Literature DB >> 3344220

alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

F Morvan1, B Rayner, J P Leonetti, J L Imbach.   

Abstract

An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.

Entities:  

Mesh：

Substances：

Year:  1988        PMID： 3344220      PMCID： PMC334722          DOI： 10.1093/nar/16.3.833

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN： 0305-1048            Impact factor:   16.971


  15 in total

1.  Targeted cleavage of polynucleotides by complementary oligonucleotides covalently linked to iron-porphyrins.

Authors:  T Le Doan; L Perrouault; C Helene; M Chassignol; N T Thuong
Journal:  Biochemistry       Date:  1986-11-04       Impact factor: 3.162

Review 2.  Redefining interferon: the interferon-like antiviral effects of certain cytokines (interleukin-1, interferon-beta 2, interferon-gamma) may be indirect or side effects.

Authors:  A Billiau
Journal:  Antiviral Res       Date:  1987-09       Impact factor: 5.970

3.  Solid-phase methods for sequencing of nucleic acids I. Simultaneous sequencing of different oligodeoxyribonucleotides using a new, mechanically stable anion-exchange paper.

Authors:  A Rosenthal; S Schwertner; V Hahn; H D Hunger
Journal:  Nucleic Acids Res       Date:  1985-02-25       Impact factor: 16.971

4.  Specific antiviral activity of a poly(L-lysine)-conjugated oligodeoxyribonucleotide sequence complementary to vesicular stomatitis virus N protein mRNA initiation site.

Authors:  M Lemaitre; B Bayard; B Lebleu
Journal:  Proc Natl Acad Sci U S A       Date:  1987-02       Impact factor: 11.205

5.  Inhibition of vesicular stomatitis virus protein synthesis and infection by sequence-specific oligodeoxyribonucleoside methylphosphonates.

Authors:  C H Agris; K R Blake; P S Miller; M P Reddy; P O Ts'o
Journal:  Biochemistry       Date:  1986-10-07       Impact factor: 3.162

6.  Inhibition of replication and expression of human T-cell lymphotropic virus type III in cultured cells by exogenous synthetic oligonucleotides complementary to viral RNA.

Authors:  P C Zamecnik; J Goodchild; Y Taguchi; P S Sarin
Journal:  Proc Natl Acad Sci U S A       Date:  1986-06       Impact factor: 11.205

7.  Antiviral effect of an oligo(nucleoside methylphosphonate) complementary to the splice junction of herpes simplex virus type 1 immediate early pre-mRNAs 4 and 5.

Authors:  C C Smith; L Aurelian; M P Reddy; P S Miller; P O Ts'o
Journal:  Proc Natl Acad Sci U S A       Date:  1986-05       Impact factor: 11.205

8.  Specific inhibition of mRNA translation by complementary oligonucleotides covalently linked to intercalating agents.

Authors:  J J Toulmé; H M Krisch; N Loreau; N T Thuong; C Hélène
Journal:  Proc Natl Acad Sci U S A       Date:  1986-03       Impact factor: 11.205

9.  Solid-phase synthesis of polynucleotides. II. Synthesis of polythymidylic acids by the block coupling phosphotriester method.

Authors:  K Miyoshi; T Miyake; T Hozumi; K Itakura
Journal:  Nucleic Acids Res       Date:  1980-11-25       Impact factor: 16.971

10.  alpha-DNA. I. Synthesis, characterization by high field 1H-NMR, and base-pairing properties of the unnatural hexadeoxyribonucleotide alpha-[d(CpCpTpTpCpC)] with its complement beta-[d(GpGpApApGpG)].

Authors:  F Morvan; B Rayner; J L Imbach; D K Chang; J W Lown
Journal:  Nucleic Acids Res       Date:  1986-06-25       Impact factor: 16.971
View more
  5 in total

1.  Alpha-DNA VIII: thermodynamic parameters of complexes formed between the oligo-alpha-deoxynucleotides: alpha-d(GGAAGG) and alpha-d(CCTTCC) and their complementary oligo-beta-deoxynucleotides: beta-d(CCTTCC) and beta-d(GGAAGG) are different.

Authors:  J Paoletti; D Bazile; F Morvan; J L Imbach; C Paoletti
Journal:  Nucleic Acids Res       Date:  1989-04-11       Impact factor: 16.971

2.  Alpha-DNA.IX: Parallel annealing of alpha-anomeric oligodeoxyribonucleotides to natural mRNA is required for interference in RNase H mediated hydrolysis and reverse transcription.

Authors:  C Gagnor; B Rayner; J P Leonetti; J L Imbach; B Lebleu
Journal:  Nucleic Acids Res       Date:  1989-07-11       Impact factor: 16.971

3.  Sequence-specific interaction of alpha-beta-anomeric double-stranded DNA with the p50 subunit of NF kappa B: application to the decoy approach.

Authors:  H Tanaka; P Vickart; J R Bertrand; B Rayner; F Morvan; J L Imbach; D Paulin; C Malvy
Journal:  Nucleic Acids Res       Date:  1994-08-11       Impact factor: 16.971

4.  alpha-DNA X: alpha and beta tetrathymidilates covalently linked to oxazolopyridocarbazolium (OPC): comparative stabilization of oligo beta-[dT]:oligo beta-[dA] and oligo alpha-[dT]:oligo beta-[dA] duplexes by the intercalating agent.

Authors:  D Bazile; C Gautier; B Rayner; J L Imbach; C Paoletti; J Paoletti
Journal:  Nucleic Acids Res       Date:  1989-10-11       Impact factor: 16.971

5.  A highly fluorescent DNA toolkit: synthesis and properties of oligonucleotides containing new Cy3, Cy5 and Cy3B monomers.

Authors:  Lucy M Hall; Marta Gerowska; Tom Brown
Journal:  Nucleic Acids Res       Date:  2012-04-11       Impact factor: 16.971
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.