The direct correlation between oxidative stress and LDL-C levels in adults is maintained by the Friedewald and Martin equations, but the methylation levels in the MTHFR and ADRB3 genes differ.

Low-density lipoprotein (LDL-C) concentrations are a standard of care in the prevention of cardiovascular disease and are influenced by different factors. This study compared the LDL-C concentrations estimated by two different equations and determined their associations with inflammatory status, oxidative stress, anthropometric variables, food intake and DNA methylation levels in the LPL, ADRB3 and MTHFR genes. A cross-sectional population-based study was conducted with 236 adults (median age 37.5 years) of both sexes from the municipality of João Pessoa, Paraíba, Brazil. The LDL-C concentrations were estimated according to the Friedewald and Martin equations. LPL, ADRB3 and MTHFR gene methylation levels; malondialdehyde levels; total antioxidant capacity; ultra-sensitive C-reactive protein, alpha-1-acid glycoprotein, homocysteine, cobalamin, and folic acid levels; usual dietary intake; and epidemiological variables were also determined. For each unit increase in malondialdehyde concentration there was an increase in the LDL-C concentration from 6.25 to 10.29 mg/dL (p <0.000). Based on the Martin equation (≥70 mg/dL), there was a decrease in the DNA methylation levels in the ADRB3 gene and an increase in the DNA methylation levels in the MTHFR gene (p <0.05). There was a positive relation of homocysteine and cholesterol intake on LDL-C concentrations estimated according to the Friedewald equation and of waist circumference and age based on the two estimates. It is concluded the LDL-C concentrations estimated by the Friedewald and Martin equations were different, and the Friedewald equation values were significantly lower than those obtained by the Martin equation. MDA was the variable that was most positively associated with the estimated LDL-C levels in all multivariate models. Significant relationships were observed based on the two estimates and occurred for most variables. The methylation levels of the ADRB3 and MTHFR genes were different according to the Martin equation at low LDL-C concentrations (70 mg/dL).

Introduction

Worldwide guidelines focus on low-density lipoprotein cholesterol (LDL-C) cut-off values as evidence-based standards for the prevention and treatment of cardiovascular disease (CVD). Many of these guidelines attribute the highest level of evidence (class 1) to LDL-C treatment goals [1-5].

In this context, the usefulness of treatment goals depends on the accuracy of the estimation used to assess LDL-C values. In this sense, a novel more accurate calculation–developed by researchers at Johns Hopkins University in Baltimore–may allow changes in management and improvement in the accuracy of LDL-C values [6].

According to the results of recent research, LDL-C continues to be routinely estimated by the Friedewald equation [1-12], which for more than 40 years has been used to support guidelines and CVD treatment management; however, it has been demonstrated that this equation tends to underestimate the LDL-C values in patients with elevated triglyceride levels (>200 mg/dL) and LDL-C below 70 mg/dL [13].

Due to the high cost of directly measuring LDL-C [13], estimating LDL-C using the Friedewald equation is still the most commonly used calculation method in clinical practice and in population-based studies. In turn, the Martin equation was applied in a study with an adult population, and its efficiency compared to the direct method (enzymatic homogeneous assay) [14] was observed. The Martin equation has also been applied in studies with individuals undergoing treatment due to high cardiovascular risk, having as a therapeutic goal the reduction in LDL-C to <70 mg/dL [6, 15, 16].

In metabolic disorders, such as vascular disease, inflammation, hypercholesterolemia and increased amounts of native LDL, changes occur in the generation of reactive oxygen species (ROS), which are responsible for causing changes in the endothelium, imbalances in oxidative metabolism and L-arginine uncoupling, causing an increase in nitric oxide release and ROS generation, in addition to endothelial dysfunction and atherogenesis [10].

MDA is the main degradation product of lipid peroxidation, and its level indirectly reflects the severity of free radical attack [17, 18]. In several studies, the influence of MDA on LDL-C was also observed in different morbidities [19-22]. The total antioxidant capacity (TAC), homocysteinemia, C-reactive protein (CRP), alpha-1-acid glycoprotein (AGP), waist circumference (WC) and cholesterol intake, based on methodological protocols for different morbidities, LDL-C levels were correlated with these variables [11, 23–27].

The relationship between LDL-C values and methylation levels, changes in the methylation profile can lead to changes in enzyme expression and fat metabolism dysregulation [28]. Additionally, external factors can regulate gene transcription and directly alter the epigenetic code, causing permanent activation of key inflammatory mediators with sustained production of pro-inflammatory mediators [29].

The DNA methylation in specific genes involved in dyslipidaemia, i.e., in the increase or decrease in LDL-C values [12, 30, 31], the following are notable: the LPL gene, which encodes lipoprotein lipase (LpL), involved in the reduced conversion of very low-density lipoprotein (VLDL) into LDL-C in plasma [32]; the beta-adrenergic receptor 3 gene (ADRB3), which is involved in the regulation of lipolysis and thermogenesis in white and brown adipose tissue [33]; and the gene that encodes methylenetetrahydrofolate reductase (MTHFR), which is involved in the conversion of homocysteine (Hcy) into methionine [34] and may be involved in lipid metabolism, as observed in a study of MTHFR polymorphism and dyslipidemia [35].

To the best of our knowledge, there are no studies comparing LDL-C values estimated using one or two methods as dependent variables and LPL, ADRB3 and MTHFR gene methylation levels, MDA, TAC and CRP, among other independent variables, in linear regression models.

Accordingly, considering that LDL-C values and their therapeutic changes are associated with CVD prevention and treatment to a greater extent than the levels of other types of lipids [26] and that the accuracy of the estimation may help better guide the management of CVD, the present study compared the estimated LDL-C concentrations based on the equations proposed by Friedewald et al. [36] and by the new method described by Martin et al. [13] and evaluated the occurrence of an association with inflammatory status, oxidative stress, anthropometric variables, food intake and DNA methylation levels in the LPL, ADRB3 and MTHFR genes in adults of both sexes.

Materials and methods

Study design

This was a cross-sectional epidemiological study associated with the project titled "Cycle II of Diagnosis and Intervention of the Food, Nutritional and Non-Communicable Diseases Statuses of the Population of the Municipality of João Pessoa/Paraíba (II Ciclo de Diagnóstico e Intervenção da Situação Alimentar, Nutricional e das Doenças não Transmissíveis mais Prevalentes da População do Município de João Pessoa/PB—II DISANDNT/Paraíba)" [37], for which data were collected between May 2015 and May 2016.

As for the inclusion criteria, individuals of both sexes were included in the sample; between 20 and 59 years of age; from different socioeconomic statuses and using medication or not. As for the exclusion criteria, the following were excluded from the original II DISANDNT / PB database: Individuals with neuro-psychiatric disorders; users of multivitamin supplements, minerals, anorectic or anabolic agents; pregnant women and infants; for the present study, individuals with a calorie intake below 700Kcal [38] and individuals with triglyceride levels above 400mg/dL were also excluded.

After the selection of the eligibility criteria, 236 individuals were selected and duly instructed as to the objectives of the study according to the ethical guidelines; the subjects agreed to participate by signing an informed consent. The research protocol of the above mentioned project, to which the present study is linked, was approved by the Research Ethics Committee of the Health Sciences Center of the Federal University of Paraíba (Universidade Federal da Paraíba, UFPB), under the protocol number 0559/2013. This study was conducted in accordance with the Declaration of Helsinki.

This information and other information about the sampling are further detailed in recently published studies [39, 40], with the exception of the levels of methylation of the LPL and MTHFR gene, the calculated values of LDL-C in accordance with Martin [13] and the stratification of the sample according to the LDL-C values.

To improve the characterization of the studied population, sex, lipid profile and gene methylation levels, distributed according to estimated LDL-C values–based on the Friedewald and Martin equations–were classified according to the Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Cholesterol in Adults (ATP III), using the following cut-off values as a goal for LDL-C values: <130 mg/dL, corresponding to values close to the optimal value, used for individuals with low cardiovascular risk; and the treatment goal of <70 mg/dL, recommended for individuals with high cardiovascular risk [41].

Data collection

The home visits and the application of the questionnaires were carried out by undergraduate students of the Nutrition Program and master's and PhD students of the Graduate's Program in Nutrition Sciences (PPGCN) of the UFPB. All were trained before the start of data collection and also participated in the pilot study. The questionnaires were applied to characterize epidemiological, demographic and socioeconomic, lifestyle, nutritional assessment, dietary intake and biochemical data.

Nutritional and food intake assessment

Weight and height measurements were carried out in triplicate and the mean of the three values was used. Body Mass Index (BMI) was calculated using the weight (kg) divided by the square of the height (meters), and the cut-off points recommended for adults aged between 20 and 59 years old by the World Health Organization (WHO) [42] were used. The waist circumference (WC) was used to determine abdominal obesity, according to the American Heart Association (AHA), with the cut-off point being ≥ 88 cm for women and ≥102 cm for men [43].

To assess the regular food intake of the individuals, three 24-hour dietary recalls (24HR) were carried out, contemplating one at the weekend, with an interval of 15 days since the beginning of data collection, according to a previously-published study [40].

To fill the 24HR, a photo album with homemade measures of food was used based on the real weight of the average intake of foods validated for this population, minimizing possible biases of this method [44, 45]. The food items were evaluated and converted into calorie and nutrient quantities with the Dietwin nutrition software and the multiple sources method (MSM) was used to estimate the regular intake of individuals of repeated measurements in a given period; the variation in intake was not affected by the method [46].

Biochemical analyses

Blood samples were collected by an experienced nurse in the individuals' homes, after a fasting period of 12 hours. The blood collection followed the standards for the use of piercing/cutting instruments. For the evaluation of the lipid profile, we used kits for the determination of total cholesterol and triglycerides of the Labtest® do Brazil brand following the Trinder enzymatic method, and for HDL cholesterol we used the Labtest® do Brazil brand following the precipitation method. PCR-us and AGP were quantified by immunoturbidimetry in serum samples; the concentrations were determined with specific commercial kits (Labtest, Minas, Brazil) according to the manufacturer's instructions. We used a previously described protocol for the analysis of antioxidant activity through plasma MDA and TAC in serum [47]. Homocysteine levels were quantified using high performance liquid chromatography (HPLC) [48]. The serum concentrations of folic acid and vitamin B12 were measured by chemiluminescence and a electrochemiluminescence immunoassay, respectively [39].

LDL-C estimation using the Friedewald and Martin equations

The LDL-C values estimated with the Friedewald equation were calculated using the following formula: (total cholesterol)—(high-density lipoprotein cholesterol [HDL-C])—(triglycerides/5), in mg/dL [36]. The calculation of the values estimated with the Martin equation was performed using a smartphone application (LDL Cholesterol Calculator. Available at: https://www.hopkinsmedicine.org/apps/all-apps/ldl-cholesterol-calculator. Accessed on: August 2018) [6]. This new approach integrates an individualized factor in the denominator to capture the performance of triglycerides in explaining the variance in VLDL-C, where the individual factor is chosen among 180 different possible factors according to the concentrations of triglycerides and non-HDL-C [13].

Cardiovascular risk

For the total sample, the Framingham risk score was estimated using an online calculator (Available at: (https://www.framinghamheartstudy.org/fhs-riskfunctions/cardiovascular-disease-10-year-risk/). Accessed on: May 2018), which estimates the risk of an individual to develop coronary artery disease over the next 10 years. The evaluation of this score is based on the following classification: <10% low risk; 10–20% moderate risk; and> 20% high risk.

The diagnosis of arterial hypertension and medication use were self-reported, based on a medical consultation. For non-hypertensive patients, the normal systolic pressure value (120 mmHg) was used, and for hypertensive patients, the value referring to mild (140 mmHg) and moderate (160 mmHg) systolic hypertension were used [49], respecting the heterogeneity of the population regarding the studied variables [39, 40].

The Framingham risk score was estimated to assist in the characterization of the sample regarding cardiovascular risk, but due to the lack of blood pressure values, it was not included in the regression models.

Analysis of the methylation levels of the MTHFR, ADRB3 and LPL genes

For the analysis, blood samples were collected at 8:30 a.m. ± 10 min from all individuals to avoid a potential sampling effect. To isolate DNA, TRIzol-LS was used according to the protocol described and adapted by Miller and Dykes [50]. For the DNA standards and participant samples, whole DNA was quantified on a NanoDrop ND-2000 UV-Vis spectrometer (Thermo Scientific, USA). Genomic DNA was modified by bisulfite using a Cells-to-CpG™ conversion kit (Applied Biosystems, Life Technologies, California) according to the manufacturer’s instructions. PCR amplification and high-resolution melting (HRM) analysis were performed using an Applied Biosystems 7500 Fast System and the accompanying software. The primer sequences for each gene were obtained using MethPrimer Software (https://www.urogene.org/methprimer/) according to the promoter region sequence entered into the Genome Browser (https://genome.ucsc.edu/).

The final volume of the solution used for PCR was 20 μl, containing: AmpliTaq™ Gold 360 Buffer, 10x, 25mM Mg Chloride, MeltDoctor™ HRM Dye (20x), 25nM of each initiator containing the primer sequences for the genes, according to Fig 1 and 1 μl of bisulfite-converted genomic DNA. The qPCR consisted of an initial enzyme activation at 95°C which lasted for 10 minutes, followed by 40 cycles, each consisting of 15 s at 95°C, 60 s at 60°C, 10 s at 95°C, 60 s at 60°C, 15 s at 95°C, and 15 s at 60°C the design of the studied genes are described in Box 1.

Fig 1

LDL-C concentration density curves according to the estimation methods.

To calculate the levels of methylation, DNA standards converted to commercially available bisulfite were acquired as positive (100% Methylated) and negative control (0% Methylated) CpGenome (Chemicon, Milipore, Billerica, MA, USA) and we performed the appropriate dilutions to obtain the following ratios: 0, 25, 50, 75 and 100%; all samples were performed at least in triplicate to acquire the standard curves and compare with the fusion profile of the samples.

Statistical analysis

All statistical analyses were performed with the software R, 3.3.2 [51]. Initially, the sample was characterized using measures such as simple frequency, percentage, measures of central tendency and dispersion. Next, a proportions test was used to determine whether there was a difference between the proportion of individuals with LDL-C values lower, higher and equal to 130 mg/dL and lower, higher and equal to 70 mg/dL for patients of each sex.

The data were tested for the presence of normality using the Lilliefors test, which is a derivation of the Kolmogorov-Smirnov test [52]. In addition, to determine whether there was a difference, on average, in the variables total cholesterol (TC), HDL, triglycerides, LPL gene methylation level, ADRB3 gene methylation level and MTHRF gene methylation level according to the classes "LDL up to 130 mg/dL", "LDL equal to or greater than 130 mg/dL", "LDL up to 70 mg/dL", and "LDL equal to or greater than 70 mg/dL", estimated by the Friedewald and Martin equations, the t-test, for comparisons of means, and the Mann-Whitney test, for comparison of medians, when the size of the subsample was small, were used.

To determine if there were significant relationships among the LDL-C values estimated by the Friedewald and Martin equations and the methylation levels of the LPL, MTHFR and ADRB3 genes and the other study variables, the linear regression models described below were proposed:

Model 1: μ(LDL Friedewald) = β0 + β1*LPL gene methylation levels + β2*MDA + β3*TAC + β4*PCR + β5*alpha-1-glyco + β6*Hcy + β7*B12 + β8*folate;

Model 3: μ(LDL Friedewald) = β0 + β1* LPL gene methylation levels + β2*CHO + β3*PTN + β4*LIP + β5*vitamin A + β6*mono + β7*B12 + β8*oleic acid + β9*omega 3 + β10*omega 6 + β11*saturated fat + β12*cholesterol + β13*polyunsaturated fats + β14*trans fats + β15*vitamin C + β16*vitamin E + β17*betacarotene + β18*selenium + β19*folate;

Model 5: μ(LDL Friedewald) = β0 + β1*LPL gene methylation levels + β2*sex + β3*age + β4*income + β5*physical activity + β6*smoking + β7*alcohol consumption + β8*WC + β9*hypolipidaemic drugs + β10*omega 6 + β11*morbidities related to CVDs.

The same models proposed for the Friedewald equation were also proposed for the Martin equation (models 2,4,6) and for the ADRB3 and MTHRF genes. For all analyses described above, the level of significance adopted was 5%.

Results

The study consisted of 236 adult individuals, of which 158 (67%) were female and 78 were male (33%), with a median age of 37.5 years.

There was a significant difference (p = 0.003) between mean LDL-C concentrations in the total sample estimated by the Friedewald and Martin equations, with LDL-C concentrations of 107.24 mg/dL and 117.81 mg/dL, respectively.

Of the 236 individuals included in the present study, 83% and 92% presented LDL-C ≥ 70 mg/dL, and 25% and 33% showed LDL-C ≥ 130 mg/dL according to Friedewald and Martin equations, respectively.

Fig 1 shows that the LDL-C density curve calculated by the Friedewald equation is slightly more dispersed than that calculated by the Martin method, which can also be observed by the estimated standard deviation, which was 39.31 for LDL-C (Friedewald) and 36.49 for LDL-C (Martin). According to the non-parametric Mann-Whitney test, there was a significant difference between LDL-C values according to the estimation method, at the 1% significance level (W = 23062, p-value = 0.001).

Table 1 shows that there was a difference according to sex in the values estimated between the intervals less than 130 mg/dL and above 130 mg/dL; more women had LDL-C levels lower than 130 mg/dL. There was also a difference between the intervals presented above for the mean TC and triglyceride values.

Table 1

Characteristics of the sample regarding sex, waist circumference, lipid profile and methylation levels of the LPL, ADRB3 and MTHFR genes according to different LDL-C estimates and cut-off values.

Lipid profile	Mean	SD	LDL-C F (mg/dL) <130 <70	LDL-C F (mg/dL) ≥130 ≥70	P-value	LDL-C M (mg/dL) <130 <70	LDL-C M (mg/dL) ≥130 ≥70	P-value
Female	-	-	117 (50%)	41 (17%)	<0.000*a	105 (45%)	53 (22%)	0.000*a
			24 (10%)	134 (56.8)	<0.000*a	13 (5%)	145 (61%)	0.000*a
Male	-	-	61 (26%)	17 (7%)	<0.000*a	55 (23%)	23 (10%)	<0.000*a
			17 (7%)	61 (25.8%)	<0.000*a	6 (2%)	72 (30%)	<0.000*b
Female waist size (cm)	84.44	14.8	82.84 ± 14.94	88.61 ± 13.81	0.019*c	82.48 ± 15.56	88.22 ± 12.58	0.010*c
			81.08 ± 16.08	84.99 ± 14.59	0.250c	74.79 ± 12.87	85.31 ± 14.72	0.008*c
Male waist size (cm)	87.18	14.6	86.39 ± 15.52	90.03 ± 10.25	0.259b	85.13 ± 14.65	92.08 ± 13.40	0.048*b
			83.80 ± 14.13	88.05 ± 14.65	0.298b	79.17 ± 13.25	87.85 ± 14.54	0.177b
Total cholesterol (mg/dL)	186.4	42.1	169.98 ± 28.32	236.60 ± 37.30	<0.000*b	164.39 ± 24.69	232.60 ± 32.40	<0.000*b
			139.29 ± 24.26	196.25 ± 38.13	<0.000*b	121.84 ± 13.49	192.00 ± 38.86	<0.000*b
HDL (mg/dL)	43.78	11	43.45 ± 11.19	44.78 ± 10.43	0.413b	43.36 ± 11.62	44.67 ± 9.59	0.360b
			40.90 ± 13.67	44.38 ± 10.29	0.129b	46.37 ± 13.71	43.55 ± 10.74	0.394b
Triglycerides (mg/dL)	138.8	73.7	132.12 ± 69.19	159.38 ± 83.43	0.027*b	129.33 ± 70.12	158.80 ± 77.47	0.124b
			142.37 ± 85.15	138.07 ± 71.29	0.764b	115.89 ± 64.34	140.83 ± 74.26	0.124 b
LPL gene methylation level (%)	36%	19%	36% ± 20%	36% ± 17%	0.901b	36% ± 19%	37% ± 18%	0.632b
			34% ± 18%	38% ± 19%	0.430 b	37% ± 23%	36% ± 19%	0.919 b
ADRB3 gene methylation level (%)	41%	18%	42% ± 18%	38% ± 17%	0.098b	43% ± 18%	39% ± 18%	0.151b
			43% ± 19%	41% ± 18%	0.452 b	52% ± 19%	40% ± 18%	0.010*c
MTHRF gene methylation level (%)	35%	18%	34% ± 18%	36% ± 17%	0.487b	34% ± 18%	36% ± 18	0.381b
			31% ± 16%	36% ± 18%	0.165 b	26% ± 10%	36% ± 18%	0.031*c

a: proportions test

b: t-test

*: significant results

c: Mann-Whitney test; -: the calculation does not apply or does not make sense; F: Friedewald; M: Martin; LDL-C: low-density lipoprotein cholesterol.

As for the WC values (male and female) distributed according to the LDL-C values calculated according to Friedewald, there was a difference between the values < and ≥ 130 mg/dL in relation to the values < and ≥ 70. It was observed that individuals who had a higher WC, also presented higher values of LDL-C.

As for the WC values for the male sex distributed according to the LDL-C values calculated according to Martin, there also was a difference between the values < and ≥ 130 mg/dL in relation to the values < and ≥ 70.

In the total sample, 14% of individuals were hypertensive, and after calculating the Framingham score–using a hypothetical value of 160 mmHg (moderate hypertension)– 82% presented mild risk, 13% presented moderate risk, and 5% presented high risk. However, when the Framingham score was calculated using 140 mmHg (mild hypertension), 89% presented mild risk, 8% presented moderate risk, and 3% presented high risk. When the corresponding normal blood pressure value of 120 mmHg was applied, excluding the self-reported hypertensive patients from the total sample, 93% of the individuals presented mild risk, 6% presented moderate risk, and 0.5% presented high risk.

There were differences in the distribution between the methylation levels of the ADRB3 gene (p = 0.010) and between the methylation levels of the MTHFR gene (p = 0.031) according to the Mann-Whitney test for values classified according to the cut-off value of 70 mg/dL (Table 1).

As described in Table 2, using the methylation levels of the LPL and ADRB3 genes as independent variables, the variables MDA and Hcy positively influenced the LDL-C value estimated with the Friedewald equation. The LDL-C Friedewald increased, on average, 10.06 mg/dL for each nmol/L MDA; and the LDL-C Friedewald increased, on average, 0.55 mg/dL for each μmol/L Hcy. Regarding the Martin equation with these same two genes, the MDA variable also positively influenced the variable LDL-C, and for each nmol/L MDA and μmol/L Hcy, the LDL-C estimated by the Martin equation increased, on average, 6.37 mg/dL and 6.25 mg/dL, respectively.

Table 2

Relationship between LDL-C levels estimated based on the Friedewald and Martin equations and the methylation levels of the LPL, ADRB3 and MTHFR genes, oxidative stress, and plasma levels of vitamin B12 and folate.

Model 1—Response variable: LDL-C Friedewald equation
Variable	LPL coefficient	p-value	ADRB3 coefficient	p-value	MTHFR coefficient	p-value
Intercept	75.13	>0.000	75.13	>0.000	72.99	>0.000
Gene (%)	11.10	0.408	11.10	0.426	19.17	0.201
MDA (nmol/L)	10.06	0.000 *	10.06	0.000*	10.29	0.000*
TAC (%)	10.17	0.566	10.17	0.55	7.02	0.693
CRP (mg/L)	-1.10	0.143	-1.10	0.117	-1.18	0.115
AGP (mg/dL)	0.03	0.814	0.03	0.875	0.02	0.903
Hcy (μmol/L)	0.55	0.040*	0.55	0.040*	0.56	0.038*
Vitamin B12 (pg/ml)	-0.03	0.145	-0.03	0.152	-0.03	0.153
Folic Acid (ng/ml)	-0.01	0.599	-0.01	0.531	-0.00	0.962
Model 2—Response variable: LDL-C Martin Equation
Intercept	100.20	>0.000	109.70	>0.000	96.48	>0.000
Gene (%)	6.61	0.604	-15.52	0.247	18.04	0.205
MDA (nmol/L)	6.37	0.020*	6.25	0.022*	6.57	0.016*
TAC (%)	1.14	0.946	2.4	0.887	-1.53	0.928
CRP (mg/L)	-0.86	0.230	-0.924	0.195	-0.91	0.199
AGP (mg/dL)	0.09	0.487	0.09	0.508	0.08	0.535
Hcy (μmol/L)	-0.12	0.638	-0.11	0.663	-0.11	0.665
Vitamin B12 (pg/ml)	-0.02	0.284	-0.02	0.278	-0.02	0.286
Folic Acid (ng/ml)	0.00	0.973	-0.00	0.899	0.01	0.637

*: p < 0.005; LDL-C: low-density lipoprotein cholesterol; AGP: alpha-1-acid glycoprotein; Hcy: homocysteine; MDA: malondialdehyde; CRP: C-reactive protein.

With the methylation levels of the MTHFR gene as one of the independent variables, for each nmol/L MDA, the LDL-C Friedewald increased, on average, 10.29 mg/dL, and for each μmol/L Hcy, the LDL-C Friedewald increased, on average, 0.56 mg/dL. According to the Martin equation with this same gene, the variable MDA had a positive influence on the variable LDL-C, and for each nmol/L MDA, LDL-C increased, on average, 6.57 mg/dL.

There was a positive influence of cholesterol intake on the LDL-C concentrations calculated according to the Friedewald equation, based on Model 3, which has the methylation levels of the LPL, ADRB3 and MTHFR genes as independent variables (Table 3).

Table 3

Relationship between LDL-C levels estimated with the Friedewald and Martin methods and the methylation levels of the LPL, ADRB3, MTHFR genes and habitual dietary intake.

Model 3—Response variable: LDL-C Friedewald
Variable	Coefficient	LB-UB (95%)	Z statistic	p-value
Intercept	109.10	98.16 ± 120.04	9.97	>0.000
LPL gene (%)	10.85	-2.83 ± 24.53	0.79	0.428
ADRB3 gene (%)	-8.93	-23.73 ± 5.87	-0.60	0.547
MTHFR gene (%)	10.02	-5.42 ± 25.46	0.65	0.517
Cholesterol (mg)	0.03	0.02 ± 0.05	2.15	0.033*

Model adjusted for the intake of the nutrients were included in the explanatory model; *: p < 0.005; LDL- C: low-density lipoprotein cholesterol; LB: lower boundary; UB: Upper boundary. No significant relationship was found in this model for Martin.

Additionally, there was a positive relationship among age and WC with LDL-C concentrations based on the two LDL-C estimates using Models 5 and 6; in contrast, for Model 5, there was not a positive relationship between the methylation level of the LPL gene and cholesterol and LDL-C levels calculated based on the Friedewald equation (Table 4).

Table 4

Relationship among LDL-C levels estimated based on the Friedewald and Martin methods and methylation levels of the LPL, ADRB3, and MTHFR genes and demographic, epidemiological, lifestyle and anthropometric variables.

Model 6—Response LDL-C Martin
Variable	Coefficient	LB-UB (95%)	Z statistic	p-value
Intercept	26.70	7.63 ± 45.77	1.40	0.163
LPL gene	3.16	-8.61 ± 14.93	0.27	0.789
ADRB3 gene	-9.42	-22.14 ± 3.30	-0.74	0.460
MTHFR gene	10.58	-2.06 ± 23.22	0.84	0.404
Age	0.80	0.59 ± 1.01	3.86	0.000*
Waist circumference	0.51	0.35 ± 0.67	3.21	0.001*
Model 5—Response variable: LDL-C Friedewald
Intercept	42.35	19.96 ± 64.74	1.89	0.060
LPL gene	13.02	-7.92 ± 18.87	0.90	0.367
ADRB3 gene	-1.42	-15.92 ± 13.08	-0.10	0.922
MTHFR gene	14.00	-0.39 ± 28.39	0.97	0.331
Age	0.50	0.26 ± 0.73	2.11	0.036*
Waist circumference	0.42	0.24 ± 0.60	2.33	0.020*

Model adjusted for demographic, epidemiological, lifestyle and anthropometric variables included in the explanatory model

*: p < 0.005; LDL-C: low-density lipoprotein cholesterol; LB: lower boundary; UB: Upper boundary.

Discussion

LDL-C concentrations varied as a function of the equations used to estimate their values, both for the Friedewald equation and for the Martin equation, and were significantly different. In this sense, the present population-based study identified that there is a distinction in the dimension of the problem; that is, LDL-C concentrations vary according to the estimation method used.

The inaccuracies of the formula with regard to triglyceride levels > 400 mg/dL (levels observed in 1% of the population of the present study) were recognized by Friedewald, Levy and Fredrickson [36]. However, even when triglyceride levels are below 400 mg/dL, researchers have suggested that the LDL-C calculated by the Friedewald formula underestimates LDL-C concentrations, corroborating the data found in the present study, where the mean LDL-C of the total sample was 107.24 and 117.81 mg/dL according to the Friedewald and Martin equations, respectively. The LDC-C concentrations estimated according to the Friedewald equation can therefore erroneously classify the CVD risk, particularly in individuals with high triglyceride levels (≥200 mg/dL; levels observed in 18% of the population in the present study, who presented mild cardiovascular risk) [6, 13].

The results from the only study found in the literature that compared the LDL-C levels estimated using the two equations in an adult population cannot be compared with the results of the present study because the objectives were different, considering that no comparisons were made between the two equations but, rather, between their results and the direct method [14]. However, notably, Lee et al. [14] observed that the Martin equation exhibited significantly higher overall agreement with the NCEP-ATP III guideline classifications than did the Friedewald equation, with values of 82.0% and 78.2%, respectively.

In the multivariate regression analysis, MDA was the only variable that positively correlated with LDL-C concentrations, calculated based on the Friedewald [36] and Martin et al. [13] equations, in all multivariate models analysed and composed of independent variables such as methylation levels of the LPL, ADRB3 and MTHFR genes, oxidative stress, inflammation, abdominal obesity, food intake and epidemiological variables. In addition, a positive relationship was found among Hcy and cholesterol with the LDL-C concentrations estimated according to the Friedewald equation in all models.

There was also a relationship among age and WC with LDL-C concentrations, estimated based on the two equations, with the exception of the model that included the methylation levels of the LPL gene as independent variable and LDL-C estimated based on the Friedewald equation as the dependent variable [36].

This study is unprecedented with regard to the identification of relationships and analysis of the influence of variables such as LPL, ADRB3 and MTHFR gene methylation, oxidative stress, inflammation, abdominal obesity, food intake and epidemiological variables on the LDL-C concentrations estimated by different equations.

In the present study, 50% of the individuals presented no morbidity, 17% had more than one morbidity, and 33% had one morbidity, and most individuals showed methylation levels between 35% and 41%. Differences in the methylation levels of the MTHFR and ADRB3 genes were identified only with the LDL-C concentrations estimated according to the Martin equation and at the cut-off value of 70 mg/dL. Although in the regression there was no significant relationship, we observed that at lower concentrations of LDL-C, methylation levels were statistically reduced when compared to higher values of LDL-C. Regarding the ADRB3 gene, in the present study ADRB3 methylation levels were lower at LDL-C levels ≥ 70 mg/dL. Although the population is different from the present study, it has been shown in men with familial hypercholesterolemia (FH) that the mean methylation levels of the ADRB3 gene were lower and correlated with high levels of LDL-C [30]. Interestingly, those authors found that hypermethylation was associated with higher ADRB3 mRNA levels. They also detected that severely obese men also showed an overall ADRB3 hypomethylation compared to FH men, suggesting that ADRB3 hypomethylation might be associated with obesity, body fat distribution and related disorders in men. The β-3 adrenergic receptor (β-3AR), a protein polypeptide consisting of 402 amino acids is, a member of the G protein-coupled receptor superfamily and mainly mediates the decomposition and heat generation of fat [53]. If the hypomethylation found in the present study could confirm its relationship with the decrease in ADRB3 transcript level, the higher LDL-C levels found could be better understood.

In contrast, another study showed that in women with excess weight, higher intake of monounsaturated and polyunsaturated fats from hazelnut oil was associated with lower ADRB3 methylation levels and greater reductions of LDL-C levels [39].

This result was inverse for the MTHFR gene, that is, at LDL-C levels ≥ 70 mg/dL, MTHFR methylation levels were higher. In the reviewed literature, hypermethylation of the MTHFR gene was associated with higher levels of TC and LDL-C in diabetic individuals [31]. MTHFR is an enzyme that acts on the folate cycle, and in MTHFR-deficient mice it was shown that the deficiency affects apolipoprotein levels and leads to lipid deposition [54]. In addition, the relationship between hypermethylation and decreased MTHFR transcript levels has already been shown [55]. Thus, lower MTHFR levels could lead to increased lipid levels. Although the mechanism of this enhancement is not yet clear, some studies of MTHFR polymorphisms that lead to decreased enzyme activity also show an association with higher lipid levels [31, 56].

Regarding the levels of methylation of the LPL gene, no relationship was found in the present study between the methylation levels of this gene and LDL-C concentrations, corroborating studies based on the analysis of the visceral adipose tissue of individuals with metabolic syndrome [12], of leukocytes from individuals with familial hypercholesterolemia [57] and of the placenta of pregnant women with gestational diabetes mellitus [58], thus also in individuals with defined clinical diagnoses.

Malondialdehyde (MDA) is an end-product of the radical-initiated oxidative decomposition of polyunsaturated fatty acids; therefore, it is frequently used as a biomarker of oxidative stress [23]. In the present study, 12% of the total population had high MDA, and 25% and 33% had high LDL-C (> 130 mg/dL), according to the Friedewald and Martin equations, respectively. Thus, although less than 15% of the population presented high MDA values, these values likely affect the lipid profile, increasing the LDL-C concentrations in the analysed models in the study population, with 75% to 67% of the LDL-C concentrations considered adequate, according to the two equations used.

In the Veterans Affairs Diabetes Trial, which investigated the association between MDA and diabetes mellitus, it was observed that the levels of MDA and LDL-C in circulating immune complexes can predict the occurrence of myocardial infarction, in addition to acute cardiovascular events in patients with type 2 diabetes [59]. However, the precise mechanism by which MDA can cause endothelial cytotoxicity is not known [23].

Regarding the relationship between MDA and LDL-C, several studies have shown that MDA and LDL-C values decrease in animal models with interventions based on the intake of different foods: Garlic (Allium sativum L.) polysaccharide [21], Chicory (Cichorium intybus L.) polysaccharides [22], Morechella esculenta polysaccharide [27].

Regarding the other study variables, considering that vascular inflammation is a fundamental mechanism in the progression of atherosclerosis and acute coronary syndromes [60], CRP stands out as an inflammation biomarker and is recommended as a secondary risk assessment factor in treatment decision-making [61, 62], particularly with regard to the treatment of high blood cholesterol [63, 64]. However, possibly because the mean CRP values for the majority of the population (81%) remained within the reference values, this variable did not influence LDL-C levels.

Hcy was included as a variable because increased Hcy affects the vascular endothelium, promoting structural endothelial injury [65]. Several mechanisms have been proposed to explain the association between Hcy and coronary artery disease, including the stimulation of LDL-C oxidation [66, 67]. In the present study, 14% of individuals had Hcy values above the reference range; however, the increased values may not have been sufficient to significantly influence the increase in LDL-C levels.

Regarding triglyceride values, Ference et al. [68] emphasized that the clinical benefit of reducing triglyceride levels is directly similar to the clinical benefit of reducing LDL-C levels per unit difference in apolipoprotein B; reduced triglyceride and LDL-C levels are associated with a lower risk of CVD. In the present study, triglyceride values increased significantly as a function of increased LDL-C. Further studies are needed to explain why there was only a difference between the triglyceride values when distributed at cut-off values of <130 mg/dL and ≥ 130 mg/dL LDL-C estimated according to the Friedewald equation.

Regarding the relationship among demographic, anthropometric and epidemiological variables, there was a positive influence of age, habitual cholesterol intake and WC on LDL-C levels. In the literature, advanced age and male sex have long been well established risk factors for CVD [69-72].

With regard to cholesterol intake, [73] observed that the intake of a high-fat diet (70.8%) increased the LDL-C levels in an experimental group; however, in the control group (29% fat), there was no significant difference. In the present study, even when the total fat intake was within the reference range (29%) [70] and the habitual cholesterol intake was 243.51 mg, an influence of this intake on LDL-C levels was identified.

Saturated fat, which is part of the habitual intake of this population, is a good source of atherogenic saturated fatty acids and is found in products such as coconut oil, which is rich in lauric fatty acids, and butter, which is a source of myristic and palmitic fatty acids [49].

Another explanation for this discrepancy may involve the type of fat consumed, since, in the case of the present study, the consumption of saturated fatty acids was 12%, exceeding the recommendation according to the National Institute of Heart, Lung and Blood: Detection, assessment and treatment of high blood cholesterol levels in adults (adult treatment panel III), final report, US Department of Health and Human Services, NIH Publication No. 02–5215, Bethesda, Maryland, September 2002.

WC is associated with CVD [74], and understanding changes in LDL-C with increased WC may help predict reductions in LDL-C, a result that can be achieved through weight loss. Regarding explanations for the relationship between LDL-C and WC, there are several hypotheses, which are different for values above or below the inflexion points for WC found in the population according to Laclaustra et al. [11].

In the present study, WC was not analysed by inflexion points, as in the aforementioned study, thus precluding comparisons with it. In this sense, we can only infer that according to the variable sex, the population of the present study was rated between 85% and 59% below and 14% and 39% above the WC reference values for males and females, respectively.

As limitations we emphasize that the results of this observational study, due to its innovative nature, should be confirmed in intervention or longitudinal follow-up studies to check if these associations are definitely causal or merely correlative. Another limitation is the fact that the LDL-C values were not assessed by the direct method. In addition, we emphasize the lack of pressure values, making it relevant to mention that, among the five most important studies conducted in the last decade in Brazil, two of them used self-reported data to calculate the prevalence of hypertension [49]. The strengths include the unprecedented aspect regarding the identification and analysis of the relationships between the LDL-C concentrations estimated based on different equations and the inclusion of the methylation levels of the LPL, ADRB3 and MTHFR genes as independent variables.

In addition to adding to our understanding in relation to the Martin and Friedewald equations, our data contribute to the elucidation of molecular mechanisms involved in cellular metabolism. The molecular data can be tabulated collectively in a gene panel indicating the susceptibility to a variety of pathologies and it can be used as a tool for personalized medicine, an action that will help in diagnosis, prognosis and treatment.

Conclusion

The LDL-C concentrations estimated by the Friedewald and Martin equations were different, and the Friedewald equation values were significantly lower than those obtained by the Martin equation.

MDA was the variable that was most positively associated with the estimated LDL-C levels in all multivariate models composed of variables associated with LPL, ADRB3 and MTHFR gene methylation levels, oxidative stress, inflammation, abdominal obesity, food intake and epidemiological variables.

Regarding the association of the variables age and WC with the LDL-C concentrations estimated based on the two equations, a positive association was observed for all models, with the exception of the model that had the methylation levels of the LPL gene and LDL-C concentrations estimated by the Friedewald equation. Based only on the Friedewald equation, Hcy and cholesterol intake were two positive associations with LDL-C levels.

The methylation levels of the ADRB3 and MTHFR genes were different with the Martin equation using the lowest LDL-C concentrations as cut-off values.

Further studies are needed to explain why some associations only occurred based on the LDL-C concentrations estimated by the Friedewald equation and for the methylation levels, which were only different when compared to the LDL-C concentrations at the lowest cut-off values based on the Martin equation.

Concentrations of LDL-C in individuals with high cardiovascular risk based on an estimated arterial pressure of 160 mmHg (5%).

(DOCX)

Click here for additional data file.

Concentrations of LDL-C in individuals with high cardiovascular risk based on an estimated arterial pressure of 140 mmHg (3%).

(DOCX)

Click here for additional data file.

(DOCX)

Click here for additional data file.

30 Apr 2020

PONE-D-20-07249

The direct correlation between oxidative stress and LDL-C levels in adults is maintained by the Friedewald and Martin equations, but the methylation levels in the MTHFR and ADRB3 genes differ

PLOS ONE

Dear Mrs. Oliveira,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Jun 14 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Juan J Loor

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Our internal editors have evaluated your manuscript and determined that it is within the scope of our 'Primary and Secondary Prevention of Cardiovascular Disease' Call for Papers. This collection of papers is headed by a team of Guest Editors for PLOS ONE and will encompass a diverse range of research articles. Additional information can be found on our announcement page: (https://collections.plos.org/s/prevention-cardiovascular). If you would like your manuscript to be considered for this collection, please let us know in your cover letter and we will ensure that your paper is treated as if you were responding to this call. If you would prefer to remove your manuscript from collection consideration, please specify this in the cover letter.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

'We thank the funding agencies that made the project possible: Brazilian National Council for

Scientific and Technological Development (Conselho Nacional Desenvolvimento Científico e

Tecnológico - CNPq), Ministry of Health, and Research Support Foundation of the State of

Paraíba (Fundação de Amparo à Pesquisa do Estado da Paraíba - FAPESQ); and the research

collaborators (Graduate Program in Nutritional Sciences, University of Paraíba).'

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

'NO - Include this sentence at the end of your statement: The funders had no role in

study design, data collection and analysis, decision to publish, or preparation of the

manuscript.'

4. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

5. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

Additional Editor Comments (if provided):

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The paper “The direct correlation between oxidative stress and LDL-C levels in adults is maintained by the Friedewald and Martin equations, but the methylation levels in the MTHFR and ADRB3 genes differ” by Jéssica Vicky Bernardo de Oliveira et al. is of some interest but I have some doubts which are difficult to be showed because the text is without pages and lines number. Therefore, I have showed the words-sentences and some comments have been done.

The number of pages is considering the whole document I received (sorry, but next time I shall not make any referee work on similar situation).

Introduction:

- Pag. 8, the sentence: “The biochemical, anthropometric and consumption variables are justified based on the following description:“ does not seem to be complete.

Materials and Methods

- Pag. 11, …” Weight and height measurements were carried out in triplicate…” did they occurred at the 3 times of dietary recalls? Please to explain;

- Pag. 13, it is suggested: “blood samples were collected at 8:30 a.m. ± 10 min from all individuals to avoid a potential sampling effect.” Please to explain the reason.

Results

- Pag. 18, Table 2 I cannot imagine that Homocysteine could be “mol/L”

- Pag. 19, Table 3 only dietary cholesterol has been included? See some notes in Portuguese

- Pag. 20, Table 4 the LPL gene was not included in model 5?

Discussion

- Pag. 21, the following sentence: “The results from the only study found in the literature that compared the LDL-C levels estimated using the two equations in an adult population cannot be compared with the results of the present study because the objectives were different, considering that no comparisons were made between the two equations but, rather, between their results and the direct method” suggests me a question to the authors: Why you did not measure directly the LDL-C or why you did not discuss the two calculated values on the light of papers which have done this comparison? (in Pag. 24 this was considered a limitation of the paper: “Another limitation is the fact that the LDL-C values were not assessed by the direct method”);

- Pag. 21, the following sentence; “MDA was the only variable that positively influenced LDL-C concentrations, calculated based on the Friedewald (36) and Martin et al. “ but are you sure that MDA influence LDL-C and not vice versa?

- Pag. 22, there are different sentences suggesting a relationship between DNA methylation of some genes and the levels of LDL-C or some data like obesity, fat storages etc. Sorry, I am not an expert of the topic, but I want pose two questions: i) the epigenetic effects would be at tissue level, thus can you measure methylation at blood level? ii) methylation can have different effects according to the gene site in which occurred, can you consider that?

- Pag. 23, there is a sentence: “the population presented high MDA values, these values likely affect the lipid profile, increasing the LDL-C concentrations in the analysed models in the study population, with 75% to 67% of the LDL-C concentrations considered adequate, according to the two equations used.” But, again, MDA is more likely affected by lipid profile and perhaps by micro-inflammatory conditions which occur when there is obesity and high LDL-C;

- Pag. 23, “…several studies have shown that MDA and LDL-C values decrease in animal models with interventions based on the intake of different foods (21, 22, 27).” First of all it would be useful to better explain which foods are decreasing the LDL-C, moreover I am asking why very few or no dietary data of the experiment are been discussed;

- Pag. 24, in fact, in the Pag. 24, some sentences are concerned with the above topic: “…here was a positive influence of age, habitual cholesterol intake and WC on LDL-C levels.” Then “…even when the total fat intake was within the reference range (29%) (70) and the habitual cholesterol intake was 243.51 mg, an influence of this intake on LDL-C levels was identified. The explanation for this discrepancy may involve the type of fat consumed.” These topics are very important for a better explanation of the results and therefore the authors are invited to show the results of the dietary survey and to discuss them.

Conclusions

Must be changed according to the suggested improvements of the discussion.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

30 Jun 2020

A rebuttal letter that answers each point raised by the academic editor and reviewer.

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Our internal editors have evaluated your manuscript and determined that it is within the scope of our 'Primary and Secondary Prevention of Cardiovascular Disease' Call for Papers. This collection of papers is headed by a team of Guest Editors for PLOS ONE and will encompass a diverse range of research articles. Additional information can be found on our announcement page: (https://collections.plos.org/s/prevention-cardiovascular). If you would like your manuscript to be considered for this collection, please let us know in your cover letter and we will ensure that your paper is treated as if you were responding to this call. If you would prefer to remove your manuscript from collection consideration, please specify this in the cover letter.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

'We thank the funding agencies that made the project possible: Brazilian National Council for

Scientific and Technological Development (Conselho Nacional Desenvolvimento Científico e

Tecnológico - CNPq), Ministry of Health, and Research Support Foundation of the State of

Paraíba (Fundação de Amparo à Pesquisa do Estado da Paraíba - FAPESQ); and the research

collaborators (Graduate Program in Nutritional Sciences, University of Paraíba).'

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

Answer: Withdrawn.

'NO - Include this sentence at the end of your statement: The funders had no role in

study design, data collection and analysis, decision to publish, or preparation of the

manuscript.'

4. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

Answer: The database of the present study is present in the public repository, and can be viewed through the link: https://osf.io/t6zn8/?view_only=026188923f00464b8ab252bbc74ef129

5. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

Answer: Jéssica Vicky Bernardo de Oliveira ; ORCID: 0000-0002-4912-6849

Additional Editor Comments (if provided):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

________________________________________

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

________________________________________

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

________________________________________

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

________________________________________

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The paper “The direct correlation between oxidative stress and LDL-C levels in adults is maintained by the Friedewald and Martin equations, but the methylation levels in the MTHFR and ADRB3 genes differ” by Jéssica Vicky Bernardo de Oliveira et al. is of some interest but I have some doubts which are difficult to be showed because the text is without pages and lines number. Therefore, I have showed the words-sentences and some comments have been done.

The number of pages is considering the whole document I received (sorry, but next time I shall not make any referee work on similar situation).

Introduction:

- Pag. 8, the sentence: “The biochemical, anthropometric and consumption variables are justified based on the following description:“ does not seem to be complete.

Answer: Was withdrawn.

Materials and Methods

- Pag. 11, …” Weight and height measurements were carried out in triplicate…” did they occurred at the 3 times of dietary recalls? Please to explain;

Answer: Weight and height measurements were taken three times in the same day, so that there was no error.

- Pag. 13, it is suggested: “blood samples were collected at 8:30 a.m. ± 10 min from all individuals to avoid a potential sampling effect.” Please to explain the reason.

Answer: It is known that the gene expression of nucleated blood cells changes ex-vivo shortly after collection [1]. In this sense, even though the DNA suffers less interference from pre-analytical variables, because it has the nitrogen bases more protected in the double helix, with a minimum space for enzymatic attacks [2], a schedule that allows the shortest time between collection was standardized, transport and storage of samples.

[1] Malentacchi F, Pazzagli M, Simi L, Orlando C, Wyrich R, Gunther K et al. SPIDIA-RNA: second external quality assessment for the pre-analytical phase of blood samples used for RNA based analyses. PLoS One. 2014; 9:e112293.

[2] Ziehler WA, Engelke DR. Probing RNA structure with chemical reagentes and enzymes. Curr Protoc Nucleic Acid Chem 2001; Chapter 6:Unit 6 1.

Results

- Pag. 18, Table 2 I cannot imagine that Homocysteine could be “mol/L”

Answer: The typo was corrected. µmol / L

- Pag. 19, Table 3 only dietary cholesterol has been included? See some notes in Portuguese

Answer: The habitual consumption variables added in model 3 of the statistics were: CHO, PTN, LIP, vitamin A, beta-carotene, vitamin C, vitamin E, vitamin B12, polyunsaturated fats, monounsaturated fats, oleic acid, omega 3, omega 6, saturated fat, cholesterol, trans fats, selenium and folate, however, only the values of the variable (cholesterol) that showed a significant association with LDL-C values were added in Table 3.

Table 1 shows the blood cholesterol data.

The Portuguese phrase was translated into English.

- Pag. 20, Table 4 the LPL gene was not included in model 5?

Answer: It has been added.

Discussion

- Pag. 21, the following sentence: “The results from the only study found in the literature that compared the LDL-C levels estimated using the two equations in an adult population cannot be compared with the results of the present study because the objectives were different, considering that no comparisons were made between the two equations but, rather, between their results and the direct method” suggests me a question to the authors: Why you did not measure directly the LDL-C or why you did not discuss the two calculated values on the light of papers which have done this comparison? (in Pag. 24 this was considered a limitation of the paper: “Another limitation is the fact that the LDL-C values were not assessed by the direct method”);

Answer: Although it is important to accurately assess LDL-C through direct measurements, in routine clinical practice, LDL-C levels are generally estimated worldwide using the Friedewald formula [3], when triglyceride levels are below 400 mg / dL. The high cost of analysis of direct measurement methods (such as homogeneous enzyme assay or use of ultracentrifuge) made the use in the present population-based study unfeasible.

3. Catapano AL, Graham I, de Backer G, Wiklund O, Chapman MJ, Drexel H, et al. 2016 ESC/EAS Guidelines for the Management of Dyslipidaemias. Rev Española Cardiol. 2017;70(2):115.

Zabłocka-Słowińska, k. Oxidative stress in lung cancer patients is associated with altered serum markers of lipid metabolism. PLOS ONE, 2019. Doi: 10.1371/journal.pone.0215246

The results of the study by Lee et al. (14) are presented according to the agreement with the direct method, which makes the comparison unfeasible. Lee et al. (14) observed that the Martin equation exhibited significantly higher overall agreement with the classifications of the NCEP-ATP III guidelines, than the Friedewald equation, as already described in the present article.

14. Lee J, Jang S, Son H. Validation of the Martin Method for Estimating Low-Density Lipoprotein Cholesterol Levels in Korean Adults: Findings from the Korea National Health and Nutrition Examination Survey, 2009-2011. Passi AG, editor. PLoS One. 2016;11(1):1–14.

- Pag. 21, the following sentence; “MDA was the only variable that positively influenced LDL-C concentrations, calculated based on the Friedewald (36) and Martin et al. “ but are you sure that MDA influence LDL-C and not vice versa?

In the study by Yang et al. [23] it was demonstrated that the impairment of the integrity and survival of human coronary artery endothelial cells (HCAECs) induced by oxidized LDL is mediated by the MDA epitope and involves the methylation of the prosurvival fibroblast growth factor 2 (FGF2) promoter and the negative regulation of intracellular FGF2. Signaling pathway through which MDA can mediate LDL-C oxidation.

23. Yang TC, Chen YJ, Chang SF, Chen CH, Chang PY, Lu SC. Malondialdehyde mediates oxidized LDL-induced coronary toxicity through the Akt-FGF2 pathway via DNA methylation. J Biomed Sci. 2014;21(1):1–12.

According to the reading of the scientific community, we observed that there is no consensus regarding the questioned influence. However, in the present study we identified that the MDA was positively related to the LDL-C values.

- Pag. 22, there are different sentences suggesting a relationship between DNA methylation of some genes and the levels of LDL-C or some data like obesity, fat storages etc. Sorry, I am not an expert of the topic, but I want pose two questions: i) the epigenetic effects would be at tissue level, thus can you measure methylation at blood level? ii) methylation can have different effects according to the gene site in which occurred, can you consider that?

Answer: We fully understand your questioning, which was justified in our published article.

Lima, R.P.A.; NASCIMENTO, R.A.F. Effect of a diet containing folate and hazelnut oil capsule on the methylation level of the ADRB3 gene, lipid profile and oxidative stress in overweight or obese women, Clinical Epigenetics, 2017. DOI 10.1186/s13148-017-0407-6.

The blood was chosen for the analysis as it is a metabolically active tissue, with an important role in the adverse inflammatory and vascular consequences of adiposity, and is widely used for clinical diagnostic purposes.

- Pag. 23, there is a sentence: “the population presented high MDA values, these values likely affect the lipid profile, increasing the LDL-C concentrations in the analysed models in the study population, with 75% to 67% of the LDL-C concentrations considered adequate, according to the two equations used.” But, again, MDA is more likely affected by lipid profile and perhaps by micro-inflammatory conditions which occur when there is obesity and high LDL-C;

Answers: As suggested, changes were made to the text.

Malondialdehyde (MDA) is a final product of oxidative decomposition initiated by radical polyunsaturated fatty acids; therefore, it is often used as a biomarker of oxidative stress (23).

23. Yang TC, Chen YJ, Chang SF, Chen CH, Chang PY, Lu SC. Malondialdehyde mediates oxidized LDL-induced coronary toxicity through the Akt-FGF2 pathway via DNA methylation. J Biomed Sci. 2014;21(1):1–12.

[59] Lopes-Virella MF, Hunt KJ, Baker NL, Virella G, Moritz T. The levels of MDA-LDL in circulating immune complexes predict myocardial infarction in the VADT study. Atherosclerosis. 2012;224(2):526–31.

- Pag. 23, “…several studies have shown that MDA and LDL-C values decrease in animal models with interventions based on the intake of different foods (21, 22, 27).” First of all it would be useful to better explain which foods are decreasing the LDL-C, moreover I am asking why very few or no dietary data of the experiment are been discussed;

Answers: Regarding the relationship between MDA and LDL-C, several studies have shown that MDA and LDL-C values decrease in animal models with interventions based on the intake of different foods: Garlic (Allium sativum L.) polysaccharide (21), Chicory (Cichorium intybus L.) polysaccharides (22), Morechella esculenta polysaccharide (27).

As for dietary consumption, the authors were concerned about the extent of the discussion. If necessary, we add.

21. Wang Y, Guan M, Zhao X, Li X. Effects of garlic polysaccharide on alcoholic liver fibrosis and intestinal microflora in mice. Pharm Biol. 2018;56(1):325–32.

22. Wu Y, Zhou F, Jiang H, Wang Z, Hua C, Zhang Y. Chicory (Cichorium intybus L.) polysaccharides attenuate high-fat diet induced non-alcoholic fatty liver disease via AMPK activation. Int J Biol Macromol. 2018;118:886–95.

27. Dong Y, Qi Y, Liu M, Song X, Zhang C, Jiao X, et al. Antioxidant, anti-hyperlipidemia Land hepatic protection of enzyme-assisted Morehella esculenta polysaccharide. Int J Biol Macromol. 2018;120(2018):1490–9.

- Pag. 24, in fact, in the Pag. 24, some sentences are concerned with the above topic: “…here was a positive influence of age, habitual cholesterol intake and WC on LDL-C levels.” Then “…even when the total fat intake was within the reference range (29%) (70) and the habitual cholesterol intake was 243.51 mg, an influence of this intake on LDL-C levels was identified. The explanation for this discrepancy may involve the type of fat consumed.” These topics are very important for a better explanation of the results and therefore the authors are invited to show the results of the dietary survey and to discuss them

Answer: We added to the discussion as requested, however, we did not add the tables due to the length of the article, but if it is convenient for the reviewers, we will add it.

Another explanation for this discrepancy may involve the type of fat consumed, since, in the case of the present study, the consumption of saturated fatty acids was 12%, exceeding the recommendation according to the National Institute of Heart, Lung and Blood: Detection, assessment and treatment of high blood cholesterol levels in adults (adult treatment panel III), final report, US Department of Health and Human Services, NIH Publication No. 02-5215, Bethesda, Maryland, September 2002.

Conclusions

Must be changed according to the suggested improvements of the discussion.

________________________________________

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: Response to reviewers.docx

Click here for additional data file.

5 Aug 2020

PONE-D-20-07249R1

The direct correlation between oxidative stress and LDL-C levels in adults is maintained by the Friedewald and Martin equations, but the methylation levels in the MTHFR and ADRB3 genes differ

PLOS ONE

Dear Dr. Oliveira,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Sep 19 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Juan J Loor

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: (No Response)

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The paper “The direct correlation between oxidative stress and LDL-C levels in adults is maintained by the Friedewald and Martin equations, but the methylation levels in the MTHFR and ADRB3 genes differ” by Jéssica Vicky Bernardo de Oliveira et al. has been modified according previous suggestions and now can be reviewed more easily.

With respect to Introduction, Materials and Methods and Results, the changes are satisfactorily (except in Table 1: Triglycerides (mg/d); while for Discussion, some further changes would be useful:

- Lines 410-414, perhaps the authors could spend some words to talk about the relationship between direct measurement and calculated values of LDL-C observed by Lee et al.;

- Lines 478-481 and later line 488 are concerning oxidative stress and inflammation which are often related; in this case the inflammation (CRP) seems at low levels therefore I ask whether the evaluated diets could suggest a lack of antioxidants (as suggested in line 496);

- Line 499 and till 519, the levels of triglycerides, that of course are carried out by LDL, are affected by several factors and some are dietary (not only total fat, SAFA etc., but also the high levels of carbohydrates; can the authors better show the results of their dietary survey and whether some nutrient levels are related to LDL-C, MDA etc.?

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

10 Aug 2020

- Pag. 8, the sentence: “The biochemical, anthropometric and consumption variables are justified based on the following description:“ does not seem to be complete.

Answer: Phrase withdrawn

Materials and Methods

- Pag. 11, …” Weight and height measurements were carried out in triplicate…” did they occurred at the 3 times of dietary recalls? Please to explain;

Answer: Weight and height measurements were taken three times in the same day, so that there was no error.

- Pag. 13, it is suggested: “blood samples were collected at 8:30 a.m. ± 10 min from all individuals to avoid a potential sampling effect.” Please to explain the reason.

Answer: It is known that the gene expression of nucleated blood cells changes ex-vivo shortly after collection [1]. In this sense, even though the DNA suffers less interference from pre-analytical variables, because it has the nitrogen bases more protected in the double helix, with a minimum space for enzymatic attacks [2], a schedule that allows the shortest time between collection was standardized, transport and storage of samples.

[1] Malentacchi F, Pazzagli M, Simi L, Orlando C, Wyrich R, Gunther K et al. SPIDIA-RNA: second external quality assessment for the pre-analytical phase of blood samples used for RNA based analyses. PLoS One. 2014; 9:e112293.

[2] Ziehler WA, Engelke DR. Probing RNA structure with chemical reagentes and enzymes. Curr Protoc Nucleic Acid Chem 2001; Chapter 6:Unit 6 1.

Results

- Pag. 18, Table 2 I cannot imagine that Homocysteine could be “mol/L”

Answer: The typo was corrected. µmol / L

- Pag. 19, Table 3 only dietary cholesterol has been included? See some notes in Portuguese

Answer: The habitual consumption variables added in model 3 of the statistics were: CHO, PTN, LIP, vitamin A, beta-carotene, vitamin C, vitamin E, vitamin B12, polyunsaturated fats, monounsaturated fats, oleic acid, omega 3, omega 6, saturated fat, cholesterol, trans fats, selenium and folate, however, only the values of the variable (cholesterol) that showed a significant association with LDL-C values were added in Table 3.

Table 1 shows the blood cholesterol data.

The Portuguese phrase was translated into English.

- Pag. 20, Table 4 the LPL gene was not included in model 5?

Answer: It has been added.

Discussion

- Pag. 21, the following sentence: “The results from the only study found in the literature that compared the LDL-C levels estimated using the two equations in an adult population cannot be compared with the results of the present study because the objectives were different, considering that no comparisons were made between the two equations but, rather, between their results and the direct method” suggests me a question to the authors: Why you did not measure directly the LDL-C or why you did not discuss the two calculated values on the light of papers which have done this comparison? (in Pag. 24 this was considered a limitation of the paper: “Another limitation is the fact that the LDL-C values were not assessed by the direct method”);

Answer: Although it is important to accurately assess LDL-C through direct measurements, in routine clinical practice, LDL-C levels are generally estimated worldwide using the Friedewald formula [3], when triglyceride levels are below 400 mg / dL. The high cost of analysis of direct measurement methods (such as homogeneous enzyme assay or use of ultracentrifuge) made the use in the present population-based study unfeasible.

3. Catapano AL, Graham I, de Backer G, Wiklund O, Chapman MJ, Drexel H, et al. 2016 ESC/EAS Guidelines for the Management of Dyslipidaemias. Rev Española Cardiol. 2017;70(2):115.

Zabłocka-Słowińska, k. Oxidative stress in lung cancer patients is associated with altered serum markers of lipid metabolism. PLOS ONE, 2019. Doi: 10.1371/journal.pone.0215246

The results of the study by Lee et al. (14) are presented according to the agreement with the direct method, which makes the comparison unfeasible. Lee et al. (14) observed that the Martin equation exhibited significantly higher overall agreement with the classifications of the NCEP-ATP III guidelines, than the Friedewald equation, as already described in the present article.

14. Lee J, Jang S, Son H. Validation of the Martin Method for Estimating Low-Density Lipoprotein Cholesterol Levels in Korean Adults: Findings from the Korea National Health and Nutrition Examination Survey, 2009-2011. Passi AG, editor. PLoS One. 2016;11(1):1–14.

- Pag. 21, the following sentence; “MDA was the only variable that positively influenced LDL-C concentrations, calculated based on the Friedewald (36) and Martin et al. “ but are you sure that MDA influence LDL-C and not vice versa?

In the study by Yang et al. [23] it was demonstrated that the impairment of the integrity and survival of human coronary artery endothelial cells (HCAECs) induced by oxidized LDL is mediated by the MDA epitope and involves the methylation of the prosurvival fibroblast growth factor 2 (FGF2) promoter and the negative regulation of intracellular FGF2. Signaling pathway through which MDA can mediate LDL-C oxidation.

23. Yang TC, Chen YJ, Chang SF, Chen CH, Chang PY, Lu SC. Malondialdehyde mediates oxidized LDL-induced coronary toxicity through the Akt-FGF2 pathway via DNA methylation. J Biomed Sci. 2014;21(1):1–12.

According to the reading of the scientific community, we observed that there is no consensus regarding the questioned influence. However, in the present study we identified that the MDA was positively related to the LDL-C values.

- Pag. 22, there are different sentences suggesting a relationship between DNA methylation of some genes and the levels of LDL-C or some data like obesity, fat storages etc. Sorry, I am not an expert of the topic, but I want pose two questions: i) the epigenetic effects would be at tissue level, thus can you measure methylation at blood level? ii) methylation can have different effects according to the gene site in which occurred, can you consider that?

Answer: We fully understand your questioning, which was justified in our published article.

Lima, R.P.A.; NASCIMENTO, R.A.F. Effect of a diet containing folate and hazelnut oil capsule on the methylation level of the ADRB3 gene, lipid profile and oxidative stress in overweight or obese women, Clinical Epigenetics, 2017. DOI 10.1186/s13148-017-0407-6.

The blood was chosen for the analysis as it is a metabolically active tissue, with an important role in the adverse inflammatory and vascular consequences of adiposity, and is widely used for clinical diagnostic purposes.

- Pag. 23, there is a sentence: “the population presented high MDA values, these values likely affect the lipid profile, increasing the LDL-C concentrations in the analysed models in the study population, with 75% to 67% of the LDL-C concentrations considered adequate, according to the two equations used.” But, again, MDA is more likely affected by lipid profile and perhaps by micro-inflammatory conditions which occur when there is obesity and high LDL-C;

Answers: As suggested, changes were made to the text.

Malondialdehyde (MDA) is a final product of oxidative decomposition initiated by radical polyunsaturated fatty acids; therefore, it is often used as a biomarker of oxidative stress (23).

23. Yang TC, Chen YJ, Chang SF, Chen CH, Chang PY, Lu SC. Malondialdehyde mediates oxidized LDL-induced coronary toxicity through the Akt-FGF2 pathway via DNA methylation. J Biomed Sci. 2014;21(1):1–12.

[59] Lopes-Virella MF, Hunt KJ, Baker NL, Virella G, Moritz T. The levels of MDA-LDL in circulating immune complexes predict myocardial infarction in the VADT study. Atherosclerosis. 2012;224(2):526–31.

- Pag. 23, “…several studies have shown that MDA and LDL-C values decrease in animal models with interventions based on the intake of different foods (21, 22, 27).” First of all it would be useful to better explain which foods are decreasing the LDL-C, moreover I am asking why very few or no dietary data of the experiment are been discussed;

Answers: Regarding the relationship between MDA and LDL-C, several studies have shown that MDA and LDL-C values decrease in animal models with interventions based on the intake of different foods: Garlic (Allium sativum L.) polysaccharide (21), Chicory (Cichorium intybus L.) polysaccharides (22), Morechella esculenta polysaccharide (27).

As for dietary consumption, the authors were concerned about the extent of the discussion. If necessary, we add.

21. Wang Y, Guan M, Zhao X, Li X. Effects of garlic polysaccharide on alcoholic liver fibrosis and intestinal microflora in mice. Pharm Biol. 2018;56(1):325–32.

22. Wu Y, Zhou F, Jiang H, Wang Z, Hua C, Zhang Y. Chicory (Cichorium intybus L.) polysaccharides attenuate high-fat diet induced non-alcoholic fatty liver disease via AMPK activation. Int J Biol Macromol. 2018;118:886–95.

27. Dong Y, Qi Y, Liu M, Song X, Zhang C, Jiao X, et al. Antioxidant, anti-hyperlipidemia Land hepatic protection of enzyme-assisted Morehella esculenta polysaccharide. Int J Biol Macromol. 2018;120(2018):1490–9.

- Pag. 24, in fact, in the Pag. 24, some sentences are concerned with the above topic: “…here was a positive influence of age, habitual cholesterol intake and WC on LDL-C levels.” Then “…even when the total fat intake was within the reference range (29%) (70) and the habitual cholesterol intake was 243.51 mg, an influence of this intake on LDL-C levels was identified. The explanation for this discrepancy may involve the type of fat consumed.” These topics are very important for a better explanation of the results and therefore the authors are invited to show the results of the dietary survey and to discuss them

Answer: We added to the discussion as requested, however, we did not add the tables due to the length of the article, but if it is convenient for the reviewers, we will add it.

Another explanation for this discrepancy may involve the type of fat consumed, since, in the case of the present study, the consumption of saturated fatty acids was 12%, exceeding the recommendation according to the National Institute of Heart, Lung and Blood: Detection, assessment and treatment of high blood cholesterol levels in adults (adult treatment panel III), final report, US Department of Health and Human Services, NIH Publication No. 02-5215, Bethesda, Maryland, September 2002.

Submitted filename: Response to reviewers (1).docx

Click here for additional data file.

17 Sep 2020

The direct correlation between oxidative stress and LDL-C levels in adults is maintained by the Friedewald and Martin equations, but the methylation levels in the MTHFR and ADRB3 genes differ

PONE-D-20-07249R2

Dear Dr. Oliveira,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Juan J Loor

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Please to check the measure unit of triglyceride in Table 1, I am surprise to see mg/d; perhaps there is some mistake

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

30 Oct 2020

PONE-D-20-07249R2

The direct correlation between oxidative stress and LDL-C levels in adults is maintained by the Friedewald and Martin equations, but the methylation levels in the MTHFR and ADRB3 genes differ

Dear Dr. Oliveira:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Juan J Loor

Academic Editor

PLOS ONE

Gene	Primers (F/R)	TA (°C)	Product (bp)	CpG sites	Genomic Location
MTHFR	F 5’–GGTCAGAAGCATATCAGTCATGAG– 3’	58°	213 bp	6	Chr1: 11,785,723–11,805,413)
	R 5’–CTGGGAAGAACTCAGCGAACTCA– 3’
LPL	F 5’–GATGTTGAATATTGAATTATTTTAGTAATA– 3’	63°	235 bp	4	Chr8: 19,939,253–19,967,259)
	R 5’–AAAAATCACCATACCCAACTAATTTT– 3’
ADRB3	F 5’–TAGGTGATTTGGGAGATTTTTTTT– 3’	60°	238 bp	4	Chr8: 37,962,990–37,966,599
	R 5’- CCCCTAACA ACCCACTAATATTAAC– 3’

F–forward; R–reverse; Ta−annealing temperature.