| Literature DB >> 33471510 |
Ahmed Abd El Wahed1,2, Pranav Patel3, Melanie Maier4, Corinna Pietsch4, Dana Rüster1, Susanne Böhlken-Fascher2, Jonas Kissenkötter2, Ole Behrmann5, Michael Frimpong6, Moussa Moïse Diagne7, Martin Faye7, Ndongo Dia7, Mohamed A Shalaby8, Haitham Amer8, Mahmoud Elgamal8, Ali Zaki9, Ghada Ismail10, Marco Kaiser11, Victor M Corman12,13, Matthias Niedrig14, Olfert Landt15, Ousmane Faye7, Amadou A Sall7, Frank T Hufert5, Uwe Truyen1, Uwe G Liebert4, Manfred Weidmann5.
Abstract
In March 2020, the SARS-CoV-2 virus outbreak was declared as a world pandemic by the World Health Organization (WHO). The only measures for controlling the outbreak are testing and isolation of infected cases. Molecular real-time polymerase chain reaction (PCR) assays are very sensitive but require highly equipped laboratories and well-trained personnel. In this study, a rapid point-of-need detection method was developed to detect the RNA-dependent RNA polymerase (RdRP), envelope protein (E), and nucleocapsid protein (N) genes of SARS-CoV-2 based on the reverse transcription recombinase polymerase amplification (RT-RPA) assay. RdRP, E, and N RT-RPA assays required approximately 15 min to amplify 2, 15, and 15 RNA molecules of molecular standard/reaction, respectively. RdRP and E RT-RPA assays detected SARS-CoV-1 and 2 genomic RNA, whereas the N RT-RPA assay identified only SARS-CoV-2 RNA. All established assays did not cross-react with nucleic acids of other respiratory pathogens. The RT-RPA assay's clinical sensitivity and specificity in comparison to real-time RT-PCR (n = 36) were 94 and 100% for RdRP; 65 and 77% for E; and 83 and 94% for the N RT-RPA assay. The assays were deployed to the field, where the RdRP RT-RPA assays confirmed to produce the most accurate results in three different laboratories in Africa (n = 89). The RPA assays were run in a mobile suitcase laboratory to facilitate the deployment at point of need. The assays can contribute to speed up the control measures as well as assist in the detection of COVID-19 cases in low-resource settings.Entities:
Year: 2021 PMID: 33471510 PMCID: PMC7839158 DOI: 10.1021/acs.analchem.0c04779
Source DB: PubMed Journal: Anal Chem ISSN: 0003-2700 Impact factor: 6.986
RT-RPA Assay Oligonucleotidesa
| RdRP | forward | TATGCCATTAGTGCAAAGAATAGAGCTCGCAC |
| reverse | CAACCACCATAGAATTTGCTTGTTCCAATTAC | |
| exo-probe | TCCTCTAGTGGCGGCTATTGATTTCAATAAbTXfTTTGATGAAACTGTCTATTG-PH | |
| E | forward | GAAGAGACAGGTACGTTAATAGTTAATAGCGTA |
| reverse | AAAAAGAAGGTTTTACAAGACTCACGTTAACsA | |
| exo-probe | ATCGAAGCGCAGTAAGGATGGCTAGbTXfTAACTAGCAAGAATAC-PH | |
| N | forward | CCTCTTCTCGTTCCTCATCACGTAGTCGCAAC |
| reverse | AGTGACAGTTTGGCCTTGTTGTTGTTGGCCTT | |
| exo-probe | TAGAATGGCTGGCAATGGCGGTGATGCTGCbTXfTTGCTTTGCTGCTGCTT-PH |
BHQ1-dt (bT), tetrahydrofuran (X), Fam-dT (fT), phosphothioate backbone (s), and PH: 3′ phosphate to block elongation.
Viral Genomes Analyzed for the Cross-Reactivity by the Three SARS-CoV-2 RT-RPA Assays
| SARS-CoV-2 | + | + | + |
| SARS-CoV-1 | + | + | – |
| coronavirus 229E | – | – | – |
| coronavirus NL63 | – | – | – |
| coronavirus OC43 | – | – | – |
| MERS-Coronavirus | – | – | – |
| influenza A (H1N1 pdm09) | – | – | – |
| influenza A (H3N2) | – | – | – |
| influenza A (H5N1) | – | – | – |
| influenza A (H1N1 H275Y) | – | – | – |
| influenza B (Victoria) | – | – | – |
| influenza B (Yamagata) | – | – | – |
| parainfluenza virus 1 (patient isolate) | – | – | – |
| parainfluenza virus 2 (patient isolate) | – | – | – |
| parainfluenza virus 3 (patient isolate) | – | – | – |
| parainfluenza virus 4 (patient isolate) | – | – | – |
| respiratory syncytial virus A and B | – | – | – |
| human rhinovirus A 16 | – | – | – |
| human rhinovirus B 5 | – | – | – |
| human metapneumovirus A1 | – | – | – |
| human metapneumovirus B2 | – | – | – |
| adenovirus type 1 | – | – | – |
| adenovirus type 4 | – | – | – |
| adenovirus type 34 | – | – | – |
| A/Anhui/1/13 (H7N9) | – | – | – |
| A/ Chicken/Germany/79 “Taucha“ (H7N7) | – | – | – |
| A/Chicken/Brescia/19/02 (H7N7) | – | – | – |
| A/Cygnusolor/Germany/R1377/07 (H5N1) | – | – | – |
| newcastle disease virus clone 30 | – | – | – |
| infectious laryngotracheitis virus U76 | – | – | – |
| infectious bronchitis M41 | – | – | – |
Retrospective Samples University of Leipziga
| | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| specificity | ||||||||||
| <35 | RdRP | estimate: | 0.93 [0.69; 0.99] | 1 [0.82; 1.0] | 1 [0.77; 1.0] | 0.95 [0.76; 0.99] | 32 | pos | 13 | 0 |
| neg | 1 | 18 | ||||||||
| >35 | 95% CI: | 1 [0.5; 1.0] | 1 [0.84; 1.0] | 1 [0.51; 1.0] | 1 [0.84; 1.0] | 22 | pos | 4 | 0 | |
| neg | 0 | 18 | ||||||||
| <35 | E | estimate: | 0.93 [0.69; 0.99] | 0.5 [0.29; 0.71] | 0.59 [0.39; 0.77] | 0.9 [0.60; 0.98] | 32 | pos | 13 | 9 |
| neg | 1 | 9 | ||||||||
| >35 | 95% CI: | 0.5 [0.15; 0.85] | 0.5 [0.29; 0.71] | 0.18 [0.05; 0.48] | 0.82 [0.52; 0.95] | 22 | pos | 2 | 9 | |
| neg | 2 | 9 | ||||||||
| <35 | N | estimate: | 0.93 [0.66; 0.99] | 0.94 [0.74; 0.99] | 0.93 [0.69; 0.99] | 0.94 [0.74; 0.99] | 32 | pos | 13 | 1 |
| neg | 1 | 17 | ||||||||
| >35 | 95% CI: | 0.5 [0.15; 0.85] | 0.5 [0.29; 0.71] | 0.18 [0.05; 0.48] | 0.81 [0.52; 0.95] | 22 | pos | 2 | 9 | |
| neg | 2 | 9 | ||||||||
Sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of RdRP, E, and N RT-RPA assays in comparison to real-time RT-PCR results (n = 36).
Figure 1Probit regression analysis for RdRP, E, and N RT-RPA assays. The limit of detection in 95% of cases is two RNA molecules/reaction for the RdRP RT-RPA assay (red) and 15 RNA molecules per reaction each for E and N RT-RPA assays (black).
Figure 2Results of 36 clinical samples analyzed with real-time RT-PCR for the E gene and RT-RPA assays for the RdRP, E, and N genes. CT is the cycle threshold, and TT is the threshold time. The red dot represents the real-time RT-PCR sample not detected by the RdRP RT-RPA, and the horizontal red lines indicate the median of TT or CT values.
Retrospective Samples of Four Laboratories in Africa (see Table S1)a
| | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| <35 | RdRP | estimate: 95% CI: | 0.93 [0.87; 0.98] | 1.00 [0.84; 1] | 1.0 [0.93; 1] | 0.87 [0.768; 0.96] | 73 | pos | 50 | 0 |
| neg | 3 | 20 | ||||||||
| >35 | RdRP | estimate: 95% CI: | 0.31 [0.14; 0.55] | 1.0 [0.84;1] | 1.0 [0.57; 1] | 0.64 [0.47; 0.79] | 36 | pos | 5 | 0 |
| neg | 11 | 20 | ||||||||
All results were used (n = 89 samples) to calculate sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of the RdRP RT-RPA assay in comparison to real-time RT-PCR assays.