Hemicycliophora ahvasiensis n. sp. (Nematoda: Hemicycliophoridae), and data on a known species, from Iran.

Hemicycliophora ahvasiensis n. sp., recovered from the rhizospheric soil of date palm in Khuzestan province, southwest Iran, is described and illustrated based upon morphological, morphometric and molecular data. The new species is characterized by its sheath, closely fitting most of the body, cuticle with or without numerous irregular lines, sometimes appearing as blocks in distal body region. Lateral field without discrete longitudinal lines, but often with continuous broken striae or anastomoses. Continuous lip region with single annulus, slightly elevated labial disc, stylet with posteriorly sloping knobs. Vulva with or without slightly modified lips, spermatheca with sperm and tail conoid, symmetrically narrowing at distal region to form a narrow conical region. Morphologically, the new species looks similar to H. indica, H. labiata, H. siddiqii, H. tenuistriata and H. typica. The latter species appears more similar to the new species under light microscopy, but could be separated using the scanning electron microscopy and molecular data. The new species was also compared with H. epicharoides and H. dulli, two species with close phylogenetic affinities to it. The phylogenetic relationships of the new species were reconstructed and discussed using partial sequences of the D2-D3 expansion segments of large subunit, and internal transcribed spacer regions (LSU D2-D3 and ITS rDNA). Hemicycliophora conida, the second studied species, was recovered from north Iran and characterized by morphological and molecular data.

In their excellent contribution to the systematics of the superfamily Hemicycliophoroidea Skarbilovich, 1959 (Siddiqi, 1980), Chitambar and Subbotin (2014) reviewed the taxonomy of the genus Hemicycliophora (De Man, 1921) and updated data of the currently valid species. In the same year, Subbotin et al. (2014) addressed aspects of the pathogenicity of Hemicycliophora species on associated host plants, the difficulties of morphological identifications due to morphological plasticity, and the lack of scanning electron microscopic (SEM) and molecular data. Currently the genus contains 133 species (132 listed in Chitambar and Subbotin, 2014 and one in Maria et al., 2018).

There are 12 species of Hemicycliophora have been reported from different provinces in Iran. They are H. belemnis Germani & Luc, 1973, H. chilensis Brzeski, 1974, H. conida Thorne, 1955, H. iranica Loof, 1984, H. lutosa Loof & Heyns, 1969, H. megalodiscus Loof, 1984, H. poranga Monteiro & Lordello, 1978, H. ripa Van den Berg, 1981, H. sculpturata Loof, 1984, H. spinituberculata Loof, 1984, H. sturhani Loof, 1984 and H. vaccinii Reed & Jenkins, 1963. All of these species were characterized using traditional taxonomic methods (Eskandari, 2018). In an effort to document Hemicycliophora species occurring in Iran, two populations were recovered from soil samples obtained from different geographical locations in northern and southern regions. The preliminary morphological studies revealed the population recovered from south Iran resembled H. typica de Man, 1921 under light microscope (LM), but further studies using SEM and molecular data, and comparisons with all known species of the genus, revealed it to be an unknown species, described herein as H. ahvasiensis n. sp. The second species recovered from north Iran belonged to H. conida Thorne, 1955.

Materials and methods

Nematode extraction and morphological observations

Several soil samples were collected from date palm and fruit tree gardens in Khuzestan and Gilan provinces, Iran. The relevant information of the presently studied nematode populations, and those included in phylogenetic analyses, are given in Table 1. Jenkins’ method (Jenkins, 1964) was used to extract the nematodes from soil samples. The collected specimens were killed in hot 4% formaldehyde solution and transferred to anhydrous glycerin according to De Grisse (1969). Observations and measurements were conducted using a Leitz SM-LUX light microscope equipped with a drawing tube. Some of the specimens were photographed using an Olympus DP72 digital camera attached to an Olympus BX51 light microscope equipped with differential interference contrast (DIC).

Table 1.

Information of the species/populations of Hemicycliophora studied in present paper and those of ingroup and outgroup taxa used in phylogenetic analyses.

			GenBank accession numbers
Species	Host	Locality	D2-D3 of LSU rDNA	ITS	Reference or identifier
H. ahvasiensis n. sp.	Phoenix dactylifera	Khuzestan province, Iran	MT901580, MT901581	MT901582, MT901583	Present study
H. californica	Salix sp.	Yolo County, CA, USA	KF430518, KF430519	KF430576	Subbotin et al. (2014)
H. conida	Punica granatum	Gilan province, Iran	–	MT901584	Present study
H. conida	Unknown plant	Belgium	FN433875	–	I. Tandingan De Ley et al. (unpub.)
H. conida	Turf grasses	Football pitch, Madrid, Spain	KF430447	KF430580	P. Castillo; Subbotin et al. (2014)
H. conida	Unknown plant	Clallam County, WA, USA	KF430448	KF430579	Subbotin et al. (2014)
H. dulli	Peat	South Africa	MT329669, MT329670	MT329671, MT329672	M. Rashidifard (unpub.)
H. epicharoides	Ammophila arenaria	Serranova, Brindisi, Italy	KF430512	–	Subbotin et al. (2014)
H. epicharoides	Ammophila arenaria	S. Barrameda, Cádiz, Spain	–	KF430608	Subbotin et al. (2014)
H. epicharoides	Pragmites sp.	Epiros, Greece	–	KF430606	Subbotin et al. (2014)
H. floridensis	Pinus elliotti	Lake City, FL, USA	KF430506	KF430536	Subbotin et al. (2014)
H. gracilis	Prunus domestica	Hamilton City, Glenn County, CA, USA	KF430480	KF430562	Subbotin et al. (2014)
H. gracilis	Prunus domestica	Butte City, Glenn County, CA, USA	KF430481	–	Subbotin et al. (2014)
H. gracilis	Unknown plant	Brooklyn Park, MN, USA	KF430482	–	Subbotin et al. (2014)
H. gracilis	Unknown plant	California, USA	–	FN435301	I. Tandingan De Ley et al. (unpub.)
H. gracilis	Unknown plant	Sacramento County, CA, USA	–	MG019827	Van den Berg et al. (2018)
H. halophila	Desmoschoenus spiralis	Taylors Mistake, New Zealand	KF430444, KF430445	KF430582, KF430583	Subbotin et al. (2014)
H. hellenica	Arundo donax	Filippias, Epirus, Greece	KF430453	KF430584	Subbotin et al. (2014)
H. iberica	Populus nigra	Arroyo Frío, Jaén, Spain	KF430461	KF430539, KF430540	Subbotin et al. (2014)
H. iberica	Quercus suber	Hinojos, Huelva, Spain	KF430462	–	Subbotin et al. (2014)
H. iberica	Quercus suber	Santa Elena, Jaén, Spain	KF430463	KF430541	Subbotin et al. (2014)
H. italiae	Ammophila arenaria	Zapponeta, Foggia, Italy	KF430458	–	Subbotin et al. (2014)
H. labiata	Poa pratensis	South Korea	MK305971, MK305972	MK305973, MK305974	Mwamula et al. (2020)
H. lutosa	Unknown plant	Gauteng province, South Africa	GQ406240, GQ406241	GQ406237	Van den Berg et al. (2010)
H. lutosoides	Turf grasses	Madrid, Spain	KF430454	–	Subbotin et al. (2014)
H. lutosoides	Juncus sp.	Cádiz, Spain	–	KF430537, KF430538	Subbotin et al. (2014)
H. obtusa	Pinus pinea	Moguer, Huelva, Spain	KF430521	KF430578	Subbotin et al. (2014)
H. onubensis1	Pinus pinea	Moguer, Huelva, Spain	KF430449, KF430450	KF430587, KF430588	Subbotin et al. (2014); Van den Berg et al. (2018)
H. parvana2	Turf grasses	New Hanover County, NC, USA	KF430501	–	Subbotin et al. (2014); Van den Berg et al. (2018)
H. parvana2	Turf grasses	Carteret County, NC, USA	KF430502	–	Subbotin et al. (2014); Van den Berg et al. (2018)
H. parvana2	Bentgrass	Texas, USA	KC329574	KC329575	Ma and Agudelo (2015)
H. parvana	Prunus persica	Punta Gorda, FL, USA	MG019825	–	Van den Berg et al. (2018)
H. parvana2	Andropogon virginicus	Paines Praire, FL, USA	–	KF430524, KF430526	Subbotin et al. (2014); Van den Berg et al. (2018)
H. parvana2	Turf grasses	New Hanover County, NC, USA	–	KF430528	Subbotin et al. (2014); Van den Berg et al. (2018)
H. poranga	Poa annua	Monterey County, CA, USA	KF430432, KF430434	KF430598	Subbotin et al. (2014)
H. poranga	Turf grasses	San Francisco, CA, USA	MG019815	–	Van den Berg et al. (2018)
H. poranga	Unknown plants	Marin County, CA, USA	MG019816	–	Van den Berg et al. (2018)
H. poranga	Salix sp.	Santa Rosa, CA, USA	–	KF430590	Subbotin et al. (2014)
H. poranga	Apium graveolens	Argentina	–	KF430596	Subbotin et al. (2014)
H. poranga	Lepidorrhachis mooreana	San Francisco, CA, USA	–	KF430600	Subbotin et al. (2014)
H. raskii	Grasses	Sacramento County, CA, USA	KF430520	KF430577	Subbotin et al. (2014)
H. robbinsi3	Turf grasses	Brunswick, NC, USA	KF430488, KF430492	–	Subbotin et al. (2014); Van den Berg et al. (2018)
H. robbinsi3	Turf grasses	Indian Hills, CA, USA	KF430491	–	Subbotin et al. (2014); Van den Berg et al. (2018)
H. robbinsi3	Turf grasses	San Antonio, TX, USA	–	KF430544	Subbotin et al. (2014); Van den Berg et al. (2018)
H. robbinsi3	Borrichia sp.	St Augustine, FL, USA	–	KF430550	Subbotin et al. (2014); Van den Berg et al. (2018)
H. robbinsi3	Phoenix roebelenii	Fort Lauderdale, FL, USA	–	KF430552	Subbotin et al. (2014); Van den Berg et al. (2018)
H. signata	Grasses	Chemba District, Mozambique	MG019824	–	Van den Berg et al. (2018)
H. similis	Fragaria x ananassa	Cartaya, Huelva, Spain	KF430465	–	Subbotin et al. (2014)
H. subbotini	Cinnamomum camphora	Zhejiang Province, China	MG701275–MG701277	MG701272, MG701273	Maria et al. (2018)
H. thienemanni	Salix sp.	Moscow, Russia	KF430469–KF430471	KF430570–KF430572	Subbotin et al. (2014)
H. thienemanni	Populus nigra	Castillo de Locubin, Jaén, Spain	–	KF430568	Subbotin et al. (2014)
H. thornei	Vitis vinifera	La Rambla, Córdoba, Spain	KF430452	KF430581	Subbotin et al. (2014)
H. typica	Grasses	Gauteng province, South Africa	KF430515	KF430603	Subbotin et al. (2014)
H. typica	Sugarcane	South Africa	–	GQ406238, GQ406239	Van den Berg et al. (2010)
H. vaccinii	Pinus pinaster	Carnota, Coruña, Spain	–	KF430542	Subbotin et al. (2014)
H. vaccinii	Pinus pinaster	Monteagudo Isl., Pontevedra, Spain	KF430459, KF430460	–	Subbotin et al. (2014)
H. vidua	Camellia sp.	South Carolina, USA	–	JQ708147	Cordero López et al. (2013)
Hemicycliophora sp.	Unknown plant	Iran	KY284835	–	E. Miraeiz, R. Heydari (unpub.)
Hemicycliophora sp. 1	Grasses	Terovo, Epirus, Greece	AY780974	KF430602	Subbotin et al. (2005); Subbotin et al. (2014)
Hemicycliophora sp. 2	Unknown plant	Birdlings Flat, New Zealand	KF430516, KF430517	KF430609, KF430610	Subbotin et al. (2014)
Hemicycliophora sp. 3	Zea mays	Tingle Farms, Willcox, AZ, USA	–	KF430573, KF430574	Subbotin et al. (2014)
Hemicycliophora sp. 5	Turf grasses	Carteret County, NC, USA	–	KF430575	Subbotin et al. (2014)
Hemicycliophora sp. 6	Nothofagus forest	Kaitoke Waterworks, New Zealand	KF430446	KF430585, KF430586	Subbotin et al. (2014)
Hemicycliophora sp. 7	Pinus pinea	Almonte, Huelva, Spain	KF430451	KF430589	Subbotin et al. (2014)
Hemicycliophora sp. 8	Unknown plant	Henrieville, UT, USA	KF444173	–	Subbotin et al. (2014)
Hemicycliophora sp. 8	Turf grasses	Monterey, CA, USA	KF430494	KF430559	Subbotin et al. (2014)
Hemicycliophora sp. 9	Trifolium repens	Preveza, Greece	KF430509, KF430511, KF430514	KF430605	Subbotin et al. (2014)
Hemicycliophora sp. 9	Agrostis sp.	Jaroslavl region, Russia	–	KF430604	Subbotin et al. (2014)
Hemicycliophora sp. 9	Unknown plant	Brake, Germany	AY780973	–	Subbotin et al. (2005); Subbotin et al. (2014)
Hemicycliophora sp. 10	Salix sp.	Yolo County, CA, USA	KF430483, KF430485–KF430486	KF430566, MG019828	Subbotin et al. (2014); Van den Berg et al. (2018)
Hemicycliophora sp. 11	Andropogon virginicus	Paines Prairie, FL, USA	KF430493	KF430557, KF430558	Subbotin et al. (2014)
Hemicycliophora sp. 12	Grasses	Saint Paul, MN, USA	KF430474	–	Subbotin et al. (2014)
Hemicycliophora sp. 12	Unknown plant	Brooklyn Park, MN, USA	KF430475	–	Subbotin et al. (2014)
Hemicycliophora sp. 12	Unknown plant	Sedona, AZ, USA	KF430476	–	Subbotin et al. (2014)
Hemicycliophora sp. 13	Neoregelia sp.	Los Angeles County, CA, USA	KF430507, KF430508	–	Subbotin et al. (2014)
Hemicycliophora sp. 15	Unknown plant	Vicinity of Trois–Rivières, Quebec, Canada	MG019819	–	Van den Berg et al. (2018)
Hemicycliophora sp. 16	Unknown tree	east of Temecula, CA, USA	MG019818	MG019829	Van den Berg et al. (2018)
Hemicycliophora sp. 17	Unknown tree	Pismo Beach, San Luis Obispo County, CA, USA	–	MG019830	Van den Berg et al. (2018)
Hemicycliophora sp. 18	Unknown plant	Vicinity of Quebec City, Quebec, Canada	MG019820	–	Van den Berg et al. (2018)
Gracilacus bilineata	Bambusa sp.	Taiwan	–	EU247525	Chen et al. (2008)
Paratylenchus bukowinensis	Unknown plant	Monopoli, Italy	AY780943	–	Subbotin et al. (2005)
Paratylenchus minutus	Annona squamosa	Taiwan	–	EF126180	Chen et al. (2009)
Paratylenchus nanus	Unknown plant	Niebüll, Germany	AY780946	–	Subbotin et al. (2005)
Trophotylenchulus floridensis	Pinus elliottii	Crystal river, Florida, USA	–	JN112261	Tanha Maafi et al. (2012)

Note: 1Originally identified as H. ripa 2Originally identified as H. wyei 3Originally identified as Hemicycliophora sp. 4.

Scanning electron microscopy (SEM)

Specimens preserved in glycerin were selected for observation according to Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded mixture of ethanol-acetone series, critical point-dried with liquid carbon dioxide, and coated with gold. The mounts were examined with a Zeiss Merlin microscope (5 kV).

DNA extraction, PCR and sequencing

For molecular analyses, single female specimens were picked out, examined in a drop of distilled water on a temporary slide under the light microscope, transferred to 3 μl of TE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0) on a clean slide, and then crushed using a cover slip. The suspension was collected by adding 20 μl TE buffer. One DNA sample for the Gilan population and two DNA samples for the Khuzestan population were prepared in this manner. The DNA samples were stored at –20°C until used as a PCR template. Primers for LSU rDNA D2-D3 amplification were forward primer D2A (5’–ACAAGTACCGTGAGGGAAAGT–3’) and reverse primer D3B (5’–TCGGAAGGAACCAGCTACTA–3’) (Nunn, 1992). Primers for amplification of ITS rDNA were forward primer TW81 (5’–GTTTCCGTAGGTGAACCTGC–3’) and reverse primer AB28 (5’–ATATGCTTAAGTTCAGCGGGT–3’) as described in Vovlas et al. (2008). The 25 μl PCR mixture contained 14.5 μl of distilled water, 3 μl of 10 × PCR buffer, 0.5 μl of 10 mM dNTP mixture, 1.5 μl of 50 mM MgCl2, 1 μl of each primer (10 pmol/μl), 0.5 μl of Taq DNA polymerase (Cinna Gen, Tehran, Iran, 5 U/μl), and 3 μl of DNA template. The thermal cycling program was as follows: denaturation at 95°C for 4 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 52°C for 40 s, and extension at 72°C for 80 s. A final extension was performed at 72°C for 10 min. Amplification success was evaluated by electrophoresis on 1% agarose gel (Aliramaji et al., 2018, 2020). The PCR products were purified using the QIAquick PCR purification kit (Qiagen®) following the manufacturer’s protocol and sequenced directly using the PCR primers with an ABI 3730XL sequencer (Bioneer Corporation, South Korea). The newly obtained sequences of the studied species were deposited into the GenBank database (accession numbers LSU D2-D3 MT901580/MT901581 and ITS rDNA MT901582 /MT901583 for the new species and MT901584 for ITS rDNA of H. conida, as indicated in Table 1).

Phylogenetic analyses

The newly obtained sequences of the D2-D3 fragments of LSU rDNA of the both populations, and the selected sequences from GenBank, were aligned by Clustal X2 (http://www.clustal.org/) using the default parameters. The ITS dataset was aligned using MUSCLE as implemented in MEGA6 (Tamura et al., 2013). The editing of both alignments was performed manually. The outgroup taxa were chosen according to previous studies (Subbotin et al., 2014; Van den Berg et al., 2018; Maria et al., 2018). The base substitution model was selected using MrModeltest 2 (Nylander, 2004) based on the Akaike information criteria. A general time reversible model, including among-site rate heterogeneity and estimates of invariant sites (GTR + G + I), was selected for the both phylogenies.

The Bayesian analysis was performed to infer the phylogenetic trees using MrBayes v3.1.2 (Ronquist and Huelsenbeck, 2003), running the chains for two million generations. After discarding burn-in samples and evaluating convergence, the remaining samples were retained for further analyses. The Markov chain Monte Carlo (MCMC) method within the Bayesian framework were used to determine equilibrium distribution and help estimate the posterior probabilities of the phylogenetic trees (Larget and Simon, 1999) using the 50% majority rule. Bayesian posterior probability (BPP) values higher than 0.50 are given on appropriate clades. The output files of the phylogenetic program was visualized using Dendroscope v3.2.8 (Huson and Scornavacca, 2012) and re-drawn in CorelDRAW software version 17.

Results

Systematics

Hemicycliophora ahvasiensis n. sp.(Figures 1–4; Table 2).

Description

Female

Body straight to slightly ventrally arcuate following heat fixation. Cuticular sheath closely appressed over entire or most of body. Under LM, annuli rounded, with or without longitudinal lines, appearing as blocks mostly in the distal body region. Block-like differentiations are more prominent in distal body region under SEM. Lateral field with no longitudinal lines, but having broken or continuous striae or anastomoses. Amphidial openings large, partly plugged. Lip region continuous with body contour, bearing one wide annulus. Labial disc slightly elevated. Stylet with posteriorly sloping knobs, having moderate to large cavity at base. Pharynx criconematoid, with pharyngeal corpus absent, metacorpus (median bulb) ovoid bearing central valves, short isthmus surrounded by the nerve ring and reduced pyriform basal bulb. Cardia short, surrounded by intestinal tissue. Excretory pore five to 10 annuli posterior to the pharynx base. Hemizonid indistinct. Reproductive system monodelphic-prodelphic, outstretched, composed by long ovary with oocytes arranged in one or two rows, spermatheca round to oval, filled with spheroid sperm cells, vulva with not or slightly modified lips, vulval sleeve slightly elongate, one to two annuli long. Body portion behind vulva slightly narrowing towards distal region. Distance between vulva to anus about five anal body diam. Tail conoid, symmetrically narrowing at about 35% of its length at distal region to form a narrower conical section ending to a finely rounded to sharp terminus.

Male

Not found.

Juvenile

One juvenile specimen was found in the population that is similar to female except by a smaller body size and undeveloped sexual organs.

Type host and locality

This population was recovered from the rhizospheric soil of date palm (Phoenix dactylifera L.) collected from Ahvaz city in Khuzestan province, southwest Iran. The GPS information of the sampling site is 31°18´11.1˝N, 48°39´10.1˝E.

Etymology

The specific epithet of the new species refers to the original city name in Latin where it was discovered.

Type material

The holotype and 12 paratype females were deposited into the nematology laboratory of the Department of Plant Protection, Shahid Chamran University of Ahvaz, Ahvaz, Iran. Three paratype females deposited at the Wageningen Nematode Collection (WaNeCo), Wageningen, The Netherlands. Two paratype females deposited at the Nematode Collection of the Department of Animal Biology, Plant Biology and Ecology of the University of Jaén, Jaén, Spain. The ZooBank Life Science Identifier (LSID) for this publication is as follows: http://zoobank.org/urn:lsid:zoobank.org:pub:EEF9C9E9-90B8-4EC1-8BD9-A403FD8D58E4.

Diagnosis and relationships

Hemicycliophora ahvasiensis n. sp. is mainly characterized by a cuticle with or without longitudinal lines on annuli. Instead of lateral lines there may be broken or continuous striae or anastomoses on lateral sides of the body. The lip region is continuous with body contour and has a single annulus, slightly elevated labial disc, and plugged amphidial openings. Other characters include posteriorly sloping stylet knobs, vulva with or without slightly modified lips and short vulval sleeve, spermatheca full of sperm and conoid tail, symmetrically narrowing at about 35% of its length at the distal region to form a narrower conical region. The polytomous identification codes of the new species from Chitambar and Subbotin (2014) are: A4, B2, C3, D1, E1, F1, G23, H1, I12, J1, K23, L3, M2, N1, O1, P1, Q2, R2, S3, T1, U2, V1, W1, X1, Y-.

In general morphology, the new species is close to H. indica Siddiqi, 1961, H. labiata Colbran, 1960, H. siddiqii Deswal & Bajaj, 1987, H. tenuistriata Doucet, 1982 and H. typica. A comparison of the new species with the aforementioned species is as follows:

From H. indica, by a shorter body (767–893 vs 800–1500 μm), lower R, Rph, Rex and RV (212–247 vs 270–320, 35–48 vs 47–69, 42–50 vs 51–67 and 38–59 vs 64–81), respectively, lateral field without line(s) (vs with three lines), lip region with one annulus (vs two or three annuli), short vulval sleeve (vs elongate) and tail symmetrically narrowing at about 35% of its length at distal region to form a narrower conical section (vs uniformly narrowing).

From H. labiata, by annuli with or without longitudinal lines (vs not), lateral field lacking line(s) (vs having one line), lip region with one annulus (vs two or three annuli), short vulval sleeve (vs moderately long) and body not constricted immediately posterior to vulva (vs constricted).

From H. siddiqii, by lateral field lacking line(s) (vs having one line), a longer body (767–893 vs 650–780 μm), lower a ratio (17.9–24.5 vs 27–31), higher c ratio (8.3–11.5 vs 7), longer stylet (63.3–71.0 vs 57–59 μm), posteriorly located excretory pore (159–180 vs 127–146 μm from anterior end), higher R, Rph and Rex (212–247 vs 185–198, 35–48 vs 30–32 and 42–50 vs 35–39, respectively), shorter vulval sleeve (vs moderately elongate) and tail symmetrically narrowing at about 35% of its length at distal region to form a narrower conical section (vs uniformly narrowing).

From H. tenuistriata, by shorter stylet (63.3–71.0 vs 70–79 μm), posteriorly located excretory pore (159–180 vs 136–158 μm from anterior end), higher R, Rph, RV(ant) and Rex (212–247 vs 179–205, 35–48 vs 31–37, 167–198 vs 146–162 and 42–50 vs 33–40, respectively), shorter vulval sleeve (vs moderately elongate) and vulval lips not modified (vs modified, well developed, extending posteriorly).

From H. typica, by cuticle lacking distinct blocks (vs having blocks), lateral field lacking line(s) (vs having two lines), body not constricted immediately posterior to vulva (vs constricted) and short vulval sleeve (vs moderately elongate).

From H. epicharoides Loof, 1968, a species with close phylogenetic affinities in both LSU and ITS phylogenies, by higher R, RV(ant) and Rex (212–247 vs 144–209, 167–198 vs 129–167 and 42–50 vs 32–43, respectively), lip region with one annulus (vs two or three annuli), lower St%L (7.5–8.4 vs 9–11), excretory pore located posterior to pharynx base (vs anterior or posterior) and tail symmetrically narrowing at about 35% of its length at distal region to form a narrower conical section (vs cylindroid anteriorly, mostly narrowing to a bluntly triangular or wedge-shaped posterior part).

From H. dulli Van den Berg & Tiedt, 2001, a species with close phylogenetic affinities in ITS phylogeny, by shorter stylet (63.3–71.0 vs 73–79 μm), lower Rst (18–21 vs 21–25), lateral field lacking line(s) (vs having one or two lines), lip region continuous with one annulus (vs set off with two annuli), excretory pore located posterior to pharynx base (vs anterior or posterior) and vulva with not or slightly modified lips (vs vulval lips elongated).

Hemicycliophora conida Thorne, 1955(

Figure 5; Table 3).

Figure 5:

Light photomicrographs of Hemicycliophora conida Thorne, 1955 from Gilan province, Iran. A–G: Female. A: Anterior body region; B: Pharyngeal region; C: Lateral field at mid-body; D, E: Annuli ornamentation; F, G: Posterior body region; H, I: Male. H: Anterior body region; I: Posterior body region. (Scale bar = 20 μm).

Table 3.

Morphometrics of Hemicycliophora conida Thorne, 1955 from Gilan province, Iran, and comparison with other population from East Azarbaijan province, Iran.

Reference	Present study		Loof (1984)
Province	Gilan province		East Azarbaijan province
Character	Female	Male	Female
n	10	5	11
L	912.0 ± 21.4 (881–928)	809.0 ± 13.6 (795–822)	820–1020
a	21.2 ± 2.5 (18.6–24.3)	37.3 ± 5.7 (31.8–43.3)	26–30
b	5.3 ± 0.2 (5.2–5.6)	–	5.0–5.6
c	11.6 ± 2.0 (10.1–14.5)	8.2 ± 0.4 (7.8–8.6)	9.7–13.6
c'	2.3 ± 0.4 (1.7–2.6)	5.2 ± 0.5 (4.6–5.6)	–
V	86.7 ± 1.0 (85.5–87.6)	–	86–89
St	92.5 ± 2.1 (90–97)	–	90–103
m	78.3 ± 4.0 (75.3–84.2)	–	–
Stylet knob height	5.0 ± 0.4 (4.3–5.6)	–	–
Stylet knob width	7.8 ± 0.5 (6.9–8.6)	–	–
Excretory pore from anterior end	178.0 ± 8.9 (169–192)	140.2 ± 13.4 (127–164)	–
Diam. at mid-body	43.5 ± 5.5 (38–50)	22 ± 3 (19–25)	–
Diam. at anus/cloaca	35.3 ± 4.3 (30–40)	19 ± 1 (18–20)	–
Diam. at vulva	46.4 ± 5.8 (40–55)	–	–
Vulva-anterior body distance	791 ± 16 (770–809)	–	–
Vulva-tail terminus distance	124.5 ± 7.8 (115–136)	–	–
Spermatheca-vulva distance	82.2 ± 10.1 (72–96)	–	–
Lip diam.	21.3 ± 2.2 (19–24)	10.7 ± 1.5 (9–12)	–
Lip height	7.5 ± 0.6 (7–8)	6.2 ± 0.8 (6–7)	–
First body annulus diam.	23.8 ± 1.9 (20–26)	–	–
Second body annulus diam.	26.1 ± 2.7 (21–30)	–	–
Pharynx length	171.0 ± 4.7 (167–176)	–	–
Annulus width	4.1 ± 0.5 (3.6–5.1)	1.9 ± 0.1 (1.8–2.0)	–
Tail length	88.0 ± 6.5 (79–94)	98.7 ± 6.1 (92–104)	–
V-anus distance	42.0 ± 19.7 (28–71)	–	–
R	230.0 ± 9.2 (224–237)	–	259–286
RSt	21.0 ± 0.9 (18–23)	–	–
Rph	38.0 ± 0.2 (38–39)	–	–
Rex	41.4 ± 1.4 (39–43)	–	48–52
RV(ant)	187.0 ± 3.5 (185–190)	–	207–226
RV	46.0 ± 4.9 (37–54)	–	–
RVan	16.0 ± 8.5 (10–22)	–	11–17
Ran	27.0 ± 2.8 (25–29)	–	35–41
VL/VB	2.7 ± 0.3 (2.2–3.4)	–	4.0–5.3
Spermatheca length	22.7 ± 5.9 (12–30)	–	–
Spermatheca diam.	31.8 ± 8.1 (15–39)	–	–
Spicules length	–	54.3 ± 2.1 (52–56)	–
Gubernaculum length	–	20.3 ± 0.6 (20–21)	–
Bursa length	–	41.7 ± 6.4 (37–49)	–

Line drawings of Hemicycliophora ahvasiensis n. sp. Female. A: Anterior body region; B: Spermatheca; C: Vulval region; D–F: Variation of posterior body end morphology. (Scale bar = 20 μm).

Light photomicrographs of Hemicycliophora ahvasiensis n. sp. Female. A: Entire body; B, C: Anterior body region; D: Reproductive system (the arrow indicates the spermatheca); E: Spermatheca; F: Vagina; G: Posterior body region.

Scanning electron micrographs of Hemicycliophora ahvasiensis n. sp. Female. A: Entire body; B, C: Anterior end showing labial region; D, E: En face view of labial area; F, G: Annuli ornamentation (the arrows indicate the excretory pore); H–L: Posterior body region.

Scanning electron micrographs of Hemicycliophora ahvasiensis n. sp. Female. A–F: Mid-body annuli ornamentation.

Body straight or ventrally arcuate. Cuticular sheath fitting closely to loosely to body. Lateral fields with two distinct longitudinal lines forming a band, with irregularities and breaks of striae or with anastomosis, an additional central line appears due to four ellipsoid markings on each annulus forming four blocks. Annuli outside lateral field with scratches. Labial region broad, anterior margins rounded, with two distinct annuli and elevated labial disc. Stylet long and slender, knobs posteriorly directed. Pharynx typical of the genus. Nerve ring encircling isthmus. Excretory pore, four annuli posterior and opposite to pharynx base. Reproductive system monodelphic-prodelphic, outstretched, spermatheca rounded to ovate, filled with spheroid sperm cells, vulval lips modified, vulval sleeve absent. Tail conical, symmetrically narrowing at distal region, tip rounded.

Cuticle annulation fine at midbody. Lateral fields marked by three longitudinal lines. Labial region distinctly trapezoid. Stylet and pharynx degenerated. Spicules semi-circular, tip slightly recurved. Gubernaculum linear, slightly thickened proximally. Bursa with crenate margin. Tail elongate, uniformly narrowing, annuli at distal end irregular.

Host and locality

This population was recovered from the rhizospheric soil of pomegranate (Punica granatum L.) collected from Rasht city, Gilan province, in north Iran. The geographical position of the sampling site is N36°54´1.687˝, E49°28´37.923˝.

Remarks

H. conida was originally described by Thorne (1955) from a sugar beet field in Ireland. It was later reported from several countries (Chitambar and Subbotin, 2014). In the report of Loof (1984), the species was recovered from East Azarbaijan province of Iran. Males, however, were not recovered in this study. Later, the species was again recovered from Azarbaijan province, but no morphometric or morphological data were provided (Barooti, 1998). The presently recovered population agreed well with other populations of the species that have been reported from different regions, based upon the morphometric data and morphology (Chitambar and Subbotin, 2014). The spicules length in The Netherlands populations was measured as 18–29 μm by Loof (1968) (Chitambar and Subbotin, 2014), but it was calculated about 55 μm after the drawings, which is in accordance with the presently studied population.

Molecular characterization and phylogenetic relationships

Two 673 and 682 nt long D2-D3 expansion segments of LSU (MT901580, MT901581), one from each female specimen, were generated for the new species. A BLAST search using these sequences revealed they have 99.34% identity with Hemicycliophora sp. 9 and Hemicycliophora sp. 13 (KF430509 and KF430508, respectively). The efforts to get the LSU sequences of H. conida failed. A total of 77 sequences of Hemicycliophora spp. and two sequences of Paratylenchus nanus Cobb, 1923 and P. bukowinensis Micoletzky, 1922 (AY780946 and AY780943, respectively), as outgroup taxa, were selected for a LSU phylogeny. This dataset comprised 750 total characters. The phylogenetic tree inferred using this dataset is presented in Figure 6. The major clade including the new species, also includes Hemicycliophora sp. 13 (KF430507, KF430508), the putative closest relative of it, based upon currently available data, H. epicharoides (KF430512), H. labiata (MK305971, MK305972) and Helicycliophora sp. 9 (KF430509, KF430511, KF430514, AY780973). H. typica (KF430515) is in a sister relation to the aforementioned major clade.

Figure 6:

Bayesian 50% majority rule consensus tree inferred from analysis of the D2-D3 domains of the LSU rDNA sequences of Hemicycliophora ahvasiensis n. sp. under the GTR + G + I model. (lnL = 6023.6660; freqA = 0.2165; freqC = 0.2342; freqG = 0.3064; freqT = 0.2429; R(a) = 0.4542; R(b) = 1.5000; R(c) = 1.0798; R(d) = 0.4155; R(e) = 4.2300; R(f) = 1; Pinvar = 0.3122; Shape = 0.7157). Bayesian posterior probability values more than 0.50 are given for appropriate clades. New sequences are indicated in bold.

Two 904 and 907 nt long sequences of ITS rDNA (MT901582, MT901583) were generated for the new species. A single 683 nt long ITS rDNA sequence (MT901584) was obtained for the Iranian population of H. conida. A BLAST search using the ITS sequences of the new species revealed they have 98.93% identity with Hemicycliophora sp. 9 (KF430605). The BLAST search using ITS sequence of Iranian population of H. conida revealed it has 99.55% and 98.21% identity with two other ITS sequences of H. conida (KF430580 and KF430579, respectively).

A total of 70 sequences of Hemicycliophora spp. and three sequences of Paratylenchus minutus Linford in Linford, Oliveira & Ishii, 1949, Trophotylenchulus floridensis Raski, 1957 and Gracilacus bilineata Brzeski, 1995 as outgroup taxa (EF126180, JN112261 and EU247525, respectively) were selected for an ITS phylogeny. This dataset comprised 1164 total characters. The phylogenetic tree inferred using this dataset is presented in Figure 7. The major clade including the new species, also includes Hemicycliophora sp. 9 (KF430604, KF430605) that represents the putative closest relative of the new species, H. epicharoides (KF430606, KF430608) and H. labiata (MK305973, MK305974). The clade including two species H. typica (GQ406238, GQ406239, KF430603) and H. dulli (MT329671, MT329672) is in sister relation to the aforementioned clade. The ITS sequence of the Iranian isolate of H. conida formed a clade with two previously available sequences (KF430579, KF430580) of the species.

Figure 7:

Bayesian 50% majority rule consensus tree inferred from analysis of the ITS rRNA gene of Hemicycliophora ahvasiensis n. sp. and Iranian population of H. conida under the GTR + G + I model. (lnL = 13525.0293; freqA = 0.2348; freqC = 0.2548; freqG = 0.2520; freqT = 0.2583; R(a) = 1.6876; R(b) = 2.3417; R(c) = 1.8416; R(d) = 0.8470; R(e) = 3.6304; R(f) = 1; Pinvar = 0.1024; Shape = 0.4967). Bayesian posterior probability values more than 0.50 are given for appropriate clades. New sequences are indicated in bold.

Discussion

The objectives of this study were to characterize one new and one known species of the genus Hemicycliophora from Iran. As common in reliable identifications of Hemicycliophora spp., the new species was studied using an integrative approach exploiting both morphological (including SEM) and molecular data (Subbotin et al., 2014).

In both inferred LSU and ITS phylogenies, Hemicycliophora ahvasiensis n. sp. belonged to a clade including Hemicycliophora sp. 9, H. labiata, H. epicharoides, H. typica and H. dulli. The close affinity of the aforementioned species was already observed (Subbotin et al., 2014; Van den Berg et al., 2018; Maria et al., 2018; Mwamula et al., 2020).

The newly described species in present study appeared similar to H. typica under LM, however, the SEM and molecular data revealed they differ. Sequences of LSU D2-D3, and ITS rDNA sequences of H. ahvasiensis n. sp. differed from those of H. typica by 6 bp (1.4%) and 31 bp (1.5%), respectively. In the inferred phylogenies, it formed a subclade separate from H. typica and other Hemicycliophora species.

The new species was isolated from the rhizosphere of date palm tree, that is a major food source for local populations in the Middle East, and plays important roles in their culture and economy (Chao and Krueger, 2007). Additional study is required to clarify if the parasitism of high nematode populations of H. ahvasiensis n. sp. can cause damages to this plant.

Table 2.

Morphometrics of Hemicycliophora ahvasiensis n. sp. from Khuzestan province, Iran.

Character	Female holotype	Female paratypes	Juvenile
n	1	20	1
L	868.7	830.3 ± 48.3 (767–893)	600
a	22.2	21.5 ± 2.1 (17.9–24.5)	18.0
b	5.9	5.8 ± 0.3 (5.4–6.5)	4.8
c	10.7	10.1 ± 1.2 (8.3–11.5)	9.8
c'	2.9	3.0 ± 0.3 (2.5–3.5)	2.6
o	11.5	12.2 ± 0.9 (9.4–15.3)	9.0
DGO	7.9	8.1 ± 0.9 (7.4–10.0)	5.5
V	85.5	84.1 ± 0.9 (82.6–85.5)	–
St	68.4	66.5 ± 2.3 (63.3–71.0)	60.8
m	81.5	80.6 ± 1.4 (77.4–83.7)	80.7
Stylet knob height	4	4.1 ± 0.5 (4–5)	3.8
Stylet knob width	7	6.6 ± 0.7 (6–8)	6.6
Excretory pore from anterior end	171	168.3 ± 6.1 (159–180)	168
Diam. at mid-body	39	38.4 ± 3.6 (32–46)	33
Diam. at anus (ABD)	27	26.8 ± 1.7 (24–29)	23
Diam. at vulva	38	38.4 ± 2.1 (35–43)	–
Vulva-anterior body distance	744	700 ± 43 (653–751)	–
Vulva-tail terminus distance	125	129.5 ± 6.0 (113–142)	–
Spermatheca-vulva distance	89	87.6 ± 13.2 (74–121)	–
Lip diam.	15	15.7 ± 0.9 (14–18)	14
Lip height	7	6.7 ± 0.7 (6–9)	6
First body annulus diam.	16	16.9 ± 0.9 (15–19)	15
Second body annulus diam.	18	18.6 ± 1.1 (16–21)	16
Pharynx length	145	142.6 ± 4.8 (134–151)	125
Annulus width	4	4.1 ± 0.3 (3.4–4.7)	2.8
Tail length	81	83.3 ± 7.9 (74–92)	61
V-anus distance	45	47.9 ± 9.9 (32–64)	–
R	245	221.3 ± 8.6 (212–247)	216
RSt	19	19.5 ± 1.1 (18–21)	22
Rph	41	41.1 ± 3.2 (35–48)	46
Rex	48	47.4 ± 3.6 (42–50)	58
RV(ant)	193	185.3 ± 8.4 (167–198)	–
RV	52	47.8 ± 6.9 (38–59)	–
RVan	15	15.0 ± 3.8 (10–22)	–
Ran	37	32.9 ± 4.9 (25–47)	–
VL/VB	3.3	3.4 ± 0.3 (2.8–3.9)	–
Spermatheca length	29	19.8 ± 5.4 (14–29)	–
Spermatheca diam.	15	15.5 ± 1.6 (12–22)	–
St%L	7.8	7.9 ± 0.4 (7.5–8.4)	10