qPCR (*# p < 0.05, two-way ANOVA); (B) proliferation of cells determined by colony formation assay (*# p < 0.05, two-way ANOVA); (C) apoptosis of cells determined by flow cytometry (*# p < 0.05, two-way ANOVA); (D,E) volume (D) and weight (E) of xenograft tumors in nude mice; (F) Ki-67 expression in the tumor sections determined by IHC staining. Data were presented as mean ± SD from three independent experiments. In animal models, n = 3 in each group.

Interactions among EZH2, miR-375, and FOXO1 in BC development. (A) mRNA expression of FOXO1 in cells after EZH2-OE or si-FOXO1 transfection determined by RT-qPCR (*# p < 0.05, two-way ANOVA); (B) proliferation of cells determined by colony formation assay (*# p < 0.05, two-way ANOVA); (C) apoptosis of cells determined by flow cytometry (*# p < 0.05, two-way ANOVA); (D,E) volume (D) and weight (E) of xenograft tumors in nude mice; (F) Ki-67 expression in the tumor sections determined by IHC staining. Data were presented as mean ± SD from three independent experiments. In animal models, n = 3 in each group.

The EZH2/miR-375/FOXO1 Axis Mediates the Activity of the p53 Signaling Pathway

The above bioinformatics analyses suggested that p53 is an important signaling pathway where EZH2 and miR-375 are located. We then surmised that the aberrant activity of the p53 signaling pathway is possibly implicated in BC progression. Therefore, we detected p53 activity in cells through Western blot analysis. It was found that the protein levels of p53 and FOXO1 were significantly reduced in the BC cell lines compared to the MCF10A cells (Figure 7A). In addition, activity of this signaling was increased when miR-375 was suppressed, but it was inhibited again upon EZH2 overexpression or FOXO1 downregulation; the protein level of FOXO1 was increased after miR-375 inhibition but reduced after EZH2 overexpression (Figure 7B). We therefore reported that inactivation of the p53 signaling pathway was responsible for BC development mediated by EZH2/miR-375/FOXO1.
Figure 7

The EZH2/miR-375/FOXO1 axis mediates the activity of the p53 signaling pathway. (A) Protein level of p53 and FOXO1 in BC cell lines and in normal cells determined by Western blot analysis (*#& p < 0.05, one-way ANOVA); (B) protein level of p53 in MCF-7 and HCC1954 cells after anti-miR-375, EZH2-OE, and si-FOXO1 transfection determined by Western blot analysis (*#& p <0.05, one-way ANOVA, *, NC vs. anti-miR-375; #, anti-miR-375 + EZH2-NC vs. anti-miR-375 + EZH2-OE, & anti-miR-375 + si-NC vs. anti-miR-375 + si-FOXO1). Data were presented as mean + SD from three independent experiments. In animal models, n = 3 in each group.

The EZH2/miR-375/FOXO1 axis mediates the activity of the p53 signaling pathway. (A) Protein level of p53 and FOXO1 in BC cell lines and in normal cells determined by Western blot analysis (*#& p < 0.05, one-way ANOVA); (B) protein level of p53 in MCF-7 and HCC1954 cells after anti-miR-375, EZH2-OE, and si-FOXO1 transfection determined by Western blot analysis (*#& p <0.05, one-way ANOVA, *, NC vs. anti-miR-375; #, anti-miR-375 + EZH2-NC vs. anti-miR-375 + EZH2-OE, & anti-miR-375 + si-NC vs. anti-miR-375 + si-FOXO1). Data were presented as mean + SD from three independent experiments. In animal models, n = 3 in each group.

Discussion

As the predominant cancer among all gynecologic productive cancers and one of the most common cancers in females worldwide, BC remains a huge health concern and heavily burdens individuals, families, and society. BC is a sporadic disease with epigenetic and genetic components involving epigenetic changes such as DNA methylation and histone modification, and the genetic alterations mainly include gene regulation (Rahman et al., 2019). In the current study, we reported a novel regulatory network implicated in BC progression, which involves aberrant activation of the oncogenic histone methyltransferase EZH2 and miR-375 and the subsequent inhibition of FOXO1 and the p53 signaling pathway. Initially, microarray analyses were performed to screen the aberrantly expressed miRNAs and mRNAs in the collected BC tissues. Intriguingly, in both the pathway and gene cluster analysis performed based on the target genes of the screened miRNAs and the GO enrichment analysis, the p53 signaling pathway was identified to be enriched in the tissue samples. p53 has been validated as an important tumor suppressor, as mutant p53 was found in up to 50% of human cancers (Stegh, 2012; Joerger and Fersht, 2016). This is also true for BC (Duffy et al., 2018). Then, miR-375, one of the abovementioned differentially expressed miRNAs, was the most abundant miRNA on the p53 signaling pathway and thus selected for subsequent experiments. We identified that high expression of miR-375 in BC patients was relevant to poor prognosis and survival rate of patients. This was partially in line with the previous findings issuing that miR-375 was upregulated in BC tissues compared to the normal tissues (Liu et al., 2019; Tang et al., 2020). Likewise, miR-375 was suggested as a negative biomarker indicating increased malignancy and dismal prognosis in medullary thyroid cancer (Shi et al., 2017). In another gynecologic tumor, ovarian cancer, miR-375 carried by serum exosomes was identified as a biomarker indicating tumor aggressiveness and LNM (Su et al., 2019). Similarly, in this study, high expression of miR-375 was found in BC tissues, and downregulation of miR-375 was introduced in cells, after which the viability, proliferation, and aggressiveness of cells were declined. Downregulation of miR-375 was found to suppress growth while inducing apoptosis of BC cells (Tang et al., 2020). A previous study by Tian et al. (2017) suggested that pretreatment with siRNA miR-375 enhanced the anti-proliferative functions of calycosin on BC MCF-7 and T47D cells. Therefore, it can be concluded that miR-375 exerts an oncogenic role in BC cells. The functions of miRNAs largely depend on the targeting genes. Importantly, the integrated analyses suggested that FOXO1 was aberrantly downregulated while EZH2 was upregulated in BC tissues. Both FOXO1 and EZH2 were enriched on the p53 signaling pathway, and FOXO1 was suggested as a direct target of miR-375, while EZH2 was the only epigenetic regulator. The following experiments validated that EZH2 positively regulated miR-375 expression to suppress FOXO1 expression. EZH2 is a well-known tumor promoter and therefore an important target for anti-cancer treatment (Shahabipour et al., 2017). In BC, silencing of EZH2 has been intensively shown to reduce the growth and metastasis of BC regardless of the subtypes (Han et al., 2018; Zhou et al., 2020). Mechanically, EZH2 has been reported to mediate the CpG island methylation of the RASSF2A promoter, therefore improving the activity of BC cells (Yu et al., 2016). Likewise, methylation modifications of EZH2 on miRNAs have also been implicated in human cancer progression (Ning et al., 2015; Kwon et al., 2017). Although the histone methylation mediated by methyltransferases usually induces gene downregulation (Lawrence et al., 2016), studies have also suggested that EZH2 may induce methylation of substrates other than H3K27 such as the androgen receptor (Xu et al., 2012) and STAT3 (Kim et al., 2013). STAT3 is activated in multiple cancers including BC, and as a transcriptional activator, its phosphorylation usually enhances the transcription of downstream genes (Banerjee and Resat, 2016; Sgrignani et al., 2018). Here, we confirmed that the methylation and phosphorylation of STAT3 in BC cells was increased by oe-EZH2, and STAT3 was further found to bind to the promoter region of miR-375. These indicated that upregulation of miR-375 by EZH2 was potentially mediated by STAT3 methylation. As for FOXO1, it is one of the FOXO transcription factors that are considered as tumor inhibitors that suppress cell proliferation and trigger apoptosis (Coomans de Brachene and Demoulin, 2016). In BC, inactivation of FOXO1 was responsible for ADP-Ribosylation factor 3-mediated proliferation of cells (Huang et al., 2019). Also, downregulation of FOXO1 by miR-9 and miR-223 has been found to lead to cell proliferation and metastasis (Liu et al., 2017; Wei et al., 2017). In the current paper, the involvements of EZH2 and FOXO1 in the functions of miR-375 were further validated by the functional rescue experiments where overexpression of EZH2 or downregulation of FOXO1 abrogated the functions of anti-miR-375 in BC cells and animals. In addition, our experiments found that the protein level of p53 in cells was increased upon miR-375, but then declined following further EZH2 upregulation or FOXO1 downregulation, indicating that the p53 signaling pathway was possibly mediated by the EZH2-miR-375-FOXO1 axis. To conclude, this study showed that EZH2 is an upstream regulator of miR-375 that increases miR-375 expression through STAT3 methylation and phosphorylation, while FOXO1 is a downstream target mRNA of miR-375 that activates the p53 signaling pathway to suppress BC development (Figure 8). These findings may provide novel understanding in the molecular mechanism of BC progression, and miR-375 may be a therapeutic target for BC management. We also hope more studies will be conducted in this field to validate our findings.
Figure 8

A diagram for molecular mechanism. miR-375 is an important oncogene triggering BC progression. EZH2 increases methylation of STAT3 and enhances miR-375 transcription activity. Upregulation of miR-375 reduces FOXO1 expression and inactivates the p53 signaling pathway to suppress BC development.

A diagram for molecular mechanism. miR-375 is an important oncogene triggering BC progression. EZH2 increases methylation of STAT3 and enhances miR-375 transcription activity. Upregulation of miR-375 reduces FOXO1 expression and inactivates the p53 signaling pathway to suppress BC development.

Data Availability Statement

The original data presented in the study are available in Figshare: https://figshare.com/articles/dataset/Supplementary_of_Original_western_blots_docx/14298860

Ethics Statement

The studies involving human participants were reviewed and approved by the Ethics Committee of the First Hospital of Jilin University. The patients/participants provided their written informed consent to participate in this study. The animal study was reviewed and approved by the Ethics of Animal Experiments of The First Hospital of Jilin University.

Author Contributions

XG is the guarantor of integrity of the entire study and contributed to the concepts. AS and YZo contributed to the design and definition of intellectual content of this study. MS and YZh contributed to the experimental studies, data acquisition, and statistical analysis. YD and ZF contributed to manuscript preparation. All authors contributed to the article and approved the submitted version.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  37 in total

Review 1.  Lateral Thinking: How Histone Modifications Regulate Gene Expression.

Authors:  Moyra Lawrence; Sylvain Daujat; Robert Schneider
Journal:  Trends Genet       Date:  2015-12-17       Impact factor: 11.639

Review 2.  FOXO transcription factors in cancer development and therapy.

Authors:  Alexandra Coomans de Brachène; Jean-Baptiste Demoulin
Journal:  Cell Mol Life Sci       Date:  2015-12-19       Impact factor: 9.261

3.  MiR-27a promotes EMT in ovarian cancer through active Wnt/𝜷-catenin signalling by targeting FOXO1.

Authors:  Li-Ya Zhang; Yuan Chen; Jue Jia; Xi Zhu; Yan He; Li-Ming Wu
Journal:  Cancer Biomark       Date:  2019       Impact factor: 4.388

Review 4.  Mutant p53 in breast cancer: potential as a therapeutic target and biomarker.

Authors:  Michael J Duffy; Naoise C Synnott; John Crown
Journal:  Breast Cancer Res Treat       Date:  2018-03-21       Impact factor: 4.872

Review 5.  Targeting the p53 signaling pathway in cancer therapy - the promises, challenges and perils.

Authors:  Alexander H Stegh
Journal:  Expert Opin Ther Targets       Date:  2012-01-12       Impact factor: 6.902

6.  Phosphorylation of EZH2 activates STAT3 signaling via STAT3 methylation and promotes tumorigenicity of glioblastoma stem-like cells.

Authors:  Eunhee Kim; Misuk Kim; Dong-Hun Woo; Yongjae Shin; Jihye Shin; Nakho Chang; Young Taek Oh; Hong Kim; Jingeun Rheey; Ichiro Nakano; Cheolju Lee; Kyeung Min Joo; Jeremy N Rich; Do-Hyun Nam; Jeongwu Lee
Journal:  Cancer Cell       Date:  2013-05-16       Impact factor: 31.743

Review 7.  DNA methylation, histone acetylation and methylation of epigenetic modifications as a therapeutic approach for cancers.

Authors:  Ching-Yu Yen; Hurng-Wern Huang; Chih-Wen Shu; Ming-Feng Hou; Shyng-Shiou F Yuan; Hui-Ru Wang; Yung-Ting Chang; Ammad Ahmad Farooqi; Jen-Yang Tang; Hsueh-Wei Chang
Journal:  Cancer Lett       Date:  2016-01-22       Impact factor: 8.679

8.  Downregulation of Long Noncoding RNA HOTAIR and EZH2 Induces Apoptosis and Inhibits Proliferation, Invasion, and Migration of Human Breast Cancer Cells.

Authors:  Lu Han; Hai-Chao Zhang; Li Li; Cai-Xia Li; Xu Di; Xin Qu
Journal:  Cancer Biother Radiopharm       Date:  2018-07-26       Impact factor: 3.099

Review 9.  Structural Biology of STAT3 and Its Implications for Anticancer Therapies Development.

Authors:  Jacopo Sgrignani; Maura Garofalo; Milos Matkovic; Jessica Merulla; Carlo V Catapano; Andrea Cavalli
Journal:  Int J Mol Sci       Date:  2018-05-28       Impact factor: 5.923

10.  CK2-mediated CCDC106 phosphorylation is required for p53 degradation in cancer progression.

Authors:  Yichong Ning; Chunqing Wang; Xin Liu; Yan Du; Shunlian Liu; Kaili Liu; Jianlin Zhou; Chang Zhou
Journal:  J Exp Clin Cancer Res       Date:  2019-03-18
View more
  4 in total

1.  EZH2 Protein Expression in Estrogen Receptor Positive Invasive Breast Cancer Treated With Neoadjuvant Endocrine Therapy: An Exploratory Study of Association With Tumor Response.

Authors:  Yujun Gan; Yungtai Lo; Della Makower; Celina Kleer; Jinyu Lu; Susan Fineberg
Journal:  Appl Immunohistochem Mol Morphol       Date:  2022-09-02

2.  Ezh2 competes with p53 to license lncRNA Neat1 transcription for inflammasome activation.

Authors:  Jia Yuan; Qingchen Zhu; Xingli Zhang; Zhenzhen Wen; Guiheng Zhang; Ni Li; Yifei Pei; Yan Wang; Siyu Pei; Jing Xu; Pan Jia; Chao Peng; Wei Lu; Jun Qin; Qian Cao; Yichuan Xiao
Journal:  Cell Death Differ       Date:  2022-05-14       Impact factor: 12.067

3.  Downregulated Copper Homeostasis-Related Gene FOXO1 as a Novel Indicator for the Prognosis and Immune Response of Breast Cancer.

Authors:  Rong Zeng; Bi Peng; Emin Peng
Journal:  J Immunol Res       Date:  2022-06-28       Impact factor: 4.493

Review 4.  MALAT1-miRNAs network regulate thymidylate synthase and affect 5FU-based chemotherapy.

Authors:  Janusz Matuszyk
Journal:  Mol Med       Date:  2022-08-03       Impact factor: 6.376

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.