Long non-coding RNA KCNQ1OT1 promotes the progression of gastric cancer via the miR-145-5p/ARF6 axis.

BACKGROUND: Long non-coding RNA KCNQ1 opposite strand/antisense transcript one gene (KCNQ1OT1) has been reported to be involved in the progression of many types of human cancer, whereas its role in gastric cancer (GC) remains unknown. The present study aimed to investigate the role of KCNQ1OT1 in GC.
METHODS: In total, 25 GC tissues and adjacent normal tissues were collected. The expression of KCNQ1OT1, miR-145-5p and ARF6 in GC tissues and cell lines was detected by quantitative reverse transcriptase-polymerase chain reaction or western blotting. Bioinformatics analysis and a dual luciferase reporter assay were performed to determine the relationship between KCNQ1OT1 and miR-145-5p or miR-145-5p and ARF6. Gain- and loss-of function of KCNQ1OT1 and miR-145-5p were achieved to confirm their roles in GC cells. Cell counting kit-8, colony formation and flow cytometry assays were used to evaluate cell viability, proliferation and apoptosis. A xenograft tumor model was established with BGC803 tumor cells transfected with sh-KCNQ1OT1 or empty vector to determine the role of LINC01089 in vivo.
RESULTS: The expression levels of KCNQ1OT1 were markedly elevated in GC tissues and cells. Knockdown of KCNQ1OT1 inhibited GC tumor growth, reduced GC cell viability and colony formation, and induced GC cell apoptosis. The expression levels of miR-145-5p were significantly decreased in GC cells and correlated with the expression of KCNQ1OT1 in GC tumors. Moreover, KCNQ1OT1 directly binds with miR-145-5p, which is targeting ARF6. Knockdown of KCNQ1OT1 increased the expression levels of miR-145-5p. Inhibition of miR-145-5p increased the expression levels of KCNQ1OT1 and also attenuated the effects of knockdown of KCNQ1OT1 on the viability, proliferation and apoptosis of GC cells. In addition, overexpression of miR-145-5p reduced GC cell viability and colony formation and induced GC cell apoptosis, whereas overexpression of ARF6 attenuated the effects of overexpression of miR-145-5p on GC cell viability, colony formation and apoptosis.
CONCLUSIONS: KCNQ1OT1 can promote GC progression through the miR-145-5p/ARF6 axis. KCNQ1OT1 may serve as a therapeutic target and a diagnostic biomarker of GC.

INTRODUCTION

Gastric cancer (GC) is the fourth most malignant cancer and the second top reason of cancer‐related death worldwide, especially in some parts of Asia. , Chronic inflammation response caused by persistent Helicobacter pylori infection is known to be the primary cause of hypochlorhydria and gastric atrophy, which may further develop to gastric precancerous lesions. , Although surgeries, radical operations and chemotherapies are available, the prognosis of GC patients is still not satisfactory, and the 5‐year survival rate is also unsatisfactory. , , Therefore, early and precise prognostics for patients are urgently needed to discover GC in early‐stage and lower the recurrent rate after treatments. The present study aimed to explore a new biomarker that might provide valuable information for the treatment of GC.

Long non‐coding RNAs (lncRNAs) (> 200 nucleotides) have been identified to play oncogenic roles in the invasion, migration, proliferation and metastasis of various cancers, such as GC, cervical cancer and breast cancer. lncRNA UCA1 was reported to promote proliferation, migration and immune escape, as well as inhibit cell apoptosis, in GC by targeting anti‐tumor microRNAs (miRNAs). lncRNA KCNQ1 opposite strand/antisense transcript one gene (KCNQ1OT1) is located at 11p15.5 with a length of 91.5 kb, which is identified to interact with chromatin and regulates the transcription of many target genes via epigenetic modifications. , Accumulative evidence has suggested that KCNQ1OT1 participates intimately in various types of cancer, such as colon cancer, bladder cancer and melanoma. , , , It has been reported that knockdown of KCNQ1OT1 suppressed the invasion of osteosarcoma cells and promoted the chemo‐sensitivity of osteosarcoma cells to cisplatin through up‐regulating the expression of KCNQ1. KCNQ1 encodes the pore‐forming α‐subunit of a voltage‐gated potassium channel and was identified as a gastrointestinal tract cancer susceptibility gene in multiple Sleeping Beauty DNA transposon‐based forward genetic screens in mice. We therefore speculated that KCNQ1OT1 might be involved in the progression of GC. The present study aimed to investigate the role of KCNQ1OT1 in GC.

miRNAs are small RNAs (approcximately 22 nucleotides) that do not encode proteins but can modulate gene expression by targeting corresponding mRNAs. It has also been reported that lncRNAs could sponge complementary sequences of miRNAs. Dysregulation of miRNAs are related to the pathogenic process of cancer cells. The regulatory role of miR‐145‐5p has been widely investigated in GC. , For example, one study proposed that down‐regulation of miR‐145‐5p was involved in advanced clinicopathological feature of GC. In the present study, our preliminary data suggested that miR‐145‐5p may be a target of KCNQ1OT1. We therefore speculated that the function of KCNQ1OT1 in GC might be regulated by miR‐145‐5p. In addition, ARF6 is known to work as a switch through cycling between active and inactive GTP‐bound conformation. Growing evidence has suggested that ARF6 participated in the signaling pathway of GC. In the present study, we aimed to examine the potential role of KCNQ1OT1 and the interactions among KCNQ1OT1, miR‐145‐5p and ARF6 in GC. The expression of KCNQ1OT1, miR‐145‐5p and ARF6 was detected in GC cells and tissues.

MATERIALS AND METHODS

Patient information

In total, 25 pairs of GC tissues and matched normal tissues were collected from patients who were admitted at Zhuhai People's Hospital (Zhuhai Hospital affiliated with Jinan University) from 2010 to 2011. The sample information of the patients is provided in Table 1. All specimens were newly diagnosed tumors and did not receive radiation or chemotherapy. All specimens were resected and collected within 15 minutes after removal. After histological confirmation, samples were immediately frozen in liquid nitrogen and stored at −80°C. This study was carried out with ethical approval from Zhuhai People's Hospital (Zhuhai Hospital affiliated with Jinan University). All participants were informed of the details of the experimental procedure prior to study commencement, and all participants provided their written informed consent.

TABLE 1

Patient sample information

Clinicopathologic factors	Patient number
Male	15
Female	10
≤ 50 years old	13
> 50 years old	12
Histological grade
High	5
Middle	10
Low	10
Local invasion
T1, T2	13
T3, T4	12
Lymph node metastasis
No	14
Yes	11
Distant metastasis
No	15
Yes	10
TNM stage
I/II	14
III/IV	11

Cell culture and transfection

Human GC cell lines of HS746T, BSG823, MKN28, 9811, BGC803, MGC803 and BGC823, and normal gastric cell line of GSE1 were obtained from Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) with 10% fetal calf serum (Gibco), penicillin and streptomycin (HyClone, Logan, UT, USA) at 37°C and 5% CO2. To construct the ARF6 overexpression plasmid, a fragment containing the cDNA sequence ARF6 was amplified and cloned into pcDNA3.1 expression vector. Empty vector was used as a negative control. Synthetic siKCNQ1OT1, miR‐145‐5p‐mimic, miR‐145‐5p‐inhibitor, miR‐NC and inhibitor NC were purchased from GenePharma (Shanghai, China). For transient transfection, cells were transfected with siKCNQ1OT1 (5′‐GGTAGAATAGTTCTGTCTT‐3′), miR‐145‐5p‐mimics (5′‐GUCCAGUUUUCCCAGGAAUCCCU‐3′), miR‐145‐5p‐inhibitor (5′‐AGGGAUUCCUGGGAAAACUGGAC‐3′), miR‐NC (5′‐UUUGUACUACACAAAAGUACUG‐3′) or inhibitor NC (5′‐CAGUACUUUUGUGUAGUACAAA‐3′) with RNAiMax and Lipofectamine 2000 (#11,668,027; Thermo Fisher Scientific) in accordance with the manufacturer's instructions. The medium was changed after 6 hours. After 48 hours, cells were harvested and used for the subsequent experiments. For the stable transfection, BSG803 cells transfected with shKCNQ1OT1 or shNC were selected using puromycin for 2 weeks to generate stable clones.

Quantitative reverse transcriptase‐polymerase chain reaction (qRT‐PCR)

Total RNAs were isolated by Trizol (#15596026; Thermo Fisher Scientific). RNAs were reversely transcribed into cDNA using a reverse transcription kit (Thermo Fisher Scientific). miRNAs were isolated and reversed transcribed using a Qiagen reverse transcription kit (#205311; Qiagen, Hilden, Germany). PCR analysis was performed on an ABI Step One Real‐time PCR instrument (#4376357; Thermo Fisher Scientific). GAPDH was the internal reference for KCNQ1OT1 and U6 was the internal reference for miR‐145‐5p. The primers for KCNQ1OT1 were: forward, 5′‐CTTTGCAGCAACCTCCTTGT‐3′, reverse, 5′‐TGGGGTGAGGGATCTGAA‐3′; and miR‐145‐5p: forward, 5′‐GTCCAGTTTTCCCAGGAATCCCT‐3′, reverse, 5′‐ CGCTTCACGAATTTGCGTGTCAT‐3′. Reaction conditions were as follows: 95°C for 5 seconds, 60°C for 15 seconds and 72°C for 15 seconds, and a total of 40 cycles. The computed tomography (CT) value was obtained and the expression levels were calculated using 2‐ΔΔCT method. Fold change = 2‐ΔΔCT, which was used to present the multiple ratios of target gene expression, and the experiment was repeated three times.

Cell viability

Cell counting kit (CCK‐8) reagent (Dojindo, Japan) was used to detect cell viabilities. BSG803 cells were plated into 96‐well plates for 24 hours. Cells were transfected and incubated for 1, 2, 3 or 4 days, and then 10 μl of CCK‐8 reagent was pipetted into the plates. After 2 hours of incubation, cell viability was detected by the enzyme immunoassay analyzer (Thermo Fisher Scientific) within different groups.

Flow cytometry

Apoptotic cells were evaluated using an Annexin V‐FITC kit (#556547; BD, USA) on the second day after transfection. The apoptosis rate was determined with the Cell Quest software (Becton‐Dickinson, Franklin Lakes, NJ, USA). Cells in the right lower quadrant were regarded as apoptosis. For cell cycle analysis, 1 × 106 cells were fixed, stained by propidium iodide and evaluated by flow cytometry in 1 hour.

Apoptotic cells

Samples were firstly de‐waxed and re‐hydrated, followed by culturing in 40 μg/ml proteinase K at 37°C for 1 hour and 3% H2O2/methanol at 25°C for 30 minutes. Equilibration buffer was then added and incubated at 25°C for 5 minutes, and TdT enzyme was pipetted to the samples for incubation at 37°C for 2 hours. The reactions were stopped using stop buffer at 37°C for 30 minutes. Antidigoxigenin peroxidase was pipetted to the slide and incubated at 37°C for 30 minutes. The slide was then stained by diaminobenzine for 10 minutes and counterstained by haematoxylin. Next, 500 cells were counted in each specimen.

Colony formation assay

BSG803 cells were seeded in a six‐well plate with 400 cells per well. The culture medium was refreshed frequently. After 2 weeks, the cells were washed and fixed with 4% paraformaldehyde at 25°C for 30 minutes. Giemsa solution was used to stain the colonies for 15 minutes. Then, cells were washed and dried. A light microscope was used to measure the cell colonies. All experiments were conducted three times.

Western blotting

RIPA Reagent (Beyotime, Shanghai, China) was used to isolate proteins from cells and tissues. The protein concentrations were measured with BCA reagent (Beyotime). The same amount of protein sample (30 μg) was subjected to 10% sodium dodecyl sulfate‐polyacrylamide gel electrophoresis to separate proteins, followed by transfer to a polyvinylidene fluoride membrane (Millipore, Burlington, MA, USA). The membrane was blocked by 5% milk and treated with anti‐GAPDH (#5174; dilution 1:5000; Cell Signaling Technology, Beverly, MA, USA), anti‐ARF6 (ab264381; dilution 1:1000; Abcam, Cambridge, UK) at 4°C overnight. After incubation with a second antibody (Abcam), signals were detected by an ECL assay (Millipore).

Dual‐luciferase reporter assay

Human KCNQ1OT1 fragment was amplified and cloned into the luciferase vector (OBio Biology, Shanghai, China). The wild‐type (WT) fragment with putative miR‐145‐5p binding site was mutated and cloned into the vector to construct a mutated KCNQ1OT1 (KCNQ1OT1‐MUT). BSG803 cells were then cultured in 48‐well plates, co‐transfected by KCNQ1OT1‐WT or KCNQ1OT1‐MUT vectors and miR‐125‐5p mimics or negative control. After 2 days, cells were harvested and dual‐luciferase reporter assay (PR‐E1910; Promega, Madison, WI, USA) was performed.

Tumor growth

The 4‐week‐old female BALB/c nude mice were kept in specific pathogen‐free environment. Mice were randomly assigned to four groups. Approximately 5 × 106 BGC803 cells stably transfected with shKCNQ1OT1 or shNC were subcutaneously injected into the left forelimb of nude mice. Tumor growth was measured every 3 days, and the volume was measured using the formula V = D × d /2 (V, volume; D, longitudinal diameter; d, latitudinal diameter). Mice injected with BGC803 cells were anesthetized with phenobarbital sodium (50 mg/kg) and killed 4 weeks post‐injection, and the xenograft tumors were excised and weighed. Animal experiments were approved by the institutional Animal Care and Use Committee of the Zhuhai People's Hospital (Zhuhai Hospital affiliated with Jinan University) and performed following institutional guidelines for the use of laboratory animals.

Statistical analysis

Data are presented as the mean ± SD and analyzed using SPSS, version 19.0 (IBM Corp., Armonk, MY, USA). All experiments were repeated as least three times. Student's t‐test was used for comparison of two groups. One‐way analysis of variance was used for single factor comparison of multiple groups, and two‐way analysis of variance was used for double factor comparison. p < 0.05 was considered statistically significant.

RESULTS

The expression of KCNQ1OT1 was up‐regulated in GC

To investigate the role of KCNQ1OT1 in GC, we first detected the expression of KCNQ1OT1 in GC tissues and cells. As shown in Figure 1A, the expression levels of KCNQ1OT1 were greatly elevated in GC tissues compared to that in adjacent healthy tissues (p < 0.05) and the expression levels of KCNQ1OT1 were also elevated in GC cells (Figure 1B) (p < 0.05). Moreover, knockdown of KCNQ1OT1 suppressed tumor growth rate, volume (Figure 1C) (p < 0.05) and weight (Figure 1D, E) (p < 0.05). The terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining results showed that shKCNQ1OT1 increased the number of TUNEL‐positive cells (Figure 1F) (p < 0.05). The Ki‐67 staining results showed that shKCNQ1OT1 decreased cell proliferation (Figure 1G). In addition, shKCNQ1OT1 decreased the expression levels of KCNQ1OT1 in the resected tumor tissues (Figure 1H). Moreover, the expression levels of miR‐145‐5p were markedly increased after knockdown of KCNQ1OT1 (Figure 1I) (p < 0.05) and the expression of ARF6 was suppressed by shKCNQ1OT1 in the resected tumor tissues (Figure 1J) (p < 0.05). These results suggest that KCNQ1OT1 plays an important role in GC.

FIGURE 1

The role of KCNQ1OT1 in GC tumorigenesis. (A) The expression of KCNQ1OT1 in GC tissues and matched normal gastric tissue. (B) The expression of KCNQ1OT1 in GC cells and human normal gastric cells. (C) Tumor volumes were measured every week and growth curves are shown. (D) Tumor growth was measured (five tumors are shown in each group). (E) Tumor weight (g) was measured. (F) TUNEL staining is shown. (G) Ki‐67 staining is shown. (H) The expression of KCNQ1OT1 in tumor tissues. (I) The expression of miR‐145‐5p in tumor tissues after transfection with shNC or shKCNQ1OT1. (J) Protein expression of ARF6 in tumor tissues transfected with shNC or shKCNQ1OT1. *p < 0.05, n = 5

Knockdown of KCNQ1OT1 promoted cell apoptosis and decreased cell proliferation in vitro

To further investigate the role of KCNQ1OT1 in GC cells, shKCNQ1OT1 was used to knockdown the expression of KCNQ1OT1 in GC cells (Figure 2A). A CCK‐8 assay showed that shKCNQ1OT1 inhibited GC cell viability (Figure 2B) (p < 0.05). As shown in Figure 2C, shKCNQ1OT1 increased the expression levels of cleaved‐caspase 3, whereas it decreased the expression levels of Bcl2 and BAX in GC cells. Moreover, shKCNQ1OT1 increased cell apoptosis (Figure 2D) (p < 0.05). The colony formation assay illustrated that shKCNQ1OT1 decreased the colony number of GC cells (Figure 2E) (p < 0.05). These results suggest that knockdown of KCNQ1OT1 can reduce proliferation and promote apoptosis of GC cells.

FIGURE 2

Knockdown of KCNQ1OT1 increased cell apoptosis and reduced cell proliferation in vitro. (A) mRNA expression of KCNQ1OT1 in cells transfected with shRNA and shKCNQ1OT1. (B) A CCK‐8 assay was used to detect the cell viability of BSG803 cell line. (C) Western blotting was used to detect the expression of cleaved‐caspase 3, caspase 3, Bcl2 and Bax in cells transfected with shNC or shKCNQ1OT1. (D) Flow cytometry was used to detect cell apoptosis. (E) A colony formation experiment was used to detect cell proliferation. *p < 0.05, n = 3

miR‐145‐5p was targeted by KCNQ1OT1 in GC cells

To investigate the underlying mechanism of KCNQ1OT1 in GC, the expression of miR‐145‐5p was detected, and the results showed that the expression levels of miR‐145‐5p were decreased in GC cells (Figure 3A) (p < 0.05). Moreover, there was a significant negative relationship between KCNQ1OT1 and miR‐145‐5p in GC tissues (Figure 3B). The expression levels of miR‐145‐5p were elevated by miR‐145‐5R mimic, whereas they were inhibited by miR‐145‐5R inhibitor (Figure 3C) (p < 0.05). Moreover, as shown in Figure 3D, DIANA‐TarBase version 7.0 predicted that miR‐145‐5p shared common binding sites with KCNQ1OT1. A luciferase reporter assay demonstrated that miR‐145‐5p‐mimic decreased the luciferase activities of KCNQ1OT1‐WT cells, but had no effect on the luciferase activities of KCNQ1OT1‐MUT cells (Figure 3E) (p < 0.05). In addition, miR‐145‐5p was up‐regulated in cells transfected with shKCNQ1OT1 (Figure 3F) (p < 0.05). Similarly, KCNQ1OT1 was significantly up‐regulated by miR‐145‐5p‐inhibitor (Figure 3G) (p < 0.05). Taken together, these results suggest that miR‐145‐5p is a direct target of KCNQ1OT1 in GC cells.

FIGURE 3

miR‐145‐5p was a target of KCNQ1OT1 in gastric cancer cells. (A) Expression of miR‐145‐5p in GC cell lines and the normal gastric cell line. (B) The expression of KCNQ1OT1 was negatively correlated with miR‐145‐5p expression. (C) Expression of miR‐145‐5p in BSG803 cells transfected with miR‐NC, miR‐145‐5p‐mimic, inhibitor NC and miR‐145‐5p‐inhibitor. (D) The shared binding sequences between KCNQ1OT1 and miR‐145‐5p were predicted by TarBase, version 7.0. (E) The relative luciferase activities of BSG803 cells were detected after co‐transfection with miR‐NC or miR‐145‐5p‐mimic and control (ctrl), KCNQ1OT1‐WT or KCNQ1OT1‐MUT. (F) The expression of miR‐145‐5p in BSG803 cells was detected after transfection with shNC or shKCNQ1OT1. (G) The expression of KCNQ1OT1 in BSG803 cells was detected after transfection with miR‐NC, miR‐145‐5p‐mimic, inhibitor NC and miR‐145‐5p‐inhibitor. *p < 0.05, n = 3

The effects of KCNQ1OT1 were mediated by miR‐145‐5p in GC cells

As shown in Figure 4A and D, CCK‐8 and colony formation demonstrated that shKCNQ1OT1 inhibited GC cell proliferation (p < 0.05), whereas shKCNQ1OT1 + miR‐145‐5p‐inhibitor attenuated the effect of shKCNQ1OT1 on GC cell proliferation (p < 0.05). As shown Figure 4B and C, down‐regulation of KCNQ1OT1 increased cell apoptosis (p < 0.05), whereas this effect was attenuated by co‐transfecting with miR‐145‐5p‐inhibitor (p < 0.05).

FIGURE 4

The effects of KCNQ1OT1 were mediated by miR‐145‐5p in GC cells. (A) A CCK‐8 assay was used to detect the cell viabilities in GC cells transfected with control (ctrl), shKCNQ1OT1 or shKCNQ1OT1 + miR‐145‐5p‐inhibitor. (B) Western blotting was used to detect the protein levels of cleaved‐caspase 3, Bcl2, Bax and GAPDH in BSG803 cells transfected with control (ctrl), shKCNQ1OT1 or shKCNQ1OT1 + miR‐145‐5p‐inhibitor. (C) Flow cytometry was used to detect cell apoptosis in BSG803 cells transfected with control (ctrl), shKCNQ1OT1 or shKCNQ1OT1 + miR‐145‐5p‐inhibitor. (D) A colony formation experiment was used to detect the cell proliferation in BSG803 cells transfected with control (ctrl), shKCNQ1OT1 or shKCNQ1OT1 + miR‐145‐5p‐inhibitor. *p < 0.05, n = 3

ARF6 was targeted by miR‐145‐5p

TargetScan (http://www.targetscan.org) predicted that ARF6 was a target of miR‐145‐5p (Figure 5A). Dual luciferase reporter assay showed that ARF6‐WT repressed the luciferase activities of miR‐145‐5p in BSG803 cells (Figure 5B) (p < 0.05). Moreover, miR‐145‐5p mimic decreased the expression levels of ARF6 (Figure 5C) (p < 0.05), whereas miR‐145‐5p inhibitor enhanced the expression levels of ARF6 (Figure 5C) (p < 0.05). Furthermore, the expression levels of ARF6 were decreased after treatment with shKCNQ1OT1 (Figure 5D) (p < 0.05). The expression levels of ARF6 were increased in GSE‐1, HS‐746 T, BSG823, MKN‐28, 9811, BGC803, MGC 803 and BGC823 cells (Figure 5E) (p < 0.05). In addition, the expression levels of ARF6 were increased in GC tissues compared to that in adjacent tissues (Figure 5F) (p < 0.05). Taken together, these results suggest that ARF6 is targeted by miR‐145‐5p.

FIGURE 5

ARF6 was a target of miR‐145‐5p. (A) The shared common binding sequences were predicted between miR‐145‐5p and ARF6. (B) Luciferase activities were detected in GS cells co‐transfected with control, ARF6‐WT or ARF6‐MUT. (C) Western blotting was used to detect the protein expression of ARF6 in GC cells transfected with miR‐NC, miR‐145‐5p‐mimic, inhibitor NC or miR‐145‐5p‐inhibitor. (D). Western blotting was used to detect the protein expression of ARF6 in cells transfected with shNC or shKCNQ1OT1. (E) mRNA expression of ARF6 was detected in GSE‐1, HS‐746 T, BSG823, MKN‐28, 9811, BGC803, MGC 803 and BGC823. (F) The expression of ARF6 was detected in adjacent tissues and cancer tissues. *p < 0.05, n = 3

ARF6 regulated KCNQ1OT1 in GC cells

To examine the role of ARF6 in GC cells, miR‐NC, miR‐145‐5p mimic or miR‐145‐5p mimic + pc‐ARF6 was transfected into GC cells. The expression levels of ARF6 were greatly increased in cells transfected with pc‐ARF6 compared to that with pc‐NC (Figure 6A) (p < 0.05). Cell viability was largely inhibited in cells transfected with miR‐145‐5p, whereas it was attenuated in cells transfected with pc‐ARF6 (Figure 6B) (p < 0.05). The flow cytometry assay results showed that miR‐145‐5p mimic promoted cell death, whereas pc‐ARF6 attenuated this effect (Figure 6C) (p < 0.05). Similarly, miR‐145‐5p mimic significantly suppressed cell colony formation, whereas ARF6 attenuated this effect (Figure 6D) (p < 0.05). Overall, our results suggest that the role of KCNQ1OT1 is regulated by ARF6 in GC cells.

FIGURE 6

ARF6 mediated KCNQ1OT1 regulation in GC cells. (A) mRNA expression of ARF6 was detected in cells transfected with pc‐NC or pc‐ARF6. (B) Cell viability (left) and apoptosis rate (right) in cells were detected after transfection with miR‐NC, miR‐145‐5p mimic or miR‐145‐5p mimic + pc‐ARF6. (C) Flow cytometry was used to detect the cell apoptosis in cells transfected with miR‐NC, miR‐145‐5p mimic or miR‐145‐5p + pc‐ARF6. (D) A colony formation assay was used to detect the proliferation of cells transfected with miR‐NC, miR‐145‐5p mimic or miR‐145‐5p mimic + pc‐ARF6. *p < 0.05, n = 3

DISCUSSION

Individuals who are infected with H. pylori have a much higher risk of contracting GC. It is crucial and necessary to develop effective and efficient diagnostic and prognostic markers to perform accurate early diagnostics and precise predictions of treatments. In recent years, lncRNAs have attracted increasing attention because of their oncogenic role in the development and progression of human cancers. In the present study, for the first time, we found that KCNQ1OT1 was significantly up‐regulated in GC tissues and cells. Knockdown of KCNQ1OT1 inhibited tumor growth rate, tumor volume and weight in vivo.

It has been reported that KCNQ1OT1 is involved in different types of cancer, such as lung adenocarcinoma, tongue cancer, colorectal cancers and hepatocellular carcinoma. Moreover, the expression of KCNQ1OT1 was found to be up‐regulated in glioma tissues and cells. This is consistent with our finding that KCNQ1OT1 was up‐regulated in GC tissues and cells. Furthermore, it has also been reported that inhibition of KCNQ1OT1 impeded the malignant progression of glioma cells. In the present study, knockdown of KCNQ1OT1 was found to inhibit tumor growth rate, tumor volume and tumor weight in vivo, as well as inhibit GC cell proliferation, and also increased cleaved‐caspase 3 protein expression and GC cell apoptosis. These findings suggest that KCNQ1OT1 plays an important role in GC proliferation and apoptosis.

The regulatory role of miR‐145 has been widely investigated in GC. For example, it was reported that miR‐145 inhibited the proliferation, migration, invasion and cell cycle progression via targeting transcription factor Sp1 in GC. Another study demonstrated that decreased expression levels of miR‐145 were closely related to human GC. In the present study, we found that miR‐145‐5p was a target of KCNQ1OT1 and its expression levels were significantly decreased in GC cell lines. Moreover, the expression of miR‐145‐5p was correlated with the expression of KCNQ1OT1 and miR‐145‐5p was a direct target of KCNQ1OT1 in GC cells. In addition, miR‐145 was reported to have anti‐proliferation and gene‐regulation effects on vitamin D3 through targeting E2F3 in GC cells. Another study revealed the molecular mechanism of miR‐145 in the suppression of invasion‐metastasis cascade in GC. In the present study, we found that down‐regulation of KCNQ1OT1 inhibited GC cell proliferation and induced GC cell apoptosis, whereas miR‐145‐5p inhibition attenuated the effect of knockdown of KCNQ1OT1 on cell proliferation and apoptosis. To the best of our knowledge, the present study is the first to report that the functions of KCNQ1OT1 in GC cells are mediated by miR‐145‐5p.

Accumulative evidence has suggested that ARF6 participates in the signaling pathway of GC. For example, it was reported that EGF decreased Wnt5a transcription induced epithelial‐mesenchymal transition via ARF6‐ERK signaling in GC cells. The present study identified that ARF6 was a target of miR‐145‐5p. Moreover, the expression levels of ARF6 increased after treatment with shKCNQ1OT1, suggesting that KCNQ1OT1 may promote GC progression through the miR‐145‐5p/ARF6 axis. Because ARF6‐ERK signaling was also reported to be involved in GC, we will continue investigating the downstream signaling pathway of KCNQ1OT1/miR‐145‐5p/ARF6 axis in GC in our future work, aiming to further elucidate the underlying mechanism of KCNQ1OT1 in GC.

CONCLUSIONS

KCNQ1OT1 contributes to GC progression by regulating the miR‐145‐5p/ARF6 axis and it may serve as a therapeutic target and diagnostic biomarker for GC.

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no conflicts of interest.

AUTHOR CONTRIBUTIONS

XDZ and XYW were responsible for analyzing and interpreting the patient data, performing experimental work and writing the manuscript. LC, NG and XCY were responsible for data analysis, performing experimental work and writing the manuscript. KS was responsible for data analysis, literature research, research design and editing the manuscript. All authors have read and approved the final version of the manuscript submitted for publication.

ETHICAL APPROVAL

This research was carried out with ethic approval from Zhuhai People's Hospital (Zhuhai Hospital affiliated with Jinan University). All participants were informed of the details of the experimental designed prior to study commencement and informed consent was signed by all of them. Our animals' experiments were conducted by the Guide for the Care and Use of Laboratory Animals of the NIH (Bethesda, USA) and received the ethic approval from Zhuhai People's Hospital (Zhuhai Hospital affiliated with Jinan University).