Li-Yan Liang1, Gui-Shi Li2. 1. Department of Intense Care Unit, Yantai Yuhuangding Hospital, No. 20 Yudong Road, Zhifu District, Yantai City, 264000 Shandong Province, China. 2. The Department of Joint Orthopaedics, Yantai Yuhuangding Hospital, No. 20 Yudong Road, Zhifu District, Yantai City, 264000 Shandong Province, China.
Abstract
Background: As an important member of the mitotic kinesin family, kinesin family member C1 (KIFC1) is abnormally expressed in a variety of tumors. However, the roles of KIFC1 in the development of osteosarcoma (OS) have never been elucidated. Methods: The expression of KIFC1 in OS tissues which was detected by immunohistochemistry (IHC) staining was further confirmed by Gene Expression Profiling Interactive Analysis 2 (GEPIA2) database. The relationship between KIFC1 and CDC20 was analyzed by clinical data, STRING database, and GEPIA2 database. Survival analysis was performed through GEPIA2 database. To elucidate the roles of KIFC1 in OS, MG-63 and U-2 OS cells were treated with short hairpin RNA (shRNA) to knock down KIFC1 expression, and the knockdown efficiency was validated with quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and western blotting (WB). Moreover, colony formation and Cell Counting Kit-8 (CCK-8) assays were utilized to evaluate cell proliferation. Results: According to IHC staining and GEPIA2 analysis, the expression of KIFC1 in OS tissues was significantly higher than that in adjacent normal tissues, which was inversely connected to the prognosis. These results were consistent with our clinical data. Besides, KIFC1 was positively correlated with CDC20. In addition, KIFC1 shRNA could effectively silence KIFC1 expression in MG-63 and U-2 OS cells. Furthermore, the knockdown of KIFC1 inhibited the cell proliferation ability with increased cell apoptosis in MG-63 and U-2 OS cells. Conclusion: KIFC1 was significantly upregulated in OS and promoted OS progression by cell proliferation. These findings offered new clues for OS diagnosis and prognosis, suggesting KIFC1 could be a potential therapeutic target for OS in further study.
Background: As an important member of the mitotic kinesin family, kinesin family member C1 (KIFC1) is abnormally expressed in a variety of tumors. However, the roles of KIFC1 in the development of osteosarcoma (OS) have never been elucidated. Methods: The expression of KIFC1 in OS tissues which was detected by immunohistochemistry (IHC) staining was further confirmed by Gene Expression Profiling Interactive Analysis 2 (GEPIA2) database. The relationship between KIFC1 and CDC20 was analyzed by clinical data, STRING database, and GEPIA2 database. Survival analysis was performed through GEPIA2 database. To elucidate the roles of KIFC1 in OS, MG-63 and U-2 OS cells were treated with short hairpin RNA (shRNA) to knock down KIFC1 expression, and the knockdown efficiency was validated with quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and western blotting (WB). Moreover, colony formation and Cell Counting Kit-8 (CCK-8) assays were utilized to evaluate cell proliferation. Results: According to IHC staining and GEPIA2 analysis, the expression of KIFC1 in OS tissues was significantly higher than that in adjacent normal tissues, which was inversely connected to the prognosis. These results were consistent with our clinical data. Besides, KIFC1 was positively correlated with CDC20. In addition, KIFC1 shRNA could effectively silence KIFC1 expression in MG-63 and U-2 OS cells. Furthermore, the knockdown of KIFC1 inhibited the cell proliferation ability with increased cell apoptosis in MG-63 and U-2 OS cells. Conclusion: KIFC1 was significantly upregulated in OS and promoted OS progression by cell proliferation. These findings offered new clues for OS diagnosis and prognosis, suggesting KIFC1 could be a potential therapeutic target for OS in further study.
Osteosarcoma (OS) originates in mesenchymal tissue is one of the most common primary malignant bone tumors global, predominantly affecting the population of adolescents under 18 and elderly over 60 [1-3]. With the rapid development of surgery technology, intensive multiagent chemotherapy, and medical equipment, the 5-year survival rate of OS patients without metastases has increased to nearly 70–80% [4, 5]. However, due to early systemic metastases, the 5-year survival rate of patients with OS metastases is just 20% [6]. Current therapeutic options for metastatic OS are limited and frequently result in poor prognosis and relapse. Therefore, the exploration of novel molecular therapeutic targets for early diagnosis and treatment in OS is both imperative and useful.Kinesin family member C1 (KIFC1) is a minus-end-directed kinesin motor protein that participates in a range of cellular biological processes including mitosis, meiosis, centrosome amplification, and macromolecular transport [7, 8]. Increasing evidence reports that KIFC1 expression is abnormal in various cancers, such as ovarian adenocarcinomas, breast cancer, bladder cancer, and glioblastoma [9-12]. Concretely speaking, KIFC1 was upregulated in ovarian cancer cells and could serve as a biomarker that predicted worse prognosis, poor overall survival, and initiation of metastatic dissemination in patients with ovarian cancer. KIFC1 was also found to be highly expressed in premalignant lesions and performed important roles in enabling preneoplastic cells to become immortalized and malignant. In addition, KIFC1 was highly expressed in bladder cancer and could be a promising biomarker and therapeutic target. Moreover, the expression of KIFC1 was upregulated in glioblastoma, and it was critical in the involvement and progression of glioblastoma. Recently, KIFC1 has emerged as a hallmark and is considered to be an attractive target for the treatment and diagnosis of human cancers. KIFC1 inhibition can significantly limit cell proliferation, motility, and drug resistance [12, 13]. Alternatively, the roles and probable mechanisms of KIFC1 in OS are still unknown.In this study, we performed immunohistochemistry (IHC) staining and bioinformatics to analyze the prognostic value of KIFC1 and examined the association between KIFC1 and CDC20 in OS. We also investigated the association between KIFC1 and grade classification and analyzed the role of KIFC1 in cell proliferation. We found that in highly consistent with CDC20, KIFC1 was significantly upregulated in OS patients. High KIFC1 level was associated with the poor prognosis of OS patients. In addition, KIFC1 silencing inhibited cell proliferation in vitro. Our results suggest that KIFC1 was a potential biomarker for OS diagnosis, treatment, prognosis, and recurrence.
2. Materials and Methods
2.1. Patient Samples
55 pairs of OS tissues and matched adjacent normal tissues were collected from the Yantai Yuhuangding Hospital. Their diagnosis was according to risk factors, presenting symptoms, and diagnostic testing. Furthermore, the final diagnosis was dependent on pathological and IHC staining. Every participant signed written informed consent. Following surgical resection, the fresh tissue was sent for pathological analysis, and the rest was immediately frozen in liquid nitrogen. The experiments were approved by the ethics committee of Yantai Yuhuangding Hospital. The clinical staging criteria were based on the Enneking staging system [14] was shown in Supplement Table 1.
2.2. Exclusion and Inclusion Criteria
The exclusion criteria used in our study were as follows: (1) patients without surgery; and (2) patients received chemotherapy, radiotherapy, and/or other treatments. The inclusion criteria used in our study were as follows: (1) assessment of the association between KIFC1, CDC20, and IHC staining of patients; (2) patient with detailed clinical information; and (3) patients did not receive any chemotherapy or radiotherapy before surgery.
2.3. Immunohistochemistry Staining
IHC staining was used to evaluate the expression of KIFC1 and CDC20 and their relationship in each tissue. Briefly, 5 μm thick specimens were fixed using 4% paraformaldehyde (PFA) at 25°C for 30 min before being blocked with 2% bovine serum albumin (BSA) for 1 hour. Subsequently, after slides were incubated with rabbit anti-KIFC1 (ab172620, 1 : 100; Abcam, Shanghai, China) and anti-CDC20 antibody (ab155921, 1 : 200; Abcam, Shanghai, China) at 4°C overnight. The slices were stained with the universal secondary antibodies (Zhongshan Jinqiao Biotechnology Co., Ltd., Beijing, China) for 1 hour the next day, and diaminobenzidine was utilized as a chromogen substrate. Finally, photographs were automatically restored and analyzed by the optical microscope (Olympus, Japan). The H-score system was applied to calculate each slice. The cutoff criteria were set as H − score = 200 to discriminate the high (≥200) and low (<200) expression groups.
2.4. Bioinformatics Analysis
As an online tool, Gene Expression Profiling Interactive Analysis 2 (GEPIA2) is frequently employed for integrating analysis of gene expression in TGGA and GTEx datasets [15]. In this study, we used GEPIA2 to analyze the KIFC1 expression between tumor and normal patients in SARC via box plots. The significantly abnormal gene expression is denoted with “∗,” which represents P < 0.05.In addition, GEPIA2 can perform survival and correlation analysis based on gene expression. Therefore, the overall survival and disease free survival of KIFC1 were performed with GEPIA2 to evaluate its prognostic value. Moreover, the correlation between KIFC1 and CDC20 was also performed by GEPIA2.
2.5. Cell Culture
The OS cell lines MG-63 and U-2 OS were purchased from the Chinese Academy of Sciences (Shanghai, China). All cells were cultivated in medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Gibco, Thermo Fisher Scientific, Inc.) at 37°C with 5% CO2.
2.6. Cell Transfection
Lentiviral vectors with short hairpin RNAs (shRNAs) against KIFC1 and their matching negative controls were designed and developed by ObiO (Shanghai, China). The TransFast transfection reagent Lipofectamine 2000 (Thermo Fisher Scientific) was then used to transfect cells through the vectors. To establish stable cell lines, an incubator with puromycin (5.0 μg/mL, Biyuntian) was employed to culture cells for 14 days. Target sequences were as follows: sh1: 5′-AAATTACCACATCCCACCCAAGA-3′, sh2: 5′-AAACGTTGGACCAAGAGAACCAG-3′, sh3: 5′-AAGTGGACAGGATGAAGTGTTTG-3′, and sh4: 5′-AACAGCAAACTGACCTACCTGCT-3′. Transfection efficiency was verified by quantitative real-time polymerase chain reaction (qRT-PCR) and western blotting (WB) assays. Finally, sh1 was preferred for further experiments.
2.7. Western Blotting
The radioimmunoprecipitation assay (RIPA) buffer (Beyotime, Shanghai, China) was used to isolate total protein from treated OS cells before quantifying the protein concentration with Bicinchoninic acid (BCA) protein analysis kit (Beyotime, Shanghai, China). After separating with 12% SDS-PAGE gel (Beyotime, Shanghai, China), the proteins were transferred to the polyvinylidene fluoride (PVDF, Beyotime, Shanghai, China) membrane which was further blocked by Tris-buffered saline contained 0.1% Tween20 (TBST, Beyotime, Shanghai, China) solution containing 5% skim milk for 2 hours at room temperature. Then, the membranes were soaked with primary antibodies, namely, anti-KIFC1 (ab172620, 1 : 10000; Abcam, Shanghai, China), anti-CDC20 antibody (ab155921, 1 : 1000; Abcam, Shanghai, China), and β-actin (1 : 1000, Abcam, Shanghai, China) at 4°C overnight. Subsequently, the membranes were incubated for another 2 hours at room temperature with secondary antibodies before being washed three times with TBST (10 minutes each time). Finally, the proteins were visualized with the VersaDoc Imaging System (BioRad Laboratories Co., San Francisco, CA, USA) and quantified by the Image J software.
Utilizing TRIzol reagent (Invitrogen, Shanghai, China), total RNA was extracted from treated OS cells (1 × 105) before cDNA synthesis with PrimeScript II 1st Strand cDNA Synthesis Kit (Takara, Shanghai, China). Then, qRT-PCR was carried out by ABI PRISM 7900 Real-Time system (Applied Biosystems, Foster City, CA, USA) with the SYBR Premix Ex Taq II (Takara). The relative expression was calculated with the 2−ΔΔct method compared to GAPDH. The following primers were used for qRT-PCR: KIFC1 forward (5′-3′): TGAGCAACAAGGAGTCCCAC and reverse (5′-3′): TCACTTCCTGTTGGCCTGAG, and GAPDH forward (5′-3′): CATGAGAAGTATGACAACAGCCT and GAPDH reverse (5′-3′): AGTCCTTCCACGATACCAAAGT.
2.9. Colony Formation Assay
After being treated with shRNA or control, OS cells were plated onto 6-well plates (1000 cells/well) at room temperature for 2 weeks. After washing thrice with phosphate buffer solution (PBS, Solarbio, Beijing, China), visible colonies were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet at room temperature for 30 minutes. Finally, the images of colony formation were taken and analyzed.
2.10. Cell Viability
The Cell Counting Kit-8 (CCK-8) assay was applied to detect cell viability following transfection. Briefly, MG-63 or U-2 OS cells were inoculated with 3 × 104 cells/well on 96-well plates. Subsequently, 10 μL CCK-8 solution and 90 μL medium (Beyotime, Shanghai, China) were added to each well and incubated for 3 h at 37°C. The optical density (OD) value of each sample was measured at 570 nm with a microplate reader (BioTek, Winooski, VT, USA).
2.11. Statistical Analyses
All the data expressed as the mean ± standard deviation (SD) was analyzed by the SPSS 22.0 statistical software. The statistical differences between the two groups were analyzed with a two-tailed Student's t-test, while multiple group comparisons were performed by one-way analyses of variance (ANOVA). The χ2 test was performed to analyze the correlation between KIFC1 expression and clinicopathological characteristics. The correlation and survival analysis were calculated by the Pearson and the log-rank test, respectively. Every experiment was conducted at least three times. The cutoff of significant difference was P < 0.05.
3. Results
3.1. KIFC1 Was Highly Expressed in OS Patients
To explore the functions of KIFC1 in OS, we preliminarily analyzed the expression of KIFC1 and the clinicopathological features in 55 OS patients. Firstly, the IHC staining data presented that the expression of KIFC1 in OS tissues was significantly higher than that in adjacent normal tissues (Figure 1(a)). Secondly, correlation analysis revealed that KIFC1 expression level was positively correlated with age, gender, tumor size, and clinical stage in OS patients (Table 1). In addition, compared to normal people, KIFC1 was significantly upregulated in OS patients in GEPIA2 database (Figure 1(b)). Comprehensive analysis revealed that higher expression of KIFC1 was accompanied by the deepening of tumor malignancy in OS patients. Conversely, these results proved that KIFC1 might be an important oncogenic gene and therapeutic target for OS.
Figure 1
KIFC1 was highly expressed in osteosarcoma. (a) Expression of KIFC1 in osteosarcoma tissues and adjacent tissues was detected by IHC staining at ×100 and ×200 magnification, respectively. The H-score was used to differentiate osteosarcoma samples with staining scores of 200 into high and low KIFC1 expression groups. (b) The expression of KIFC1 between osteosarcoma and normal people in GEPIA2. The data were presented as mean ± SD, ∗P < 0.05.
Table 1
Relationships of KIFC1 and clinicopathological characteristics in 55 patients with osteosarcoma.
Feature
All n = 55
KIFC1 expression
χ2
P
Low
High
n = 24
n = 31
Age (year)
0.007
0.933
<25
18
8
10
≥25
37
16
21
Gender
0.246
0.620
Male
30
14
16
Female
25
10
15
Tumor size
4.610
0.032∗
<4 cm
21
13
8
≥4 cm
34
11
23
Clinical stage
5.200
0.018∗
I-II
29
17
12
III
26
7
19
3.2. The Relationship between KIFC1 and CDC20 Expression
Cell division cycle 20 homologue (CDC20) has been proved to play important roles in carcinogenesis and development of OS in previous studies [16-18]. Therefore, we sought to test whether KIFC1 interacts with CDC20 played critical functions in OS. Firstly, IHC staining was used to detect the relationship between KIFC1 and CDC20. As shown in Figure 2(a), both KIFC1 and CDC20 were overexpressed in OS patients. Specifically, the increased expression of KIFC1 was accompanied by the high expression of CDC20. The relationships of KIFC1 and CDC20 in 55 patients with osteosarcoma were presented in Table 2. Then, the GEPIA2 and STRING were preferred to confirm their correlation. As represented in Figures 2(b) and 2(c), KIFC1 and CDC20 were closely related in OS. In detail, the RNA coexpression score between KIFC1 and CDC20 was 0.918 with STRING. Moreover, Pearson correlation analysis revealed a significantly positive correlation between KIFC1 and CDC20 through GEPIA2 (R = 0.67, P = 0 < 0.05). Taken together, CDC20 and KIFC1 were highly correlated with each other, which demonstrated that they were associated with the development and progression of OS.
Figure 2
Coexpression of KIFC1 and CDC20. (a) Coexpression of KIFC1 and CDC20 as detected by IHC staining. (b) Relationships between KIFC1 and CDC20 in osteosarcoma among the STRING database. (c) Pearson analysis between KIFC1 and CDC20 in osteosarcoma determined among the GEPIA2 database.
Table 2
Relationships of KIFC1 and CDC20 in 55 patients with osteosarcoma.
All n = 55
KIFC1
χ2
P
Spearman
Low24
High31
CDC20
6.425
0.011
0.369
Low26
16
10
High29
8
21
3.3. Survival and Prognostic Value of KIFC1 in Osteosarcoma
GEPIA2 was used to further assess the prognostic value of KIFC1 in OS. The overall survival result (Figure 3(a)) revealed that OS patients with high expression of KIFC1 had a worse prognosis compared to those with low expression of KIFC1 (HR = 1.7, P = 0.012). In addition, the disease free survival (DFS) (Figure 3(b)) showed significant difference between these two groups (HR = 1.5, P = 0.02). Our results verified that high KIFC1 expression led to a worse prognosis, indicating that KIFC1 could be an independent prognostic factor of OS.
Figure 3
Relationships between KIFC1 expression and survival prognosis of osteosarcoma. (a) Effects of KIFC1 on overall survival time of patients with osteosarcoma. (b) Effects of KIFC1 on disease free survival time of patients with osteosarcoma.
To investigate the role of KIFC1 in OS cells, KIFC1 shRNA and control empty vector were transfected into MG-63 and U-2 OS cells, respectively. Then, we measured the expression of KIFC1 at both mRNA and protein levels in OS cells by qRT-PCR and WB analysis. Our qRT-PCR data demonstrated that KIFC1 mRNA level was significantly knocked down in MG-63 and U-2 OS cells after KIFC1 shRNA transfection (Figure 4(a)). Moreover, our WB results indicated that the protein level of KIFC1 was decreased in both MG63 and U-2 OS cells transfected with KIFC1 shRNA (Figure 4(b)). These results revealed that KIFC1 shRNA significantly inhibited the KIFC1 expression in OS cells, which could be applied for further function experiments.
Figure 4
KIFC1 shRNA inhibited the expression of KIFC1 in both mRNA and protein. (a) The mRNA expression of KIFC1 was measured by qRT-PCR in both MG-63 and U-2 OS cells with KIFC1 inhibition. (b) Western blotting was performed to detect the expression of KIFC1 in MG-63 and U-2 OS cells with KIFC1 shRNA transfection. The data were presented as mean ± SD, ∗P < 0.05.
3.5. Knockdown of KIFC1 Inhibited the Proliferation of Osteosarcoma Cells
Then, the effects of KIFC1 on OS cell proliferation were determined with colony formation assay and CCK-8 assay. As shown in Figure 5(a), according to the colony formation assay, the number of clones in the cells transfected with KIFC1 shRNA was remarkably less than that in the control group. In addition, OD value of CCK-8 assay was significantly decreased in the KIFC1 shRNA group compared with the control group (Figure 5(b)). The result indicated that the knockdown of KIFC1 with KIFC1 shRNA could significantly inhibit the proliferation of MG-63 and U-2 OS cells. These founding revealed the key cancer-promoting function of KIFC1 in OS cells.
Figure 5
Knockdown of KIFC1 inhibited the cell proliferation in osteosarcoma cells. (a) Cell proliferation of MG-63 and U-2 OS cells with or without knockdown of KIFC1 was evaluated by colony formation assay. (b) CCK-8 assay detected the effect of KIFC1 knockdown on the proliferation of MG-63 and U-2 OS cells. The data were presented as mean ± SD, ∗P < 0.05.
4. Discussion
As the most common skeletal malignancy, OS is characterized by early metastasis, recurrence, drug resistance, and rapid progression [19-22]. Therefore, it is of great significance to identify innovative therapeutic regimens or targets to improve the diagnosis and prognosis of OS patients.As a microtubule-dependent mitotic kinesin with ATP activity, KIFC1 is involved in a range of cellular activities including mitosis, meiosis, and macromolecular transport [23]. Previous in-depth studies have demonstrated that KIFC1, which is closely associated with the occurrence and progression of gastric cancer, hepatocellular carcinoma, ovarian adenocarcinomas, and breast cancer, maybe emerged as a potential target for further study of tumor treatment [10, 24–26]. However, little is known about the expression and effects of KIFC1 in human OS. Our present study showed that KIFC1 was highly expressed in OS patients, and its expression had a significant positive correlation with the pathological clinical stage and tumor size of OS. As CDC20 has been reported to be involved in the development of OS that regulates the cell cycle [17, 27], we further explored the function of KIFC1 with coexpression analysis by STRING and GEPIA2. In consistent with previous findings, CDC20 was upregulated in OS patients. In addition, KIFC1 was positively related to CDC20 which revealed that KIFC1 played critical roles in OS. Furthermore, survival analysis confirmed that OS patients with overexpression of KIFC1 had a worse prognosis suggesting that KIFC1 could serve as a reliable candidate biomarker for diagnosis, treatment, and prognosis of OS. Hence, cellular level experiments including cell transfection, colony formation, and CCK-8 assays confirmed the importance of KIFC1 in the pathogenesis of OS. In particular, our results demonstrated that KIFC1 was highly expressed in MG-63 and U-2 OS cells, and silencing of KIFC1 by transfection of cells with KIFC1 shRNA inhibited the proliferation of OS cells. These results also suggested that KIFC1 promoted the tumorigenesis and progression of OS. However, there were certain shortages in our study. For example, more in vitro experiments needed to uncover the accurate mechanisms of OS. Also, the number of patients involved in our manuscript was not large enough, and a large sample of OS patients needed to further prove our conclusions. Moreover, in vivo experiments were not performed to evaluate the functions of KIFC1 on OS tumorigenesis.
5. Conclusion
In our study, we combined the use of bioinformatics with in vitro experiments to confirm the overexpression of KIFC1 in OS. We further revealed that silencing of KIFC1 by transfection of MG-63 and U-2 OS cells with KIFC1 shRNA inhibited the proliferation of OS cells. To the best of our knowledge, this was the first study to demonstrate that KIFC1 participated in OS progression, which could serve as an independent risk factor for poor prognosis of OS. Moreover, the present study provided a new area of research for the exploration of OS diagnosis, treatment, and prognosis in further study.
Authors: Leissan R Sadykova; Atara I Ntekim; Musalwa Muyangwa-Semenova; Catrin S Rutland; Jennie N Jeyapalan; Nataliya Blatt; Albert A Rizvanov Journal: Cancer Invest Date: 2020-06-01 Impact factor: 2.176