Literature DB >> 33588605

Kinesin Family Member C1 Increases Temozolomide Resistance of Glioblastoma Through Promoting DNA Damage Repair.

Jianheng Wu1, Xinjun Wang1, Xiaowei Yuan1, Qiao Shan1, Zhen Wang1, Yuehui Wu1, Jingwei Xie1.   

Abstract

Glioblastoma (GBM) is one of the most frequent primary malignant brain tumors with a poor prognosis. Unfortunately, due to the intrinsic or acquired chemoresistance of GBM cells, it easily becomes refractory disease and tumors are easy to recur. Therefore, it is critical to elucidate the molecular mechanisms underlying the chemoresistance of GBM cells to discover more efficient therapeutic treatments. Kinesin family member C1 (KIFC1) is a normal nonessential kinesin motor that affects the progression of multiple types of cancers. However, whether KIFC1 have a function in GBM is still unexplored. Here we found that KIFC1 was upregulated in human temozolomide (TMZ)-resistant GBM tissues. KIFC1 silencing is sufficient to inhibit GBM cell proliferation and amplify TMZ-induced repression of cell proliferation. Mechanistically, KIFC1 silencing contributed to DNA damage, cell cycle arrest, and apoptosis through regulating Rad51, Akt, and DNA-PKcs phosphorylation. We also noticed that KIFC1 silencing also inhibited tumor formation and increased TMZ sensitivity through regulating Ki67, Rad51, γ-H2AX, and phosphorylation of AKT in vivo. Our findings therefore confirm the involvement of KIFC1 in GBM progression and provide a novel understanding of KIFC1-Akt axis in the sensitivity of GBM to chemotherapy.

Entities:  

Keywords:  KIFC1-Akt axis; TMZ resistant; glioblastoma (GBM); kinesin family member C1 (KIFC1); proliferation

Mesh:

Substances:

Year:  2021        PMID: 33588605      PMCID: PMC7894588          DOI: 10.1177/0963689721991466

Source DB:  PubMed          Journal:  Cell Transplant        ISSN: 0963-6897            Impact factor:   4.064


Introduction

Glioblastoma (GBM) is the most common primary malignant brain tumor in adults with a median survival time of approximately 1 year. Even in the most favorable situations, most patients die within 2 years[1,2]. The standard treatments for GBM are surgical excision and temozolomide (TMZ) chemotherapy plus radiation, which is more effective than radiation alone[3]. However, most patients develop refractory disease and tumor recurrence due to the intrinsic or acquired chemoresistance of GBM cells[4]. Therefore, it is critical to elucidate the molecular mechanisms underlying the chemoresistance of GBM cells to discover more efficient therapeutic treatments. TMZ is an SN1 methylation chemotherapeutic agent that can pass the blood-brain barrier. TMZ can be spontaneously hydrolyzed to form the methyl diazonium (MDI) ions that methylate DNA at multiple sites, leading to critical DNA lesion[5]. Akt serine/threonine kinase (Akt) can affect the stability and nuclear localization of human post meiotic segregation increased 2 (hPMS2), which binds to the mismatch recognition complexes that facilitate repair to repress mismatch repair, resulting in resistance to treatment and accumulation of mutations[6]. Several factors have been identified to be involved in the process of TMZ resistance such as mismatch repair status, loss of p53 function, or activation of the Akt pathway[7-9]. However, the mechanisms deciphering acquired TMZ resistance have not been fully characterized, and the potential targets related to TMZ resistance are still under investigation. Kinesin family member C1 (KIFC1) is a normal nonessential kinesin motor, which plays a key role in centrosome clustering, and is therefore vital for the survival of cancer cells. KIFC1 has been reported to play roles in vesicular trafficking, germ cell development, and double-stranded DNA transportation[10-12]. The expression of KIFC1 is increased in ovarian cancer, breast cancer, and non-small cell lung cancer[13,14]. In addition, KIFC1 is a driver of invasion, proliferation, and self-renewal in GBM, and suppression of the expression of KIFC1 leads to prolonged mitotic arrest and cell death[15]. Moreover, KIFC1 can be used as target in docetaxel-mediated apoptosis in breast cancer cells. However, whether KIFC1 has a function in GBM is still under investigation. Previous studies have found that in cancer cells lacking DNA damage repair, even without amplified centrosomes, KIFC1 depletion shows synthetic lethal effects[6,16]. Whether KIFC1 is related to DNA repair in GBM needs further study. In addition, KIFC1 can promote tumor progression by activating the Akt pathway[17]. It is speculated that KIFC1 may regulate DNA damage repair in GBM cells by activating the Akt pathway, thereby affecting the sensitivity of GBM cells to TMZ. The results of this study may provide theoretical basis for the potential value of targeting KIFC1 in the diagnosis and treatment of TMZ-resistant GBM. Here, we found that KIFC1 was upregulated in both recurrent and primary GBM patients. High KIFC1 level was associated with the poor prognosis of patients with GBM. In addition, we observed that inhibition of KIFC1 activity increased the sensitivity of GBM cell to TMZ and reduced DNA repair capacity of tumor cells. Our results further revealed that KIFC1 silencing contributed to cell cycle arrest, stimulated cell apoptosis and reduced the expression of Rad51, phosphorylation of Akt and DNA-PK in GBM cells. Overexpression of Akt abolished the effect of KIFC1 silencing. KIFC1 silencing inhibited tumor formation and decreased Ki67, Rad51 and phosphorylation of Akt, and increased γH2AX in vivo. Our results suggest that KIFC1 inhibition might be a promising therapeutic strategy for TMZ resistance in GBM.

Materials and Methods

Patient Samples and Cell Lines

Human GBM tissues and adjacent non-tumor samples were collected from patients in The Fifth Affiliated Hospital of Zhengzhou University. All patients included in this study approved our research. All patients only received TMZ treatment, without radiation or other therapy. All procedures performed in studies involving human participants were in accordance with the standards upheld by the Ethics Committee of The Fifth Affiliated Hospital of Zhengzhou University (Approval no. 2019 -1) and with those of the 1964 Helsinki Declaration and its later amendments for ethical research involving human subjects. And the collected tissue specimens were stocked in −80°C until use. The human glioma cell lines U138 and U251 were purchased from American Type Culture Collection (ATCC, LGC Standards, GmbH, Wesel, Germany) and Procell (Wuhan, China), respectively.

Quantitative Polymerase Chain Reaction

Total RNAs were extracted from human tissue samples and cell lines by TRIzol (Invitrogen, Carlsbad, California, USA) reagent according to manufacturer’s protocol. The reverse transcription was conducted by using reverse transcriptase (M1701, Promega, Madison, Wisconsin, USA) to establish cDNA profiles of each sample. Quantitative polymerase chain reaction (PCR) was conducted by using SYBR Ex Taq kit (Takara, Osaka, Japan), and the expression levels of KIFC1 were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) level. Primers used in this assay are listed as follows—KIFC1: forward: 5′-AGAAACCCAGCAAACGTCCA-3′, reverse: 5′-AGTTGGGACATCAGTCCCCT-3′ and GADPH: forward: 5′-ACCACAGTCCATGCCATCAC-3′; reverse: 5′-TCCACCACCCTGTTGCTGTA-3′.

Immunohistochemistry

We performed immunohistochemistry (IHC) staining to examine the KIFC1 expression levels in each tissue. Briefly, 5 µm slices were fixed with 4% paraformaldehyde (PFA) at room temperature for 30 min and subsequently blocked with 2% bovine serum albumin (BSA) for 1 h. Subsequently, slides were incubated with rabbit anti-KIFC1 antibody (1:200; ABclonal, Wuhan, China) overnight at 4°C. The following day, the sections were stained with biotinylated secondary antibody for 1 h, and diaminobenzidine was used as a chromogen substrate.

3-(4,5-Dimethyl-thiazol-2-yl)-2,5-Diphenyltetrazolium Assay

U138 and U251 cells were seeded into 96-well plates for 24 h and then treated with different concentrations of TMZ. The adherent cells were fixed with PFA in phosphate buffered saline (PBS) for 10 min and then stained with 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium (MTT) solution (5 mg/ml). Finally, the absorbance at 492 nm was measured with a GF-M3000 microplate reader (CAIHONG, Shandong, China). The cell viability was calculated as the ratio of the absorbance values of treated and untreated cells.

Cell Cultures, Transfection, and RNA Interference

U138 and U251 cells were maintained in Dulbecco’s modified Eagle’s medium (Invitrogen Life Technologies, Carlsbad, CA, USA), containing of 10 mM HEPES (Invitrogen Life Technologies), 10% heat-inactivated fetal bovine serum (Irvine Scientific, Santa Ana, CA, USA), 100 U/ml penicillin, and 100 μg/ml streptomycin. TMZ-resistant U138 and U251 cells, termed U138 R and U251 R, were obtained by treatment with sequentially increasing the concentration of TMZ (2–100 μM) for approximately 4 months. U138 R and U251 R showed at least 10-fold resistance to TMZ. Transfection of short hairpin RNA (shRNA) was achieved with Lipofectamine 2000 reagent (Invitrogen). Commercialized lentiviral vectors expressing KIFC1 shRNAs were purchased from GeneCopoeia (Texas, USA). Target sequences were as follows: sh1: 5′-GCAACATCCGTGTATTCTGCC-3′; sh2: 5′-CCAGGGCTATCAAATAAAGAA-3′. Transfection efficiency was verified by immunoblot analysis. siRNA sequences were listed as follows—sense: TTTGTAGTCATTGTCCTCCAGCACAGCTGGAGGACAATGACTACTTTTT and antisense: CTAGAAAAAGTAGTCATTGTCCTCCAGCTGTGCTGGAGGACAATGACTA. Human Akt sequence was constructed.

Immunoblot Analysis

Proteins were separated through sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto a polyvinylidene difluoride membrane. Then the membranes were blocked in 5% skim milk in Tris-buffered saline for 2 h and then incubated with the indicated antibody including: anti-KIFC1 antibody (1:1,000, Abcam, Cambridge, MA, USA), Phos-Akt (phospho T308; 1:1,000 dilution, Abcam), Akt1/2 (1:1,000 dilution, Abcam), Rad51 (1:1,000 dilution, Santa Cruz, Dallas, TX, USA), Phospho-DNA-PK (1:1,000 dilution, CST, Boston, USA), and GAPDH (1:10,000 dilution, Abcam) overnight at 4°C. Then the membranes were incubated with secondary antibodies for 1 h at room temperature. Signals were visualized with the enhanced chemiluminescence system. Quantification in the immunoblot was performed by ImageJ software.

Colony Formation Assays

Cells transfected with indicated plasmids were seeded into a six-well culture plate for 24 h. After culturing for 2 weeks, the cells were fixed with PFA (polyformaldehyde), stained with 0.2% crystal violet buffer for 30 min, and washed with PBS. Then the colonies were photographed and the colony numbers were analyzed in each group.

Cell Cycle Assay

The cell cultures were conducted as following. After digested with trypsin enzyme, cells were collected. Then, the ethanol fixed cells were washed with PBS and treated with RNase I at 37°C for 30 min. Finally, the cells were stained with propidium iodide at 4°C for additional 30 min and then examined by a flow cytometer (FACSCalibur; BD Biosciences, New Jersey, USA). Data were analyzed using CellQuest Pro software, version 6 (BD Biosciences).

Terminal Deoxynucleotidyl Transferase 2’-Deoxyuridine 5’-Triphosphate (dUTP) Nick End Labeling Staining Assay

Cells were fixed in 4% PFA and washed with PBS. Terminal deoxynucleotidyl transferase 2’-deoxyuridine 5’-triphosphate (dUTP) nick end labeling staining kit (6432344001, Merck, New Jersey, USA) was purchased from Merck. And terminal deoxynucleotide transferase and luciferin-labeled dUTP were used for quantitative detection. The cells were then added with precooled 70% ethanol and incubated for 30 min. And then cells were resuspended in staining solution containing 4’,6-diamidino-2-phenylindole (DAPI) and incubated for 60 min at 37ºC. The staining was analyzed with fluorescence microscope.

Immunofluorescence Staining

Cells were fixed in 4% PFA and washed with PBS containing 0.1% (v/v) Triton-X-100 solution. Then the cells were blocked in 2% BSA in PBS. Subsequently cells were stained with mouse anti-γH2AX (1:500 dilution, Sigma, USA) primary antibody. Then cells were incubated with secondary antibody conjugated with Alexa 488 (Molecular Probes, Life Technologies Japan, Tokyo, Japan). After the cells were counterstained with DAPI, digital images were acquired using fluorescence microscopy (DP72, Olympus, Tokyo, Japan).

Tumor Growth Assays

All animal studies in this study were approved by the Ethics Committee of The Fifth Affiliated Hospital of Zhengzhou University (Approval no. 2019 -1). Female BALB/c nude mice (8-week-old; weight, ∼22 g) were supplied by Beijing Vital River Laboratory Animal Technology (Beijing, China). Mice were fed with food and water ad libitum, and were kept at a specific pathogen-free level at 20°C and a humidity of 60%, alternating between light and dark for 12 h. Six mice were used in each group, and all mice were given adequate food and water and did not die normally. U138 cells were infected with control or KIFC1 shRNA lentivirus to stably knockdown KIFC1. Approximately 5 × 105 KIFC1 depleted cells or control U138 R cells were subcutaneously implanted into nude mice (six mice per group) to induce tumor and treated with TMZ at the concentration of 1 mM every day with subcutaneous injection. After 4 weeks, tumors were excised, and the volume and weight of each tumor was measured.

Statistics

GraphPad 6.0 was used for data analysis in this study. All data in this study were representative of at least three independent experiments. Results were displayed as mean ± standard error of the mean. * indicates P < 0.05, and ** indicates P < 0.01.

Results

KIFC1 Level is Elevated in Human TMZ-resistant GBM Tissues

To detect the expression levels of KIFC1, a total of 58 patient samples collected in our hospital were included in this study, and the clinical characteristics of participants were listed in Table 1. After surgical excision and TMZ chemotherapy, GBM relapsed in 30 patients. Brain samples including primary, recurrent GBM and paired normal tissue were subjected to quantitative PCR assays. Notably, we found that the mRNA level of KIFC1 was significantly increased in primary and recurrent GBM tissues compared to the normal tissues (Fig. 1A). Meanwhile, we also observed a reduced KIFC1 expression in recurrent tumors in six (20%) patients and increased KIFC expression in nine (30%) patients in recurrent GBM compared with primary GBM tissues. To further verify the expression levels of KIFC1 in patients with GBM, we performed IHC assays. Consistently, we found that the KIFC1 expression level was increased in primary and recurrent GBM tissues compared with normal tissues (Fig. 1B). Interestingly, the expression levels of KIFC1 were higher in recurrent tissues than that in primary GBM tissues (Fig. 1B). Therefore, we demonstrated the elevated expression level of KIFC1 in human GBM tissues, especially in recurrent tumor tissues. Furthermore, according to the staining intensity of KIFC1 in GBM tissues, GBM patients were divided into two groups. We analyzed the correlations between KIFC1 levels and prognosis of patient with GBM. We found that patients with high expression of KIFC1 tended to have lower overall survival and progression-free survival rates, suggesting the poor prognosis. These data suggested that KIFC1 was upregulated in GBM tissues and negatively associated with the prognosis of patients with GBM (Fig. 1C).
Table 1.

Relationship Between KIFC1 Expression and Clinicopathological Parameters.

ParametersKIFC1 expression P value
Low (<median)High (≥median)
Number2929
Gender
 Male16150.792
 Female1314
Age (years)
 ≥Mean (45)11140.426
 <Mean (45)1815
IDH1 status
 Not mutant20110.018
 Mutant918
Chemotherapy
 Yes20110.049
 No814
 NA14
Radiotherapy
 Yes19150.063
 No109
 NA05
KPS
 ≥7020100.009
 <70919
WHO grade
 III15130.599
 IV1416

KIFC1: Kinesin family member C1; KPS: Karnofsky; NA: Not Applicable.

Fig. 1.

KIFC1 level is elevated in human TMZ-resistant GBM tissues. (A) Quantitative PCR assays depicted the higher mRNA levels of KIFC1 in 30 recurrent and primary GBM tissues. (B) Results from IHC assays revealed increased KIFC1expression in 30 recurrent and primary GBM tissues comparing normal tissues. Representative images were displayed (100× and 200× magnification, respectively). (C) The Kaplan–Meier Plot analysis was performed, and the overall survival rate and progression-free survival rate of GBM prognosis between KIFC1 high and low patients were exhibited. The survival analysis did not include nonrelapsed patients, and the plots were based on the expression at the time of relapse. X-axis represented for months. Results are presented as mean ± SD, *P < 0.05; **P < 0.01. GBM: glioblastoma; IHC: immunohistochemistry; KIFC1: kinesin family member C1; PCR: polymerase chain reaction; SD: standard deviation; TMZ: temozolomide.

Relationship Between KIFC1 Expression and Clinicopathological Parameters. KIFC1: Kinesin family member C1; KPS: Karnofsky; NA: Not Applicable. KIFC1 level is elevated in human TMZ-resistant GBM tissues. (A) Quantitative PCR assays depicted the higher mRNA levels of KIFC1 in 30 recurrent and primary GBM tissues. (B) Results from IHC assays revealed increased KIFC1expression in 30 recurrent and primary GBM tissues comparing normal tissues. Representative images were displayed (100× and 200× magnification, respectively). (C) The Kaplan–Meier Plot analysis was performed, and the overall survival rate and progression-free survival rate of GBM prognosis between KIFC1 high and low patients were exhibited. The survival analysis did not include nonrelapsed patients, and the plots were based on the expression at the time of relapse. X-axis represented for months. Results are presented as mean ± SD, *P < 0.05; **P < 0.01. GBM: glioblastoma; IHC: immunohistochemistry; KIFC1: kinesin family member C1; PCR: polymerase chain reaction; SD: standard deviation; TMZ: temozolomide.

KIFC1 Depletion Promotes GBM Cell Sensitivity Toward TMZ and Inhibits Colony Formation

We then detected the effects of KIFC1 on the proliferation and apoptosis of U138 and U251 cells through MTT, colony formation, and flow cytometry (FCM) assays. Interestingly, our data confirmed that KIFC1 depletion inhibited the proliferation of both U138 and U251 cells (Supplemental Fig. S1A, B). Additionally, our data further confirmed that KIFC1 knockdown stimulated the apoptosis of U138 and U251 cells (Supplemental Fig. S1C). To further investigate the function of KIFC1 in GBM progression, TMZ-resistant U138 and U251 cells were obtained by treatment with sequentially increasing the concentration of TMZ. After 4 months of incubation, U138 and U251 cells developed resistance to TMZ and were marked as U138 R and U251 R cells. According to the results, TMZ treatment obviously decreased the viability of U138 and U251 cells, with the IC50 of 27.03 and 22.54 μmol/l, respectively. The IC50 of U138 R and U251 R cells were up to 805.1 and 505.2 μmol/l, respectively (Fig. 2A). Meanwhile, we observed the increased expression of KIFC1 in U138 R and U251 R cells, which was proved by quantitative PCR assays (Fig. 2B). Similarly, the protein level of KIFC1 was also increased in U138 R and U251 R cells.
Fig. 2.

KIFC1 silencing promoted GBM cell sensitivity toward TMZ and inhibited colony formation. (A) The viability of U138, U138 R, U251, and U251 R cells exposed to elevated concentration of TMZ was detected and IC50 was displayed through MTT assays. (B, C) The relative level of KIFC1 in U138, U138 R, U251, and U251 R cells was examined through quantitative PCR assays and immunoblot assays. (D) Silencing efficiency of KIFC1 was verified by immunoblot assays in U138 R and U251 R cells. (E) The viability of U138 R and U251 R cells with or without KIFC1 knockdown exposed to elevated concentration of TMZ was detected and IC50 was displayed through MTT assays. (F) Photographs displayed the reduced colony formation in TMZ treatment plus KIFC1 silencing. The relative colony formation levels were quantified. GBM: glioblastoma; KIFC1: kinesin family member C1; MTT: 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium; PCR: polymerase chain reaction; TMZ: temozolomide.

KIFC1 silencing promoted GBM cell sensitivity toward TMZ and inhibited colony formation. (A) The viability of U138, U138 R, U251, and U251 R cells exposed to elevated concentration of TMZ was detected and IC50 was displayed through MTT assays. (B, C) The relative level of KIFC1 in U138, U138 R, U251, and U251 R cells was examined through quantitative PCR assays and immunoblot assays. (D) Silencing efficiency of KIFC1 was verified by immunoblot assays in U138 R and U251 R cells. (E) The viability of U138 R and U251 R cells with or without KIFC1 knockdown exposed to elevated concentration of TMZ was detected and IC50 was displayed through MTT assays. (F) Photographs displayed the reduced colony formation in TMZ treatment plus KIFC1 silencing. The relative colony formation levels were quantified. GBM: glioblastoma; KIFC1: kinesin family member C1; MTT: 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium; PCR: polymerase chain reaction; TMZ: temozolomide. To investigate the possible function of KIFC1 on TMZ sensitivity, KIFC1 shRNA was transfected into U138 R and U251 R cells to downregulate its expression. We found that KIFC1 shRNA significantly reduced the expression levels of KIFC1 in U138 R and U251 R cells, confirmed by immunoblot assay (Fig. 2D). Subsequently the cell viability in control and KIFC1 depleted cells was measured. We noticed that KIFC1 depletion significantly sensitized TMZ, with the IC50 of 785.7 μmol/l in control cells and 325.3 μmol/l in KIFC1 depleted U138 R cells, and 474.6 μmol/l in control cells and 169.7 μmol/l in KIFC1 depleted U251 R cells, respectively (Fig. 2E). In addition, we observed a significant reduction in colony formation following KIFC1 knockdown in U138 R and U251 R cells (Fig. 2F). Taken together, our findings suggested that KIFC1 depletion promoted GBM cell sensitivity toward TMZ via inhibiting cell proliferation.

KIFC1 Silencing Contributed to Cell Cycle Arrest and Stimulated Cell Apoptosis in GBM Cells

To further explore the mechanism underlying the effects of KIFC1 on GBM, cell cycle analysis was performed in U138 R and U251 R cells with or without TMZ treatment and KIFC1 knockdown. Our results showed that the addition of TMZ minimally affected cell cycle and KIFC1 knockdown led to increased cell percentage in G1 phase compared with control group in U138 R and U251 R cells (Fig. 3A). In addition, we also evaluated the effect of KIFC1 on GBM cell apoptosis. Interestingly, we noticed that knockdown of KIFC1 promoted severe DNA damage compared with control cells, while TMZ treatment led to DNA damage (Fig. 3B). Taken together, our findings suggested that KIFC1 silencing contributed to cell cycle arrest and promoted cell apoptosis.
Fig. 3.

KIFC1 silencing contributed to cell cycle arrest and apoptosis. (A) Cell cycle analysis of control or KIFC1 depleted GBM cells exposed to TMZ or not was performed. Quantitative analysis of cell percentage in indicated cell cycle was listed. (B) TUNEL staining of indicated group of cells was performed in GBM cells. GBM: glioblastoma; KIFC1: kinesin family member C1; TMZ: temozolomide; TUNEL: terminal deoxynucleotidyl transferase 2’-deoxyuridine 5’-triphosphate (dUTP) nick end labeling.

KIFC1 silencing contributed to cell cycle arrest and apoptosis. (A) Cell cycle analysis of control or KIFC1 depleted GBM cells exposed to TMZ or not was performed. Quantitative analysis of cell percentage in indicated cell cycle was listed. (B) TUNEL staining of indicated group of cells was performed in GBM cells. GBM: glioblastoma; KIFC1: kinesin family member C1; TMZ: temozolomide; TUNEL: terminal deoxynucleotidyl transferase 2’-deoxyuridine 5’-triphosphate (dUTP) nick end labeling.

KIFC1 Silencing Led to the Defect in DNA Damage Repair in U138 R and U251 R Cells

It is well known that DNA damage is always associated with the abnormal cell cycle. Therefore, we detected whether TMZ induced cell cycle arrest by promoting DNA damage. We conducted immunofluorescence assays to quantify γ-H2AX staining (evaluation of DNA strand breaks caused by repair incision nucleases) degree in the nuclei of U138 R and U251 R cells, which represented DNA damage degree. We observed a significant increase in the number of γ-H2AX foci in the nuclei of KIFC1 depleted U138 R and U251 R cells (Fig. 4A). Coincidently, the expression levels of phosphorylated DNA-PKcs and Rad51 protein were decreased in KIFC1 depleted U138 R and U251 R cells compared with control cells as assessed by immunoblot. Phosphorylated DNA-PKcs resulted in a reduction of DNA repair activity and NHEJ ability (Fig. 4B). Therefore, we assumed that KIFC1 silencing led to DNA damage in TMZ-resistant GBM cells.
Fig. 4.

KIFC1 silencing led to DNA damage in U138 R and U251 R cells. (A) Immunofluorescence of γH2AX staining showed KIFC1 depletion led to DNA damage in U138 R and U251 R cells. The cells were treated with TMZ at the concentration of 500 μM for 48 h. The transfection of KIFC1 shRNA was performed after the treatment of TMZ for 24 h and maintained for 24 h. And the immunostaining was performed at 48-h time point, then these pictures were taken. (B) Immunoblot assays depicted that KIFC1 silencing downregulated Rad51 and phosphorylated DNA-PK protein level. KIFC1: kinesin family member C1; shRNA: short hairpin RNA; TMZ: temozolomide.

KIFC1 silencing led to DNA damage in U138 R and U251 R cells. (A) Immunofluorescence of γH2AX staining showed KIFC1 depletion led to DNA damage in U138 R and U251 R cells. The cells were treated with TMZ at the concentration of 500 μM for 48 h. The transfection of KIFC1 shRNA was performed after the treatment of TMZ for 24 h and maintained for 24 h. And the immunostaining was performed at 48-h time point, then these pictures were taken. (B) Immunoblot assays depicted that KIFC1 silencing downregulated Rad51 and phosphorylated DNA-PK protein level. KIFC1: kinesin family member C1; shRNA: short hairpin RNA; TMZ: temozolomide.

KIFC1 Silencing Inhibited DNA Repair via Akt Pathway in GBM Cells

Accumulating evidences indicate that Akt is directly involved in the regulation of DNA repair and chemoresistance. Akt targeting leads to an inhibition of repair of radiation-induced DNA double-strand break. Thus, we explored the possible involvement of Akt pathway in KIFC1-mediated DNA repair. We detected the change of Akt signaling pathways and found a decrease in phosphorylated Akt levels in KIFC depleted cells (Fig. 5A). Moreover, to further explore the involvement of Akt in DNA damage caused by KIFC1 silencing, we conducted Akt1/2 knockdown in U138 and U251 cells, respectively. We observed a significant reduction of phosphorylated Akt, Rad51, and phosphorylated DNA-PKcs, which was critical for DNA repair, after Akt1/2 knockdown (Fig. 5B). The phosphorylation of DNA-PKcs is required and essential for efficient repair of DNA-DSBs during NHEJ. Enhanced cellular sensitivity to iridium (IR) after mutations in these phosphorylation sites supports the specific function of DNA-PKcs phosphorylation in DNA-DSBs repair. Thus, reduced phosphorylated DNA-PKcs indicated impaired DNA repair. Consistently, Akt1/2 knockdown also increased γ-H2AX foci in the nuclei of KIFC1 depleted U138 and U251 cells, suggesting that Akt silencing induced DNA damage (Fig. 5C). Furthermore, to confirm whether DNA damage caused by KIFC1 silencing could be reversed by Akt, we overexpressed Akt in KIFC1 depleted GBM cells. As expected, we found that the reduction of Rad51 and phosphorylated DNA-PKcs induced by KIFC1 knockdown were abrogated by Akt overexpression (Fig. 5D). Meanwhile, Akt overexpression reduced the level of γ-H2AX induced by KIFC1 knockdown. We therefore demonstrated that overexpression of Akt could rescue the defects of DNA damage repair after KIFC1 silence (Fig. 5E). In conclusion, these data confirmed that KIFC1 affects cell DNA damage repair via Akt pathway.
Fig. 5.

KIFC1 silencing inhibited DNA repair via reducing Akt phosphorylation in U138 R and U251 R cells. (A) Immunoblot assay displayed reduced phosphorylated Akt following KIFC1 depletion in U138 R and U251 R cells. (B) Immunoblot assays depicted that Akt1/2 silencing downregulated Rad51 and phosphorylated DNA-PKcs protein level. (C) Immunofluorescence of γH2AX staining showed Akt knockdown led to DNA damage. (D) Akt overexpression reversed downregulation of Rad51 and phosphorylated Akt and DNA-PKcs caused by KIFC1 silencing. (E) Immunofluorescence showed Akt overexpression reversed DNA damage caused by KIFC1 silencing, through γH2AX staining. KIFC1: kinesin family member C1.

KIFC1 silencing inhibited DNA repair via reducing Akt phosphorylation in U138 R and U251 R cells. (A) Immunoblot assay displayed reduced phosphorylated Akt following KIFC1 depletion in U138 R and U251 R cells. (B) Immunoblot assays depicted that Akt1/2 silencing downregulated Rad51 and phosphorylated DNA-PKcs protein level. (C) Immunofluorescence of γH2AX staining showed Akt knockdown led to DNA damage. (D) Akt overexpression reversed downregulation of Rad51 and phosphorylated Akt and DNA-PKcs caused by KIFC1 silencing. (E) Immunofluorescence showed Akt overexpression reversed DNA damage caused by KIFC1 silencing, through γH2AX staining. KIFC1: kinesin family member C1.

KIFC1 Silencing Inhibited Tumor Formation and Increased TMZ Sensitivity In Vivo

According to previous data, KIFC1 depletion resulted in the enhancement of TMZ sensitivity in GBM. Therefore, we further detected the effects of KIFC1 on tumor growth of GBM cells in vivo. U138, U251, U138 R, and U251 R cells were infected with KIFC1 shRNA lentivirus or control lentivirus to stably downregulate KIFC1 expression. KIFC1 knockdown increased cell sensitivity toward TMZ with IC50 of 29.70 and 26.27 μmol/l in control U138 and U251 cells and IC50 of 12.64 and 8.65 μmol/l in KIFC1 knockdown U138 and U251 cells, respectively (Supplemental Fig. S2A). TMZ treatment led to decreased level of γ-H2AX and increased phosphorylated DNA-PKcs and Rad51 protein level in U138 and U251 cells (Supplemental Fig. S2B). KIFC1 depletion significantly blocked the changes caused by TMA treatment in U138 and U251 cells (Supplemental Fig. S2B). The stably transfected U138, U251, U138 R, and U251 R cells were injected into nude mice accompanied with TMZ treatment. After injection, tumors volume and weight were monitored every week. After 4 weeks, the tumors in each group were isolated and photographed. Representative photographs of tumors were acquired, and the growth curves were calculated and shown (Fig. 6A, B and Supplemental Fig. S2C–E). Interestingly, the volume of tumors isolated from KIFC1 silencing and TMZ-treated groups was significantly smaller than the merely TMZ treatment group (Fig. 6A–C and Supplemental Fig. S2C–E). Furthermore, we performed IHC assays and found that Ki67, Rad51, and the phosphorylation of Akt were remarkably decreased, and γ-H2AX was increased in KIFC1 depleted group compared with control groups (Fig. 6D), which was consistent with the previous data. According to the data in GEPIA (GEO), UALCAN (TCGA), and OncoLnc database, we noticed that the expression of KIFC1 was significantly high in GBM tissues compared with normal tissues (Supplemental Fig. S3A, B). However, according to the prognosis data in GEPIA database, there was no significant difference in survival between patients with high and low KIFC1 (Supplemental Fig. S3C). In our study, we found that patients with high KIFC1 had poor prognosis. This may be due to the difference in the number of clinical samples and the different clinical characteristics of patients themselves. Taken together, all these data revealed that KIFC1 was involved in the TMZ resistance in GBM and inhibition of KIFC1 could be a promising target for TMZ resistance.
Fig. 6.

KIFC1 silencing inhibited tumor formation and increased TMZ sensitivity in vivo. (A) U138 cells stably transfected with KIFC1 or control shRNA lentivirus, and subsequently injected into nude mice. Tumors were excised and volume was calculated every week. Representative images of isolated tumors were displayed (left), and tumor growth curves were analyzed based on tumor volume (right). (B) IHC assays indicated the expression level of Ki67, Rad51, γH2AX, and phosphorylated Akt in control or KIFC1 depletion tumor tissues isolated from mice. IHC: immunohistochemistry; KIFC1: kinesin family member C1; shRNA: short hairpin RNA; TMZ: temozolomide.

KIFC1 silencing inhibited tumor formation and increased TMZ sensitivity in vivo. (A) U138 cells stably transfected with KIFC1 or control shRNA lentivirus, and subsequently injected into nude mice. Tumors were excised and volume was calculated every week. Representative images of isolated tumors were displayed (left), and tumor growth curves were analyzed based on tumor volume (right). (B) IHC assays indicated the expression level of Ki67, Rad51, γH2AX, and phosphorylated Akt in control or KIFC1 depletion tumor tissues isolated from mice. IHC: immunohistochemistry; KIFC1: kinesin family member C1; shRNA: short hairpin RNA; TMZ: temozolomide.

Discussion

GBM is highly aggressive and is undoubtedly a common lethal malignant tumor in the brain with poor prognosis[18,19]. So far, surgical clinical treatment and chemoradiotherapy cannot obviously improve the survival time of patients with GBM, which is only 12 to 15 months[20]. The metastasis of GBM is due to the proliferation and invasion of GBM cells into normal brain tissues[21]. Therefore, it is urgently needed to study the molecular mechanisms underlying GBM progression and development. For decades, targeted therapy for GBM has received worldwide attention, and there is a urgent need to find novel and promising therapeutic targets to combat this disease[22,23]. In this study, we found the significant high expression of KIFC1, a kinesin motor protein, in human GBM tissues collected in our hospital. Through the clinicopathological analysis, we found that the expression of KIFC1 was correlated with the clinical features of patients with GBM. We therefore provided a potential therapeutic target for the treatment of TMZ-resistant GBM. Through FCM assays, we further noticed that silencing of KIFC1 led to cell cycle arrest and cell apoptosis in GBM cells. Consistent with the in vitro data, we found that KIFC1 silencing suppressed tumor growth of GBM cells in mice. These findings all confirmed the key role of KIFC1 in GBM progression. Similarly, KIFC1 has been widely reported as an oncogene in multiple types of tumors. KIFC1 can be activated by TCF-4 and further promotes HCC progression via transcriptionally activating HMGA1[24]. In addition, KIFC1 promoted the proliferation of bladder cancer cells via Akt pathway[25]. Similarly, our data also confirmed that the Akt signaling contributed to the inhibition of tumor growth caused by KIFC1 silencing. Interestingly, another study provides the evidence that a KIFC1 inhibitor, CW069, stimulates cell apoptosis and reverses resistance to docetaxel in prostate cancer[26]. Therefore, all these studies proved the involvement of KIFC1 in cancer progression, suggesting that the inhibitors targeting of KIFC1 may have the potential to combat TMZ-resistant GBM in the future. DNA damage is emerging as a critical promoting mechanism in the progression of multiple types of cancers[27]. Cancer cells lacking of the DNA repair genes exhibit double-stranded DNA breaks, abnormal cell division, and the development of cancer progression[27]. In GBM, the defects of DNA damage repair and cytogenetic abnormalities were common phenotypes of GBM cells[28]. Importantly, several signaling pathways were reported to affect the regulation of DNA damage repair, such as Akt signaling pathway and NF-kappa B pathway[29]. Notably, here, we found that KIFC1 affected DNA damage repair via Akt pathway in GBM cells. Therefore, our data provided the evidence that KIFC1 promoted the proliferation and apoptosis of GBM via DNA damage repair and Akt signaling pathway. However, more precise molecular mechanism needs further study. In GBM, Akt signaling pathway is widely known to be involved in the regulation of cancer cell proliferation, migration, apoptosis, and drug resistance[30]. ACT001, a novel PAI-1 inhibitor, exerts synergistic effects in combination with cisplatin via the suppression of Akt pathway[31]. Similarly, another small molecule LCC-09 suppresses stemness and resistant phenotypes of GBM cells via Akt pathway[32]. In this study, we also found the involvement of Akt pathway in the regulation of GBM progression, suggesting that targeting of the Akt signaling pathway may be highly effective in inhibiting GBM progression. Collectively, our findings confirmed the involvement of KIFC1 in the progression of GBM. Interestingly, we found the obvious high expression of KIFC1 in human GBM tissues, especially in recurrent tumor tissues. We further demonstrated the effects of KIFC1 on GBM cell cycle, proliferation, and apoptosis in vitro. Furthermore, we found that KIFC1 silencing led to the defect in DNA damage repair in U138 R and U251 R cells via Akt signaling. Consistent with the in vitro data, we also demonstrated that KIFC1 silencing suppressed the tumor growth of GBM cells in mice. Therefore, we uncovered a novel understanding of KIFC1-Akt axis in the sensitivity of GBM to chemotherapy. Click here for additional data file. Supplemental Material, sj-jpg-1-cll-10.1177_0963689721991466 for Kinesin Family Member C1 Increases Temozolomide Resistance of Glioblastoma Through Promoting DNA Damage Repair by Jianheng Wu, Xinjun Wang, Xiaowei Yuan, Qiao Shan, Zhen Wang, Yuehui Wu and Jingwei Xie in Cell Transplantation Click here for additional data file. Supplemental Material, sj-jpg-2-cll-10.1177_0963689721991466 for Kinesin Family Member C1 Increases Temozolomide Resistance of Glioblastoma Through Promoting DNA Damage Repair by Jianheng Wu, Xinjun Wang, Xiaowei Yuan, Qiao Shan, Zhen Wang, Yuehui Wu and Jingwei Xie in Cell Transplantation Click here for additional data file. Supplemental Material, sj-jpg-3-cll-10.1177_0963689721991466 for Kinesin Family Member C1 Increases Temozolomide Resistance of Glioblastoma Through Promoting DNA Damage Repair by Jianheng Wu, Xinjun Wang, Xiaowei Yuan, Qiao Shan, Zhen Wang, Yuehui Wu and Jingwei Xie in Cell Transplantation
  32 in total

Review 1.  Malignant gliomas in adults.

Authors:  Patrick Y Wen; Santosh Kesari
Journal:  N Engl J Med       Date:  2008-07-31       Impact factor: 91.245

2.  NF-κB and AKT signaling prevent DNA damage in transformed pre-B cells by suppressing RAG1/2 expression and activity.

Authors:  Katarina Ochodnicka-Mackovicova; Mahnoush Bahjat; Timon A Bloedjes; Chiel Maas; Alexander M de Bruin; Richard J Bende; Carel J M van Noesel; Jeroen E J Guikema
Journal:  Blood       Date:  2015-07-07       Impact factor: 22.113

3.  Akt activation suppresses Chk2-mediated, methylating agent-induced G2 arrest and protects from temozolomide-induced mitotic catastrophe and cellular senescence.

Authors:  Yuchi Hirose; Makoto Katayama; Olga K Mirzoeva; Mitchel S Berger; Russell O Pieper
Journal:  Cancer Res       Date:  2005-06-01       Impact factor: 12.701

4.  Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia.

Authors:  M Esteller; S R Hamilton; P C Burger; S B Baylin; J G Herman
Journal:  Cancer Res       Date:  1999-02-15       Impact factor: 12.701

5.  Genomic and molecular profiling predicts response to temozolomide in melanoma.

Authors:  Christina K Augustine; Jin Soo Yoo; Anil Potti; Yasunori Yoshimoto; Patricia A Zipfel; Henry S Friedman; Joseph R Nevins; Francis Ali-Osman; Douglas S Tyler
Journal:  Clin Cancer Res       Date:  2009-01-15       Impact factor: 12.531

6.  Management of Glioblastoma, Present and Future.

Authors:  Nancy Ann Oberheim Bush; Shawn L Hervey-Jumper; Mitchel S Berger
Journal:  World Neurosurg       Date:  2019-11       Impact factor: 2.104

7.  The expression of three genes in primary non-small cell lung cancer is associated with metastatic spread to the brain.

Authors:  Helena Grinberg-Rashi; Efrat Ofek; Marina Perelman; Jozef Skarda; Pnina Yaron; Marián Hajdúch; Jasmin Jacob-Hirsch; Ninette Amariglio; Meir Krupsky; David A Simansky; Zvi Ram; Raphael Pfeffer; Ilana Galernter; David M Steinberg; Issachar Ben-Dov; Gideon Rechavi; Shai Izraeli
Journal:  Clin Cancer Res       Date:  2009-02-03       Impact factor: 12.531

8.  mTOR inhibition decreases SOX2-SOX9 mediated glioma stem cell activity and temozolomide resistance.

Authors:  Laura Garros-Regulez; Paula Aldaz; Olatz Arrizabalaga; Veronica Moncho-Amor; Estefania Carrasco-Garcia; Lorea Manterola; Leire Moreno-Cugnon; Cristina Barrena; Jorge Villanua; Irune Ruiz; Steven Pollard; Robin Lovell-Badge; Nicolas Sampron; Idoia Garcia; Ander Matheu
Journal:  Expert Opin Ther Targets       Date:  2016       Impact factor: 6.902

9.  Exosomal L1CAM Stimulates Glioblastoma Cell Motility, Proliferation, and Invasiveness.

Authors:  Karma R Pace; Reetika Dutt; Deni S Galileo
Journal:  Int J Mol Sci       Date:  2019-08-16       Impact factor: 5.923

10.  CHD4 regulates the DNA damage response and RAD51 expression in glioblastoma.

Authors:  Lisa D McKenzie; John W LeClair; Kayla N Miller; Averey D Strong; Hilda L Chan; Edward L Oates; Keith L Ligon; Cameron W Brennan; Milan G Chheda
Journal:  Sci Rep       Date:  2019-03-14       Impact factor: 4.379

View more
  3 in total

1.  The Roles of KIFC1 in the Development of Osteosarcoma: Characterization of Potential Therapeutic Targets.

Authors:  Li-Yan Liang; Gui-Shi Li
Journal:  Comput Math Methods Med       Date:  2022-04-18       Impact factor: 2.809

2.  Commentary: Kinesin Family Member C1 Increases Resistance of Glioblastoma to Temozolomide Through Promoting DNA Damage Repair.

Authors:  Liu Yang; Pingan Lu; Song Qu
Journal:  Cell Transplant       Date:  2022 Jan-Dec       Impact factor: 4.064

3.  An Integrative Pan-Cancer Analysis of Kinesin Family Member C1 (KIFC1) in Human Tumors.

Authors:  Hao Wu; Yingjuan Duan; Siming Gong; Qiang Zhu; Xuanyou Liu; Zhenguo Liu
Journal:  Biomedicines       Date:  2022-03-10
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.