Literature DB >> 33302904

Increased Association of Deamidated αA-N101D with Lens membrane of transgenic αAN101D vs. wild type αA mice: potential effects on intracellular ionic imbalance and membrane disorganization.

Om Srivastava1, Kiran Srivastava2, Roy Joseph2, Landon Wilson3.   

Abstract

We have generated two mouse models, in one by inserting the human lens αAN101D transgene in CRYαAN101D mice, and in the other by inserting human wild-type αA-transgene in CRYαAWT mice. The CRYαAN101D mice developed cortical cataract at about 7-months of age relative to CRYαAWT mice. The objective of the study was to determine the following relative changes in the lenses of CRYαAN101D- vs. CRYαAWT mice: age-related changes with specific emphasis on protein insolubilization, relative membrane-association of αAN101D vs. WTαA proteins, and changes in intracellular ionic imbalance and membrane organization.
METHODS: Lenses of varying ages from CRYαAWT and CRYαAN101D mice were compared for an age-related protein insolubilization. The relative lens membrane-association of the αAN101D- and WTαA proteins in the two types of mice was determined by immunohistochemical-, immunogold-labeling-, and western blot analyses. The relative levels of membrane-binding of recombinant αAN101D- and WTαA proteins was determined by an in vitro assay, and the levels of intracellular Ca2+ uptake and Na, K-ATPase mRNA were determined in the cultured epithelial cells from lenses of the two types of mice.
RESULTS: Compared to the lenses of CRYαAWT, the lenses of CRYαAN101D mice exhibited: (A) An increase in age-related protein insolubilization beginning at about 4-months of age. (B) A greater lens membrane-association of αAN101D- relative to WTαA protein during immunogold-labeling- and western blot analyses, including relatively a greater membrane swelling in the CRYαAN101D lenses. (C) During in vitro assay, the greater levels of binding αAN101D- relative to WTαA protein to membranes was observed. (D) The 75% lower level of Na, K-ATPase mRNA but 1.5X greater Ca2+ uptake were observed in cultured lens epithelial cells of CRYαAN101D- than those of CRYαAWT mice.
CONCLUSIONS: The results show that an increased lens membrane association of αAN101D--relative WTαA protein in CRYαAN101D mice than CRYαAWT mice occurs, which causes intracellular ionic imbalance, and in turn, membrane swelling that potentially leads to cortical opacity.

Entities:  

Keywords:  Cataract; Crystallins; Deamidation; Lens; Post-translational modifications; Transgenic mice

Mesh:

Substances:

Year:  2020        PMID: 33302904      PMCID: PMC7726915          DOI: 10.1186/s12886-020-01734-0

Source DB:  PubMed          Journal:  BMC Ophthalmol        ISSN: 1471-2415            Impact factor:   2.209


Background

Although the cornea is the primary refractive tissue performing 70–80% of refraction of the eye, the major function of the lens is in accommodation and to partly help in the refraction. The lens accommodative function gradually diminishes with age, and is almost completely lost at age of > 50 years. The lens transparency plays an important role in focusing light on to the retina, but this role is gradually lost as it develops age-related opacity. Several unique factors maintain lens transparency for up to > 60 year of our life time. These include: cellular homeostasis among only two types of cells (epithelial and fiber cells) [1], an orderly terminal differentiation of epithelial to fiber cells with precise organelles loss [2], the unique interactions among crystallins [3], with almost no protein turnover [4], the specialized lens metabolism [5], specific interactions among α-crystallin and membrane [6], the precise maintenance of intracellular and extracellular ionic concentrations [7], the low levels of cellular water and oxygen in the lens inner cortex and nuclear regions [8], and a unique membrane lipid composition [9]. Alterations among some of these lens unique factors play direct or indirect roles in pathogenesis of cataracts (e.g., pediatric- and age-related cataracts). However, additional cataract-causative factors are also identified, which include mutations in crystallins [10], oxidative insults of crystallins, the loss of redox balance of glutathione [11], extensive truncations of α-, β-, and γ-crystallins [12-20], a variety of post-translational modifications with deamidation as being the most abundant [21-25], and the loss of membrane integrity [7, 26, 27]. These factors individually or in combination also cause lens opacity through altered lens cellular structures and contents, ionic imbalance, increased water and oxygen levels, loss of natural interactions among crystallins, and crystallins’ unfolding, degradation and cross-linking. Our focus in this study is the potential roles of deamidation of Asn101 of αA crystallin to Asp that introduces negative charges and shown to alter their hydrophobicity, tertiary structures, crystallin-crystallin interactions, and leads to aggregation and cross-linking [21-27]. In this study, the deamidation of Asn101 to Asp in in a mouse model was studied to determine phenotypic and molecular changes within the lens due to deamidation of a single nucleotide change in CRYAA crystallin gene. This site was chosen because our past study showed that only deamidation of Asn localized at specific sites in crystallins (e.g., deamidation of N101 but not of N123 residues in αA-crystallin [24], and of N146 but not of N78 of αB-crystallin) exhibited the above-described deamidation-induced effects [25]. To show the potential effects of deamidation in vivo, we have generated mouse models by inserting the human lens αA-N101D transgene in CRYαAN101D mice, and human lens wild-type αA-transgene in CRYαAWT mice (to act as a control). The CRYαAN101D mice developed cortical cataract at about 7-months of age relative to CRYαAWT mice [28, 29]. This model showed for the first time that in vivo expression of the deamidated αAN101D caused cortical lens opacity, which was due to the disruption of fiber cell structural integrity and protein insolubilization as aggregation [28]. The comparative RNA sequencing and Ingenuity Pathway Analyses (IPA) of lenses from 2- and 4-months old CRYαAN101D- and CRYαAWT mice showed that the genes belonging to cellular assembly and organization, cell cycle and apoptosis networks were altered in αAN101D lenses [29]. This was accompanied with several cellular defects in αAN101D lenses that included defective terminal differentiation (increased proliferation and decreased differentiation) of epithelial cells to fiber cells, and reduced fiber cells denucleation and expressions of Rho A and Na, K-ATPase (the major lens membrane-bound molecular transporter) [29]. The findings also suggested the potential role of lens intracellular ionic imbalance as the major reason for the development of cataract [29]. The above findings suggested that the altered intracellular ionic imbalance could be due to potential loss of membrane integrity that caused cortical opacity at about 7-months of age in the CRYαAN101D mouse model. Therefore, the focus of the present study was to determine whether an increased membrane-association of αAN101D potentially compromises membrane integrity, and causes an ionic imbalance and leads to cataract development.

Methods

Ethics statement

All animal experiments were performed per protocols approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Alabama at Birmingham (Protocol no. 130208393). Mice were housed in a pathogen-free environment at the facility of the University of Alabama at Birmingham.

Materials

Unless stated otherwise, the molecular biology-grade chemicals were purchased from Millipore-Sigma (St. Louis, MO, USA) or Fisher (Atlanta, GA, USA) companies. The Rabbit polyclonal anti-human aquaporin-0 (AQP0) antibody was purchased from Alpha Diagnostics (San Antonio, TX, USA). Additional commercial sources of various chemicals and antibodies used in the study are described throughout the text.

Generation of transgenic mice

The mouse model that expresses a human αA-crystallin gene in which Asn-101 was replaced with Asp is referred to as αAN101D-transgenic mouse model. This model has been considered to be “deamidated” in this study, and the mice expressing αAN101D-transgene is referred here as CRYαAN101D mice. Both mouse models (human lens αAN101D transgenic- and human wild-type αA-transgenic mouse models were generated in Dr. Om Srivastava’s laboratory [28]. Independent transgenic (Tg) mouse lines were established from transgenic founders using C57BL/6 mice (Harlan Laboratories, Indianapolis, IN). αAN101D protein expression constituted about 14 and 14.2% of the total αA in the lens WS-and WI-proteins of the αAN101D transgenic mice, respectively [28]. The mouse lenses were extracted after the mice were euthanized using the CO2 procedure as per approved method by the Institutional Animal Care and Use Committee (IACUC) of the University of Alabama at Birmingham (Protocol no.130208393). Adult (2–3 months) wild type mice (C57BL6) were obtained from the university breeding colony. Animals were kept under a 12/12 h light–dark cycle and had ad libitum access to food and water. We have used three mice from each group of CRYαAWT mice control and αAN101D mice in all the experiments described below.

Isolation of water soluble (WS)- and water insoluble (WI)-proteins from mouse lenses

The WS- and WI-protein fractions from lenses of desired ages of CRYαAWT- and CRYαAN101D mice were prepared as previously described by us [28]. All procedures were performed at 5 °C unless specified otherwise. The lenses were removed under a dissecting microscope and placed in 5 °C-cold buffer A (5 mM Tris-HCl, 1 mM EDTA, 1 mM DTT, pH 7.8, and protease inhibitor cocktail [Roche Life Science, Indianapolis, IN]), and centrifuged at 14,000 x g for 15 min at 5 °C to separate the WS- and WI- protein fractions. The supernatant (WS-protein fraction) was collected, and next the pellet (WI-protein fraction) was resuspended in buffer A, centrifuged as above. The recovery of WS- and WI-protein fractions was repeated twice after centrifugation, and the WS supernatants after each centrifugation steps were pooled. The final WI-protein pellet was solubilized in 5 mM Tris-HCl, pH 7.5, containing 8 M urea, 5 mM EDTA, and 5 mM EGTA. The 8 M urea concentration was diluted to 4 M urea with buffer A prior to centrifugation as above. The protein concentrations in these fractions were determined by using a kit (Pierce Biotechnology-Thermo Fisher) using bovine serum albumin as a standard.

Membrane isolation from mouse lenses

The membranes from lenses of 1- and 6-month-old CRYαAWT and CRYαAN101D mice were prepared as described previously [30, 31]. Lenses of identical ages from both types of mice were homogenized in buffer B (0.05 M Tris-HCl, pH 8.0 containing 5 mM EDTA, 1 mM DTT, 150 mM NaCl, and protease inhibitor cocktail [Roche, Indianapolis, IN]), and the preparations were centrifuged at 100,000 x g for 30 min using Beckman TL 100 centrifuge with a TLA 100.3 rotor. The supernatant was collected, and the pellets were washed twice with the above buffer B and centrifuged as above. This was followed by three additional washes with buffer B containing 8 M urea and centrifugation as above after each wash. Next, the pellet was washed twice with water and centrifuged as above. The pellet was then washed with 0.1 M cold (5 °C) NaOH [30, 31]. A final wash of pellet was with water and centrifugation as above to recover the purified lens membrane preparations as pellets.

Purification of recombinant WTαA- and αA-N101D-crystallins, their conjugation with Alexa Fluor 350 and membrane binding

The WTαA- and αA-N101D mutant proteins were expressed in E.coli and purified by a Ni-affinity column chromatographic method as previously described by us [28]. Each protein was labeled with Alexa-350 using a protein labeling kit as suggested by the manufacturer (Molecular Probes, Carlsbad, CA). The binding of Alexa 350-conjugated WT αA- and αA-N101D mutant proteins to mouse lens membrane (isolated from C57BL non-transgenic mice) was determined as previously described [32, 33]. During the binding assay, the purified lens membrane (containing 2.5 mg protein; isolated from 1 to 3-month old non-transgenic C57 mice) was incubated with increasing but identical concentrations of either Alexa-labelled WT αA- or αA-N101D proteins at 37οC for 6 h. Next, the incubated preparations were centrifuged at 14,000 X g and the supernatant and pellet (membrane fraction) recovered. After washing the membrane fraction with water and centrifugation as above, the relative levels of fluorescence of membranes incubated with WT αA- and αA-N101D mutant proteins were determined using Perkin Elmer Multiplate Reader (Model Victor1420–04).

Determination of intracellular Ca2+ in epithelial cells in culture from lenses of CRYαAWT - and CRYαAN101D mice

To culture epithelial cells, six 5-months old lenses from CRYαAWT - and CRYαAN101D mice were excised and incubated with 0.25% trypsin at 37ο C for 2.5 h in an incubator with 5% CO2-humidified air. Next, the lens cells in trypsin solution were centrifuged at 1200 rpm for 3 min, and trypsin (in the supernatant) was discarded. The lens epithelial cells (recovered as pellet) were suspended in medium 199 (Thermo Fisher Scientific, Grand Island, NY) containing 10% fetal calf serum (Hyclone, Logan, Utah) and 1% antibiotic-antimycotic solution (Thermo Fisher Scientific, Grand Island, NY) in 12-well plates (Corning, Franklin Lakes, NJ). After 24 h, the unattached cells were discarded by washing with the above medium. The old medium was replaced with fresh medium after every 48 h, and the cells were allowed to grow for 7 to 10 days until confluent. Next, the confluent cells were trypsinized and seeded in 12-well plates for intercellular Ca2+ determination and were allowed to grow for 24 h. The cells were washed with medium 199 without phenol red, incubated in calcium orange dye (Thermo Fisher Scientific, Grand Island, NY) at a final concentration of 4 μM for 30 min at room temperature as instructed in the manufacturer’s protocol. After 30 min, the cells were washed with the above medium, and Ca2+ indicator was examined under a microscope (Leica DMI 4000B) using a Texas Red filter.

Western blot and Immunohistochemical analyses

The WS- and WI-proteins and membrane fractions isolated from lenses were analyzed for their immunoreactivity with anti-aquaporin-0 antibody (to visualize the membrane intrinsic protein), and Mouse anti-His monoclonal antibody ([Novagen, Madison, WI], to visualize WTαA and αAN101D) during Western blot analysis. The SDS-PAGE analysis was carried out as described by Laemmli [34]. The confocal immunohistochemical analysis of lens axial sections of WTαA and αAN101D was carried out as previously described by us [28]. The analysis was performed at the High-Resolution Imaging core facility of the University of Alabama at Birmingham.

Localization by Immunohistochemical-transmission Electron microscopic method

The analysis was performed at the High-Resolution Imaging core facility of the University of Alabama at Birmingham. His-tagged αAWT- and αAN101D-crystallins were localized in lens cells by an Aurion immunogold method and the reagents used were Aurion Conventional Immunogold reagents (Electron Microscopy Science [PA]). Lenses of desired ages were fixed in phosphate-buffered saline, pH 7.4 containing 4% paraformaldehyde and 0.05% glutaraldehyde (Electron Microscopy Sciences, Hatfield, PA) for 2 h at room temperature, and then overnight at 4 °C. The fixed lenses were washed with water (Millipore, Billerica, MA). Samples were dehydrated by ascending ethanol gradient series followed by infiltration overnight at 4 °C with absolute ethanol: London Resin (LR) white (1:1). Next, the samples were incubated overnight with pure LR white resin on a rotating platform. The lenses were removed and transferred to gelatin capsules containing fresh LR white and allowed to polymerize for 24 h at 45–50 °C. Ultra-thin (silver gold to light gold) LR white lens sections were collected on nickel mesh grids. The color of sections was silver-gold to light gold, and based on their color, the thickness was estimated to between 70 and 80 nm. For immunogold-labeling, the protocol as described in Electron Microscopy Sciences (Hatfield, PA) was precisely followed. To inactivate aldehyde groups present after aldehyde fixation, the samples on grids were incubated on 0.05 M glycine in PBS buffer for 10–20 min. Next, the grids were transferred onto drops of the matching Aurion blocking solution for 15 min, and then were washed for 15 min in incubation solution (PBS containing 0.1% bovine serum albumin and 15 mM NaN3, pH 7.3). This was followed by a 2X wash in incubation buffer, each time for 5 min. The grids were incubated with two primary antibodies (Mouse anti-His monoclonal antibody and Rabbit anti-aquaporin-0 polyclonal antibody for 1 h. In controls, the primary antibodies were omitted. The grids were then washed 6X (5 min each time) with the incubation solution and transferred to following secondary antibody conjugates {(goat anti-Rabbit EM grade conjugate 25 nm diameter) and (goat anti- mouse EM grade conjugate 10 nm diameter)} and were incubated for 30 min to 2 h. The grids were washed on drops of incubation solution for 6X (5 min each time). The grids were washed twice with PBS for 5 min, post-fixed in 2% glutaraldehyde in PBS for 5 min, and finally washed with distilled water and contrasted according to standard procedures. Lens sections were imaged using an FEI 120kv Spirit TEM (FEI-Thermo Fisher), and images were collected using an AMT (AMT-Woburn, MA) digital camera.

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-PCR [qPCR])

RNA was extracted with Trizol reagent (Invitrogen) from cultured lens epithelial cells from CRYαAN101D and CRYαAWT mice, and all the samples were analyzed in triplicates. Real-time PCR quantifications were performed using the BIO-RAD iCycler iQ system (Bio-Rad, Hercules, CA), using a 96-well reaction plate for a total volume of 25 μL. RNA was extracted as described above. Primers were designed using Primer3 for the following genes: Atp1a2 Forward-5’CGGGAGCCATAAGGGTTTGT 3′, and Atp1a2 Reverse- 5’GCACTGACTTGGCTGTTGTG 3′. The ACTB gene was used for normalization. The reaction mixture included 12.5 μL of Real- Time SYBR Green PCR master mix, 2.5 μL of reverse transcription product, 1 μL of forward and reverse primer and 8 μL of DNase/RNase free water. The reaction mixtures were initially heated to 95 °C for 10 min to activate the polymerase, followed by 40 cycles, which consisted of a denaturation step at 95 °C for 15 s, annealing at 55 °C for 60 s and an elongation step at 72 °C. The qRT-PCR data were analyzed by the comparative ΔCt method.

Results

Age-related protein Insolubilization in lenses of CRYαAN101D and CRYαAWT mice

To determine at what age there is change in the protein profiles in lenses of CRYαAN101D and CRYαAWT mice occurred, a comparative analysis of WS-proteins and WI-proteins from the lenses of the two types of mice of different ages was carried out (Fig. 1). The WS- and WI-proteins from lenses of different ages (1-, 3-, 4-, 5- and 7-months) were analyzed by SDS-PAGE. The WS-protein profiles from the lenses of the CRYαAN101D and CRYαAWT mice were almost identical until 3-months of age, except lens preparations from ages of 4-, 5- and 7-months of CRYαAN101D mice exhibited relatively greater levels of aggregated protein of Mr > 30 kDa and higher relative to same-aged lenses from CRYαAWT mice (Lanes 4 and 5 in Fig. 1b). Additionally, on quantification, the relatively increasing levels of WS-proteins showed age-related water insolubilization beginning at 4-months of age in the lenses of αAN101D mice (Table 1). Between 4- to 7-months of age, relatively about 5 to 10% higher proteins became insoluble in lenses of CRYαAN101D.To determine changes in individual crystallins due to their insolubilization, the WS-protein fraction from 7-month-old lenses was fractionated by a size-exclusion HPLC using a G-4000PWXL column (Tosoh Biosciences, fractionation range of protein with Mr’s between 1X104 to 1X107 Da). The comparative protein elution profiles at 280 nm of 7-month old lenses of αAN101D-mice showed an increased protein in the void volume peak (representing WS-HMW proteins), and reduced β- and γ-crystallin peaks relative to lenses of CRYαAWT-mice (the differences shown in green in Fig. 2a). The void volume peak in WS-protein fraction was also higher in the 7-month old lenses relative to 1-month old lenses of αAN101D-mice (Results not shown), suggesting a relatively increased HMW protein aggregate formation with aging. On western blot analysis of the individual column fractions nos. 6 to 9 (constituting the void volume-HMW-protein peak) with an anti-His antibody, the levels of His-immunoreactive protein were higher in 7-month old CRYαAN101D lenses compared to the identical aged CRYαAWT lenses (Fig. 2b). Additionally, because the immunoreactive peak in the WT lenses was in the fractions no. 8 and 9 whereas it was in the fractions no. 7 and 8 in the αAN101D lenses that suggested that the HMW proteins of αAN101D lenses showed a higher molecular weights relative to the HMW proteins from WT lenses. On quantification of Western blot images with Image J (Fig. 2c), the intensity of the immunoreactive HMW proteins of αAN101D was about 20% greater relative to WT lenses. Together, the results suggested a greater aggregation with higher Mr of the HMW-proteins in CRYαAN101D lenses compared to the identical aged CRYαAWT lenses.
Fig. 1

SDS-PAGE analysis of WS- and WI-proteins from lenses of CRYαAWT- and CRYαAN101D mice at different ages. a. Coomassie blue stained gel of WS protein from both WT and Transgenic mice at different ages as indicated at the bottom of the gel (months). And the numbers 1–5 at the top of the gel indicate lanes. b Coomassie blue stained gel of WI protein from both WT and Transgenic mice at different ages as indicated at the bottom of the gel (months).). Note that a greater insolubilization and aggregated proteins (Mr > 30 kDa) were seen in WI-proteins of lenses of 4-month and older CRYαAN101Dmice compared to age-matched lenses from CRYαAWT mice. The Table 1. shows quantification of protein levels in the WS- and WI-protein fractions of lenses of different ages from CRYαAN101D and CRYαAWT mice. Gel images are not cropped

Table 1

Age-related changes in Protein distribution in water soluble and water insoluble fractions in lenses of WT and αA-N101D mice

Age (Months)CRYαAWT (mg)CRYαAN101D (mg)Percent Insoluble of total Protein
WSWIWSWIαAWTαAN101D
10.960.1081.070.5710.134.7
31.81.141.160.6838.736.9
41.431.271.472.047.0354.05
51.691.151.52.240.559.4
71.741.91.742.252.155.8
Fig. 2

Size-exclusion HPLC (using a G-4000PWXL column) and SDS-PAGE analysis of WS-HMW proteins eluted in the void volume. a HPLC-protein elution profiles at 280 nm of WS-proteins from lenses of 5-month-old CRYαAN101D - and CRYαAWT mice. The green region shows the difference in the A280 profiles of WS-proteins from the two type of lenses. b Western blot analysis of the void volume peaks (constituted by the fraction no. 6 to 9 in [A]) following HPLC separation of WS-proteins from lenses of CRYαAN101D - and CRYαAWT mice. Note that in the CRYαAWT lenses, the αA-immunoreactive bands were in fractions no. 8 and 9 whereas it were in fraction no. 7 and 8 in CRYαAN101D lenses, suggesting a higher Mr of HMW proteins in the latter. c Quantification of the Western Blot using Image J. Gel images are not cropped

SDS-PAGE analysis of WS- and WI-proteins from lenses of CRYαAWT- and CRYαAN101D mice at different ages. a. Coomassie blue stained gel of WS protein from both WT and Transgenic mice at different ages as indicated at the bottom of the gel (months). And the numbers 1–5 at the top of the gel indicate lanes. b Coomassie blue stained gel of WI protein from both WT and Transgenic mice at different ages as indicated at the bottom of the gel (months).). Note that a greater insolubilization and aggregated proteins (Mr > 30 kDa) were seen in WI-proteins of lenses of 4-month and older CRYαAN101Dmice compared to age-matched lenses from CRYαAWT mice. The Table 1. shows quantification of protein levels in the WS- and WI-protein fractions of lenses of different ages from CRYαAN101D and CRYαAWT mice. Gel images are not cropped Age-related changes in Protein distribution in water soluble and water insoluble fractions in lenses of WT and αA-N101D mice Size-exclusion HPLC (using a G-4000PWXL column) and SDS-PAGE analysis of WS-HMW proteins eluted in the void volume. a HPLC-protein elution profiles at 280 nm of WS-proteins from lenses of 5-month-old CRYαAN101D - and CRYαAWT mice. The green region shows the difference in the A280 profiles of WS-proteins from the two type of lenses. b Western blot analysis of the void volume peaks (constituted by the fraction no. 6 to 9 in [A]) following HPLC separation of WS-proteins from lenses of CRYαAN101D - and CRYαAWT mice. Note that in the CRYαAWT lenses, the αA-immunoreactive bands were in fractions no. 8 and 9 whereas it were in fraction no. 7 and 8 in CRYαAN101D lenses, suggesting a higher Mr of HMW proteins in the latter. c Quantification of the Western Blot using Image J. Gel images are not cropped

Identification proteins present in water insoluble-urea soluble (WI-US) - and water insoluble urea insoluble (WI-UI) protein fractions of lenses of CRYαAWT and CRYαAN101D mice

To Identify the insolubilized proteins in WTαA vs. αAN101D lenses, the WI-proteins from 5-month-old mice were further fractionated into WI-US- and WI-UI-protein fractions, and examined by SDS-PAGE (Fig. 3) followed by their protein compositional analysis by mass spectrometry. SDS-PAGE analysis showed that both WI-US- and WI-UI-protein fractions from CRYαAN101D lenses contained greater levels of protein species including aggregated proteins (Mr > 30 kDa) [Identified as a, and c in Fig. 3] relative to the same fractions from lenses of CRYαAWT mice (Identified as b and d in Fig. 3). The mass spectrometric analysis was carried out at the following two levels: (i) In the first level analysis, determination of the total protein compositions in the WI-US- and WI-UI protein fractions of the two types of lenses (Supplemental Tables A [Comparative protein compositions of WI-US-fractions of CRYαAN101D and WTαA lenses], and Supplemental Table B [Comparative protein compositions of WI-UI-fractions of αAN101D and WTαA lenses]). (ii) In the second level analysis, the protein compositions of protein aggregates (Mr > 30 kDa) in WI-US-fraction of αAN101D lenses (Identified as ‘a’ in Fig. 3), and WI-US-protein fraction of WTαA lenses (Identified as ‘b’ in Fig. 3) [Supplemental Table C]. Similarly, the compositions of protein aggregates (Mr > 30 kDa) in WI-UI-fraction of αAN101D lenses (Identified as ‘c’ in Fig. 3,), and WI-US-fraction of WTαA lenses (Identified as ‘d’ in Fig. 3) were determined [Supplemental Table D]. The rationale of the two levels of analysis was to determine the relative proteins compositions due to the greater insolublization of proteins in CRYαAN101D lenses relative to CRYAAWT lenses (Fig. 1, Table 1). Our expectation was that the level 1 comparative examination would identify the total proteins that underwent insolubilization, and existed in the US- and UI-protein fractions, whereas the level 2 analysis would selectively identify those proteins that formed aggregates (Mr > 30 kDa) in the US- and UI-fractions. The rationale was that the information would implicate potential roles of specific crystallins in the aggregation and therefore, in the cataractogenic mechanism.
Fig. 3

SDS-PAGE analysis of WI-US- and WI-UI-protein fractions of 5-month-old lenses from CRYαAN101D and CRYαAWT mice. To normalize the protein analyses, the protein fractions were isolated under identical conditions and with identical buffer volumes. Equal volumes of protein fractions from lenses of two types of mice were used during the analysis. The four fractions numbers as 1 to 4 (containing total proteins in WI-US- and WI-UI-fractions) and four fractions numbered as a to d (containing aggregated proteins with Mr. > 30 kDa) were analyzed by mass-spectrometric methods, and the results are shown in Supplementary Tables A, B, C and D. Gel images are not cropped

Comparative Protein Compositions in WI-US Fractions of Lenses from CRYαA and CRYαA Mice SDS-PAGE analysis of WI-US- and WI-UI-protein fractions of 5-month-old lenses from CRYαAN101D and CRYαAWT mice. To normalize the protein analyses, the protein fractions were isolated under identical conditions and with identical buffer volumes. Equal volumes of protein fractions from lenses of two types of mice were used during the analysis. The four fractions numbers as 1 to 4 (containing total proteins in WI-US- and WI-UI-fractions) and four fractions numbered as a to d (containing aggregated proteins with Mr. > 30 kDa) were analyzed by mass-spectrometric methods, and the results are shown in Supplementary Tables A, B, C and D. Gel images are not cropped The proteins detected in the WI-US-protein fractions of CRYαAN101D lenses but were absent in the WT lenses are described in Supplemental Table A. Together, the results show that the WI-US fraction of CRYαAN101D lenses was enriched in several histones, which could be due to the lack of denucleation relative to WT lenses. Absence of Retinal dehydrogenase in transgenic lens fraction. Comparative Protein Compositions of WI-UI-Fractions of Lenses from CRYαA and CRYαA Mice The proteins present in the WI-UI-protein fractions of CRYαAN101D lenses but were absent in WT lenses are described in Supplemental Table B. In summary, the results again show that the majority of histones that existed in CRYαAN101D lenses were absent in the WT lenses, which could be due to the lack of denucleation in the lenses of former mice. Also, specifically αB- and βB2-crystallin became insoluble as their levels were higher even in the WI-UI-fraction of lenses of CRYαAN101D relative to WT lenses. Compositions of Aggregated Proteins (M > 30 kDa) in WI-US- and WI-UI-Fractions of Lenses from CRYαA and CRYαA Mice As noted above, the purpose of the second level of mass spectrometric analysis was to elucidate the comparative compositions of aggregated proteins (Mr > 30 kDa) in WI-US- and WI-UI-protein fractions of CRYαAN101D and CRYαAWT lenses [Supplemental Tables C and D]. On comparison, the major proteins present as aggregates (Mr > 30 kDa) in WI-US fraction of CRYαAN101D but absent in CRYαAWT were (Supplemental Table C): βB3- and γC-crystallins, collagen alpha-1(IV) chain and -alpha-2(IV) chain and nestin. In contrast, the exclusively present major proteins in WI-US fraction of CRYαAWT were: γC-, γD-, γE- γF-crystallins. The above list describes the selective proteins that were water insoluble-urea soluble and became the part of the complexes with Mr > 30 kDa in CRYαAN101D lenses. The greater abundance of αA-, and βB1-crystallins in the aggregated form suggested their potential involvement in the aggregation process along with βB3- and γC-crystallins. On comparison of major proteins that existed in WI-UI protein fraction as > 30 kDa aggregates in CRYαAN101D not in the CRYαAWT included [Supplemental Table D]: γB-, γD- and γE-crystallins, and nestin. In the WI-UI fraction, the greater abundance of proteins in CRYαAN101D compared to CRYαAWT were: αA-crystallin and lens fiber intrinsic proteins. Together, the results showed that the proteins that remained urea insoluble and were possibly associated with the membrane of CRYαAN101D lenses included: γB-, γD- and γE-crystallins, and nestin (Nestin is an intermediate filament protein).

Increased association of αAN101D with Lens membrane in the outer cortical Fiber cells relative WTαA in CRYYAAWT lenses

Our previous report [28] showed an increased levels and abnormal deposition of αAN101D within the outer cortical region in CRYαAN101D lenses compared CRYαAWT lenses. This suggested a relatively greater membrane binding of αAN101D, which was further investigated in experiments as described below. Immunohistochemical Analyses of Lenses from CRYαA and CRYαA Mice The purpose of the experiments was to determine relative levels of αAN101D and WTαA in the outer cortical regions of CRYαAN101D- vs. CRYαAWT lenses. This was examined by immunohistochemical analysis of 5-months old lenses of the two types of mice using anti-His monoclonal (for detection of WTαA and αAN101D [green fluorescence]) - and polyclonal anti-aquaporin 0 (for membrane detection [red fluorescence])-antibodies (Fig. 4). The axial sections (at 10X magnification) showed an irregular and greater deposition of His-tagged αA (Green) in the lens outer cortex of CRYαAN101D mice (Shown by an arrow in Fig. 4a) relative to CRYαAWT mice (Shown by an arrow in Fig. 4b). Similarly, the equatorial sections (at 40X magnification) also exhibited a greater immunoreactive green fluorescence in the outer cortex of the CRYαAN101D lens relative to the CRYαAWT lens (shown by arrows in Fig. 4c and d). Together, the results suggested the abnormally greater levels of association of αAN101D in the outer cortical regions, and potentially with the fiber cell membranes in the CRYαAN101D lenses relative to those of CRYαAWT lenses.
Fig. 4

a Confocal-immunohistochemical analysis of 5-month old lenses from CRYαAN101D and CRYαAWT mice by using anti-His monoclonal (green, for αA detection)- and polyclonal anti-aquaporin 0 (red, for membrane detection)-antibodies. a and b: The axial sections at 10X magnification showed an irregular deposition of His-tagged αA (Green) in the lens outer cortex of CRYαAN101D mice (in B, shown by an arrow) relative to CRYαAWT mice (in A, shown by an arrow). The equatorial sections (at 40X magnification) show a greater deposit of green fluorescence in the outer cortex of CRYαAN101D lens relative to CRYαAWT (shown by arrows in c and d)

Relative Membrane-Association of WTαA- and αA in Lenses of CRYαA and CRYαA Mice a Confocal-immunohistochemical analysis of 5-month old lenses from CRYαAN101D and CRYαAWT mice by using anti-His monoclonal (green, for αA detection)- and polyclonal anti-aquaporin 0 (red, for membrane detection)-antibodies. a and b: The axial sections at 10X magnification showed an irregular deposition of His-tagged αA (Green) in the lens outer cortex of CRYαAN101D mice (in B, shown by an arrow) relative to CRYαAWT mice (in A, shown by an arrow). The equatorial sections (at 40X magnification) show a greater deposit of green fluorescence in the outer cortex of CRYαAN101D lens relative to CRYαAWT (shown by arrows in c and d) The rationale for the next experiment was that if the greater membrane-association of αA-N101D occurs in vivo in CRYαAN101D lenses compared to CRYαAWT lenses, the difference in their levels could also be determined in the purified membrane fractions by western blot analysis. The expectation was that following the step-wise membrane purification by using 8 M urea (to dissociate non-covalently-bound membrane proteins), and by the final wash with 0.1 N NaOH (to remove non-membranous extrinsic proteins) [30, 31], the purified membrane would show relative levels of membrane-association of αAN101D vs. WTαA in the two types of mice. To normalize the levels of the relative association during the membrane preparations, two lenses of 1-month-old and two lenses from 6-month old from CRYαAN101D and CRYαAWT mice were identically processed, using identical volumes of buffers at each steps during membrane purification (See Methods). Next, Western blot analysis using anti-His- and anti-aquaporin 0-antibodies were used to determine the relative levels of membrane-association of WTαA and αAN101D at different purification steps (Results not shown). To simplify the western blot results of fractions recovered during the sequential steps of membrane purification, only the results of immunoblots with anti-His antibody but not with anti-aquaporin-0 are shown in Fig. 5. However, the western blot profiles with anti-aquaporin-0 were almost identical to anti-His antibody results. In Fig. 5, a, b, e and f show SDS-PAGE analysis followed by Coomassie blue-stained gels exhibiting relative levels of protein bands in preparations at different membrane purification steps in lenses at two different age groups (1 and 6 months). In Fig. 5, c and d (1-month old lenses) and G and H (6-months old lenses) corresponded to samples of A, B, E and F (Coomassie blue-stained gels), and show the Western blot results with anti-His antibody (green fluorescence) in the two different age groups (1 and 6 months). The levels of green fluorescence with His-tagged αA in lenses of 1-month old lenses (Fig. 5, left panel: WTαA [C] and αAN101D [D]) and 6-month old lenses (Fig. 5, right panel: WTαA [G] and αAN101D [G]) are shown. Additionally, in both left and right upper panels, the lanes 1, 2 and 3 show the WS-protein fractions recovered after first, second and third consecutive washes in buffer A to solubilize WS-proteins, respectively. Lanes 4 and 5 represent the urea soluble-protein fractions recovered during two consecutive washes of WI-protein pellet (containing membranes) with buffer B containing 8 M urea, respectively. Lane 6 represents the 0.1 N NaOH-solubilized proteins from membranes and the lane 7 from both 1- and 6-month old lenses (left and right panels) show the purified lens membrane preparations. Similarly, lanes 7 and 8 from 6-month old lenses (right panel) represent purified membrane preparation. Lane 9 of 6-month old lenses represents the crude lens WS-homogenate. The results show that the green fluorescence representing WTαA in CRYαAWT mice was entirely disappeared on urea solubilization in 1- and 6-month old lenses (lanes 1 to 5 in both left and right panels), whereas it was still present in these lenses until 0.1 N NaOH wash (lane 6 in left and right panels). In contrast, the green fluorescence still existed in lane 6 of membranes from 1- and 6-month-old CRYαAN101D lenses. Together, the results suggest that αAN101D was tightly bound and at the higher levels to lens membrane of CRYαAN101D lenses relative to CRYαAWT lenses.
Fig. 5

Relative Membrane-Association of WTαA- and αAN in Lenses of CRYαAN101D and CRYαAWT Mice. a, b, e and f: the relative levels of association of WTαA and αAN101D with the purified membrane preparations at different membrane purification steps analyzed using SDS-PAGE analysis at two different age groups (1 and 6 months) (c, d, g and h): Similarly the samples were analyzed by Western blot using anti-His antibody at two different age groups (1and 6 months). Additionally, in both left and right panels, the lanes 1, 2 and 3 show the WS-protein fractions recovered after 1st, 2nd and 3rd consecutive washes in buffer B to solubilize WS-proteins, respectively. Lanes 4 and 5 represent the urea soluble-protein fractions recovered during two consecutive washes of WI-protein pellet with buffer B containing 8 M urea, similarly, lanes 7 and 8 from 6-month old lenses (E and F) represent purified membrane preparation. Lane 9 of 6-month old lenses represents crude WS-homogenate. i & j: Quantification of immunoreactive bands of αA- recovered in urea-soluble fractions (Lane 4 [L4] and lane 5 [L5] represent two consecutive urea wash of WI proteins during membrane isolation from lenses of CRYαAWT and CRYαAN101Dmice as shown in Western blot analysis in Fig. 5. i Relative levels of immunoreactive WTαA lenses (blue) and αA-N101D αA- (red) during membrane purification from 1-month old lenses. j Relative levels of immunoreactive WTαA lenses (blue) and αAN101D αA- (red) during membrane purification from 6-months old lenses. Note that relatively higher levels of αAN101D than WTαA was associated with purified membranes in lanes 4 (in 1-month old) and lane 5 (in both 1- and 6- month-old) of the two types of lenses. Gel images are not cropped

Relative Membrane-Association of WTαA- and αAN in Lenses of CRYαAN101D and CRYαAWT Mice. a, b, e and f: the relative levels of association of WTαA and αAN101D with the purified membrane preparations at different membrane purification steps analyzed using SDS-PAGE analysis at two different age groups (1 and 6 months) (c, d, g and h): Similarly the samples were analyzed by Western blot using anti-His antibody at two different age groups (1and 6 months). Additionally, in both left and right panels, the lanes 1, 2 and 3 show the WS-protein fractions recovered after 1st, 2nd and 3rd consecutive washes in buffer B to solubilize WS-proteins, respectively. Lanes 4 and 5 represent the urea soluble-protein fractions recovered during two consecutive washes of WI-protein pellet with buffer B containing 8 M urea, similarly, lanes 7 and 8 from 6-month old lenses (E and F) represent purified membrane preparation. Lane 9 of 6-month old lenses represents crude WS-homogenate. i & j: Quantification of immunoreactive bands of αA- recovered in urea-soluble fractions (Lane 4 [L4] and lane 5 [L5] represent two consecutive urea wash of WI proteins during membrane isolation from lenses of CRYαAWT and CRYαAN101Dmice as shown in Western blot analysis in Fig. 5. i Relative levels of immunoreactive WTαA lenses (blue) and αA-N101D αA- (red) during membrane purification from 1-month old lenses. j Relative levels of immunoreactive WTαA lenses (blue) and αAN101D αA- (red) during membrane purification from 6-months old lenses. Note that relatively higher levels of αAN101D than WTαA was associated with purified membranes in lanes 4 (in 1-month old) and lane 5 (in both 1- and 6- month-old) of the two types of lenses. Gel images are not cropped On Image J-quantification of the Western blots (Fig. 5 i and j), the lanes 4 and 5 (urea soluble fractions) of 1-month old lenses showed higher levels (2.5X) of immunoreactivity with anti-His antibody in the CRYαAN101D lenses (shown in red) compared to those from CRYαAWT lenses (blue). Similarly in Fig. 5j, among the lanes 4 and 5 containing same fractions from 6-month old lenses (as described in 1-month old lenses), the lane 5 showed a greater immunoreactive level of CRYαAN101D lenses (red) compared to CRYαAWT lenses (blue). Additionally, the lane 6 (representing membrane remaining after two urea washes, right panel) of 6-month CRYαAN101D lenses exhibited about 2X greater immunoreactivity than CRYαAWT lenses (Quantification results not shown). Together, the results show that relative to CRYαAWT, higher levels of CRYαAN101D were tightly associated with the lens membranes of 1- and 6- month old CRYαAN101D mice. Relative Membrane-Binding of Alexa 350-Labeled Recombinant WTαA- and αA- Crystallins To examine whether αAN101D show a greater binding affinity to the lens membrane relative to WTαA-crystallin, the binding of the two recombinant proteins to purified lens membrane was determined. The recombinant WTαA- and αAN101D proteins were labeled with Alexa 350 using a protein labeling kit by the procedure described by the manufacturer (Molecular Probes, Thermo fisher Scientific). The two labeled-proteins were purified by a size-exclusion HPLC column and were analyzed by SDS-PAGE. Figure 6a shows the Coomassie blue-stained WT αA (lane 1), αAN101D protein (lane 2), and the purified lens membrane from non-transgenic C57 mice (lane 3). The Fig. 6b shows the images of the two Alexa 350-labeled proteins under a UV trans-illuminator [Lane 1: Images of Alexa 350-labeled WTαA, and lane 2: Alexa 350-labeled αAN101D). During the binding assay, the purified lens membrane (containing 2.5 mg protein; isolated from 1 to 3-month old non-transgenic C57BL mice) was incubated with increasing but identical concentrations of either Alexa-labelled WT αA- or αAN101D proteins at 37οC for 6 h (See details in Methods). A relatively higher levels (> 1.5X) of binding of αAN101D protein relative to WTαA protein with membrane preparation was observed (Fig. 6c). The values reported are the average of triplicate assays.
Fig. 6

Relative in vitro binding of recombinant αAN101D and WTαA proteins to lens membrane. a The recombinant WT αA- and αA-N101D proteins were labeled with Alexa 350, purified by a size-exclusion HPLC column and analyzed by SDS-PAGE. Lane 1: Coomassie blue-stained WTαA, lane 2: αAN101D mutant protein, and lane 3: purified lens membrane from non-transgenic C57 mice. b Images of labeled αAN101D and WTαA proteins. Lane 1: Alexa 350-labeled WT αA, and lane 2: αAN101D protein. c Binding of a WT αA, and αAN101D with purified lens membrane (2.5 mg protein; isolated from 1- to 3-month old non-transgenic C57 mice). During the binding assay, the protein mixtures were incubated with increasing but identical concentrations of either Alexa-labelled WTαA- or αA-N101D at 37οC for 6 h, centrifuged at 14,000Xg and the supernatant and pellet (membrane fraction) recovered. After washing the membrane fraction with water and centrifugation as above, the relative fluorescence of membranes incubated with WT αA- and αA-N101D mutant proteins was determined. The values reported are the average of triplicate assays

Immunogold-Labeling for Relative Localization of αA-WT and αAN101D in Lens Membranes of CRYαA and CRYαA Mice Relative in vitro binding of recombinant αAN101D and WTαA proteins to lens membrane. a The recombinant WT αA- and αA-N101D proteins were labeled with Alexa 350, purified by a size-exclusion HPLC column and analyzed by SDS-PAGE. Lane 1: Coomassie blue-stained WTαA, lane 2: αAN101D mutant protein, and lane 3: purified lens membrane from non-transgenic C57 mice. b Images of labeled αAN101D and WTαA proteins. Lane 1: Alexa 350-labeled WT αA, and lane 2: αAN101D protein. c Binding of a WT αA, and αAN101D with purified lens membrane (2.5 mg protein; isolated from 1- to 3-month old non-transgenic C57 mice). During the binding assay, the protein mixtures were incubated with increasing but identical concentrations of either Alexa-labelled WTαA- or αA-N101D at 37οC for 6 h, centrifuged at 14,000Xg and the supernatant and pellet (membrane fraction) recovered. After washing the membrane fraction with water and centrifugation as above, the relative fluorescence of membranes incubated with WT αA- and αA-N101D mutant proteins was determined. The values reported are the average of triplicate assays To ascertain the relative levels association αAN101D vs. WTαA to the lens membrane in vivo, the immunogold-labeling experiment was carried out (See details in Methods). (A) and (B) in Fig. 7 show lens membranes from CRYαAN101D and CRYαAWT mice at 500 nm magnification, and (C) and (D) from these lenses at 100 nm magnification, respectively. The bigger gold particles (25 nm, red arrows) the smaller gold particles (10 nm, yellow arrows) represented the aquaporin-0 and the His-tagged αAN101D and WTαA, respectively. As shown in the representative images in (A) to (D), the 25 nm gold particles (representing aquaporin-0, identified by red arrows) were bound to membranes. On counting the membrane-associated 10 nm particles (representing His-tagged αAN101D and WTαA), almost the same numbers of the particle were found to be associated with membranes of both CRYαAN101D and CRYαAWT lenses, suggesting that the His-tagged αAN101D and WTαA were bound to the membranes of the two types of lenses. Our previous study [28] showed that αAN101D protein constituted about 14 and 14.2% of the total αA- crystallin in the WS- and WI-proteins, respectively in the lenses of CRYαAN101D mice. Therefore, an argument can be made that although an almost equal number of 10 nm and 25 nm particles were associated with membranes of the two type of lenses, a higher number of gold particle representing αAN101D relative to WTαA were associated with the membrane.
Fig. 7

Immunogold-labeling to determine relative localization of αA-WT and αAN101D in lens membranes of CRYαAN101D and CRYαAWT mice. a and c show membranes of lenses from CRYαAN101D (at 500 nm and 100 nm magnification respectively) and (b) and (d) from CRYαAWT (at 500 nm and 100 nm magnification respectively). The bigger particles (25 nm, red arrows) represented the aquaporin 0 whereas the smaller gold particles (10 nm, yellow arrows) represented the His-tagged αAN101D and WTαA-. As shown in the representative images in (a) to (d), both 10 nm and the 25 nm gold particles were bound to membranes.e: Quantification of width of membranes from lenses of CRYαAN101D and CRYαAWT mice. Note that the lens membranes of CRYαAN101D mice were about 2X wider that those from CRYαAN101D mice, suggesting membrane swelling of the former lenses

Immunogold-labeling to determine relative localization of αA-WT and αAN101D in lens membranes of CRYαAN101D and CRYαAWT mice. a and c show membranes of lenses from CRYαAN101D (at 500 nm and 100 nm magnification respectively) and (b) and (d) from CRYαAWT (at 500 nm and 100 nm magnification respectively). The bigger particles (25 nm, red arrows) represented the aquaporin 0 whereas the smaller gold particles (10 nm, yellow arrows) represented the His-tagged αAN101D and WTαA-. As shown in the representative images in (a) to (d), both 10 nm and the 25 nm gold particles were bound to membranes.e: Quantification of width of membranes from lenses of CRYαAN101D and CRYαAWT mice. Note that the lens membranes of CRYαAN101D mice were about 2X wider that those from CRYαAN101D mice, suggesting membrane swelling of the former lenses Another interesting observation was that the membranes of CRYαAN101D lenses were about 2X more swollen relative to those of CRYαAWT lenses [Fig. 7, compare (A) to (B) and (C) to (D)]. The width of the membrane was quantified using Image J as shown in Fig. 7e. The swelling could represent water intake within the lens cells due to the potential ionic imbalance in the CRYαAN101D lenses compared to CRYαAWT lenses. Such a possibility of ionic imbalance was further determined as described below.

Na, K-ATPase and Ca2+ levels in cultured epithelial cells from lenses of CRYαAN101D and CRYαAWT mice

Sodium-potassium-adenosine triphosphatase (Na, K-ATPase) has been recognized for its role in regulating electrolyte concentrations in the lens, and the electrolyte balance is vital to lens transparency [35, 36]. In addition, calcium has been reported to control both sodium and potassium permeability through lens membranes [37]. In our previous study [29], we showed that the expression of Na,K-ATPase at the protein level was drastically reduced in CRYαAN101D lenses relative to CRYαAWT lenses. Next, the levels of Na, K-ATPase mRNA, and Ca2+ levels were determined in cultured epithelial cells from lenses of CRYαAN101D and CRYαAWT mice. Both (A) and (B) in Fig. 8 show intracellular Ca2+ levels in the presence of calcium orange in cultured epithelial cells from CRYαAN101D and CRYαAWT, respectively. Only a few CRYαAN101D epithelial cells showed the Ca2+ uptake, which was possibly due to our previous finding that the lens cells contained only about 14% of αAN101D mutant protein [28]. In this experiment, 100 cells from the cultures of two types of lenses were counted. On quantification by Image J, the number of cells exhibiting calcium orange uptake were 1.5X greater in cells of CRYαAN101D lenses relative to cells from CRYαAWT lenses (Fig. 8b). On the determination of levels of mRNA of Na, K-ATPase in these cells, its level was 75% lower in the CRYαAN101D lens cells than CRYαAWT lens cells (Fig. 8c).
Fig. 8

Determination of levels of intracellular Ca2+ and Na, K-ATPase mRNA in cultured epithelial cells from lenses of CRYαAN101D and CRYαAWT mice. a Left and right panels show intracellular Ca2+ staining following uptake from calcium orange in cells from CRYαAWT- and CRYαAN101D mice, respectively. b Quantification by Image J of the number of cells that showed positive intracellular Ca2+-staining following uptake from calcium orange in CRYαAWT - and CRYαAN101D cells. c Relative levels of Na, K-ATPase mRNA in epithelial cells from CRYαAWT- and CRYαAN101D mice as determined by the QRT-PCR method

Determination of levels of intracellular Ca2+ and Na, K-ATPase mRNA in cultured epithelial cells from lenses of CRYαAN101D and CRYαAWT mice. a Left and right panels show intracellular Ca2+ staining following uptake from calcium orange in cells from CRYαAWT- and CRYαAN101D mice, respectively. b Quantification by Image J of the number of cells that showed positive intracellular Ca2+-staining following uptake from calcium orange in CRYαAWT - and CRYαAN101D cells. c Relative levels of Na, K-ATPase mRNA in epithelial cells from CRYαAWT- and CRYαAN101D mice as determined by the QRT-PCR method

Discussion

Several past studies have shown in vitro effects of deamidation of crystallins on their structural properties including those in αA-, and αB-crystallins [21-25]. It has been reported that deamidation of Asn and Gln was the major modification identified in several human cataractous and aged lenses and these totaled 66% of the modification in the water-soluble and water-insoluble protein fractions that was analyzed by 2D LC/MS [23]. The mass spectrometric analysis found that there is negligible (less than 1%) deamidation at αAN101 site in both aged and cataractous human lenses [38]. These studies suggested that because of low levels of deamidation of αA- at N101 to D in normal and cataractous lenses, the αAN101D might not play a significant role in cataract development. However, additional studies suggest otherwise. For example, our in vitro studies showed significant altered structural and functional properties of αA-crystallin on deamidation of N101 residue but not of N123 residue [24]. We also showed that the WS-protein fraction from 50 to 70 year-old human donors contained αA- fragments with deamidation of N101 to D [39]. This finding is significant because recent studies have also shown an increasing role of crystallin fragments in cataract development [40, 41]. In the present study, the cortical cataract development in mice on the introduction of αA-N101D transgene further show significance of deamidation of this site and altered changes in the lens. However, the exact in vivo molecular mechanism of αAN101D-induced crystallin’s aggregation is yet to be fully understood. Previously we showed that the three recombinant deamidated αA-mutants (N101D, N123D, and N101D/N123D) exhibited reduced levels of chaperone activity, alterations in secondary and tertiary structures, and larger aggregates relative to WT-αA-crystallin [24, 25]. Among the above three mutants, the maximally affected and altered properties were observed in the recombinant αAN101D mutant [25]. Additionally, our recent results show that in vitro, the deamidated αA-, and αB-crystallins facilitated greater interaction with βA3-crystallin, leading to the formation of larger aggregates, which might contribute to the lens cataractogenic mechanism [42]. As a further extension of our previous studies [28, 29], in some studies the 7-month old lenses were chosen because of the development of cortical cataract at about 7-month of age in the αA-N101D mice relative to αAwt mice. In other experiments, lenses from 5-month old of both types of mice were used to determine the progression of phenotypic changes in lenses to determine their significance in cataractogenic mechanism. The present study show that the introduction of αAN101D trans-gene in a mouse model resulted in the following major in vivo effects in lenses of CRYαAN101D- relative to CRYαAWT mice: (A) An age-related difference in protein profiles with an increasing association αAN101D with WI-protein fraction suggesting its insolubilization after 4-months of age. (B) The WS-HMW protein fraction showed a higher level of proteins with a greater Mr. (C) Mass spectrometric analysis showed preferential insolubilization of αA-, αB-, γD- and γE-crystallins, and nestin, which remained insoluble even in 8 M urea. (D) The tight association of αAN101D with membranes relative to WTαA, which could not be fully dissociated with 8 M urea treatment. (E) In vitro, αAN101 a showed greater affinity and binding to lens membranes relative WTαA. (F) The greater number of immunogold-labeled αAN101 relative WTαA binding to membrane along with relatively greater swelling of lens membranes, suggesting the potential water uptake due to intracellular ionic imbalance, and (G) The ionic imbalance was suggested by the greater Ca2+ uptake and 75% reduction in mRNA levels of Na, K-ATPase in the epithelial cells cultured from CRYαAN101D lenses relative to those from CRYαAWT lenses. Our mass spectrometry analysis showed that retinal dehydrogenase was absent in the N101D mice. It has been shown earlier that Aldh1a1(−/−) knock-out mice developed lens opacification later in life [43]. Retinal dehydrogenase 1 may protect the lens against cataract formation by detoxifying aldehyde products on lipid peroxidation in both cornea and lens. It has been shown that antimalarial drug chloroquine which binds and inhibit retinal dehydrogenase 1 [44] induce cataract in rats [45]. Together, these findings suggest altered membrane integrity (possibly due to greater levels of αAN1010D binding to membrane than WTαA) resulting in intracellular ionic imbalance in CRYαAN101D lenses, which could play a major role in the cortical cataract development. Among the lens crystallins, only α-crystallin show an association with the membrane in both normal and cataractous lenses [6, 46–50]. Lens membranes contain both a high-affinity saturable and low-affinity non-saturable α-crystallin-binding sites [46, 50–52]. Alpha-crystallin binding to native membranes was enhanced on stripping of extrinsic proteins from the lens membrane surface to expose lipid moieties [32, 33], which contradicted a previous report that the crystallin mostly interacts with lens membrane MP26 protein [53]. Even after stripping extrinsic membrane proteins by alkali-urea treatment, the full-length αA-, and αB-crystallins remained associated with membranes of both bovine and human lenses [6]. Additionally, αB-crystallin showed three-fold higher binding to lens membrane relative to αA-crystallin, and their binding was affected by the residual membrane-associated proteins, suggesting that their binding behaviors were affected by an intrinsic lens peptides [6]. A large-scale association of proteins with cell membranes in the lens nucleus (mostly in the barrier region) occurs after middle age in human lenses [48], and such association was enhanced by mild thermal stress [49]. The in vitro studies further supported this because the binding capacity of α-crystallin from older lenses to lipids increased with age and decreased in diabetic donors who were treated with insulin [50]. This implied that under diabetic conditions, abnormal binding of α-crystallin to lens membrane occurred. Such information in the literature about membrane binding of native vs. post-translationally modified crystallins including the deamidated αAN101D species is presently lacking. Therefore, the results of the present study showing relatively increased binding of αAN101D relative to WTαA are highly significant. The RNA sequence and IPA data of our previous study [29] further support the findings of the present study. This study [29] showed that the genes belonging to gene expression, cellular assembly, and organization, and cell cycle and apoptosis networks were altered, and specifically, the tight junction-signaling and Rho A signaling were among the top three canonical pathways that were affected in the CRYαAN101D lenses relative to CRYαAWT lenses. The present study showed an increased association of αAN101D to membrane, and this could lead to potential ionic imbalance affecting tight junction assembly and RhoA GTPase expression. This in turn causes increased proliferation and decreased of differentiation and denucleation of epithelial cells, and an accumulation of nuclei and nuclear debris in the lens anterior inner cortex and fiber cell degeneration. Some of these phenotypic changes could be cause or effects, but together could be responsible for the age-related cortical cataract development in CRYαAN101D lenses. To maintain ionic balance within lens cells, a permeability barrier close to the surface of the lens is responsible for the continuous sodium extrusion via Na, K-ATPase-mediated active transport [35-37]. Without an active sodium extrusion, lens sodium and calcium contents are shown to increase resulting in lens swelling that leads to loss of lens transparency [35]. Similarly, an excessive intracellular Ca2+ levels can be detrimental to lens cells, and its increased levels play an important role in development of cortical cataract [37]. Therefore, homeostasis of Na+, K+, Ca2+ and other ions within the lens has been recognized as of fundamental importance in lens pathophysiology. These have been altered as shown in our present and our previous studies [29]. It is also possible that the increased Ca2+ levels could in turn lead to calpain activation and proteolysis of crystallins, which will be investigated in future. Similar to our study, other studies have shown that an increased membrane binding of α- crystallin in the pathogenesis of different forms of cataracts. The high molecular weight complexes (HMWCs), comprised of α-crystallin and other crystallins, accumulate with aging and show a greater membrane binding capacity than native α-crystallin [50]. Other mutants of αA-crystallin, like the αAN101D mutant, also exhibit a greater membrane binding than corresponding wild-type species [54]. For example, in the αAR116C-associated congenital cataracts, an increased membrane binding capacity along with changes in complex polydispersity, and the reduction of subunit exchange were considered potential factors in the cataract pathogenesis [54]. Similarly, αA-crystallin R49C neo mutation influenced the architecture of lens fiber cell membranes and caused posterior and nuclear cataracts in mice [55]. Interactions between proteins and the cell membrane are an integral aspect of many biological processes, which are influenced by compositions of both membrane lipids and protein structure [56]. Reports have shown the age-related lipid compositional changes in the lens membrane, which might affect α-crystallin binding, i.e., in the nucleus of the human lenses, the levels of glycerophospholipids declined steadily by age 40 as opposed to the levels of ceramides and dihydroceramides increased approximately 100 fold during middle-age [57, 58]. Further, it has been shown that because of the elevation of sphingolipid levels with species, age, and cataract, lipid hydrocarbon chain order, or stiffness increased. Therefore, the increased membrane stiffness caused an increase in light-scattering, reduced calcium pump activity, altered protein-lipid interactions, and perhaps slow fiber cell elongation [60]. Presently, whether similar changes occur in αAN101D lenses are not known. Alpha A- and αB-crystallins differently associate with the cellular membrane, i.e. αA-crystallin may interact exclusively with membrane phospholipids, and thereby unaffected by the presence of extrinsic proteins on the membrane, whereas these proteins may act as conduits for αB-crystallin to bind to the membrane [58]. Presently, the specific binding mechanism of αAN101D to the membrane and age-related changes in lipid composition in lenses CRYαAN101D vs. CRYαAWT are unknown, and these are presently the focus of our investigations.

Conclusions

The results presented in this study suggest that an increased association of αAN101D relative WTαA with the lens membrane causes a possible loss of membrane integrity, leading to an ionic imbalance, and in turn, to membrane swelling, cellular disorganization and finally cortical opacity. Our future study will determine the specific binding site in the αAN101D relative WTαA, and changes in the membrane compositions that might facilitate the increased binding of the deamidated crystallin with the membrane. Additional file 1: Supplementary Table A. Water Insoluble-Urea Soluble (WI-US)-Protein Fraction of Alpha A-WT lenses. Additional file 2: Supplementary Table B. Water Insoluble-Urea Insoluble (WI-UI)-Protein Fraction of AlphaA N101D lens Additional file 3: Supplementary Table C. Water insoluble-urea soluble alphaAN101D (Mr > 30 kDa) Additional file 4: Supplementary Table D. Water insoluble-urea insoluble alpha A N101D (Mr > 30 kDa) Additional file 5.
  56 in total

Review 1.  Lens ion transport: from basic concepts to regulation of Na,K-ATPase activity.

Authors:  Nicholas A Delamere; Shigeo Tamiya
Journal:  Exp Eye Res       Date:  2008-05-16       Impact factor: 3.467

2.  Properties of alpha-crystallin bound to lens membrane: probing organization at the membrane surface.

Authors:  G Chandrasekher; R J Cenedella
Journal:  Exp Eye Res       Date:  1997-03       Impact factor: 3.467

3.  Cleavage of structural proteins during the assembly of the head of bacteriophage T4.

Authors:  U K Laemmli
Journal:  Nature       Date:  1970-08-15       Impact factor: 49.962

4.  alpha-Crystallin chaperone-like activity and membrane binding in age-related cataracts.

Authors:  Brian A Cobb; J Mark Petrash
Journal:  Biochemistry       Date:  2002-01-15       Impact factor: 3.162

Review 5.  Lipids and the ocular lens.

Authors:  Douglas Borchman; Marta C Yappert
Journal:  J Lipid Res       Date:  2010-04-20       Impact factor: 5.922

Review 6.  Vitreoretinal influences on lens function and cataract.

Authors:  David C Beebe; Nancy M Holekamp; Carla Siegfried; Ying-Bo Shui
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2011-04-27       Impact factor: 6.237

7.  Structural and functional changes in the alpha A-crystallin R116C mutant in hereditary cataracts.

Authors:  B A Cobb; J M Petrash
Journal:  Biochemistry       Date:  2000-12-26       Impact factor: 3.162

8.  Deamidation affects structural and functional properties of human alphaA-crystallin and its oligomerization with alphaB-crystallin.

Authors:  Ratna Gupta; Om P Srivastava
Journal:  J Biol Chem       Date:  2004-07-28       Impact factor: 5.157

9.  Membrane alterations during cataract development in the Nakano mouse lens.

Authors:  M Tanaka; P Russell; S Smith; S Uga; T Kuwabara; J H Kinoshita
Journal:  Invest Ophthalmol Vis Sci       Date:  1980-06       Impact factor: 4.799

10.  Significance of interactions of low molecular weight crystallin fragments in lens aging and cataract formation.

Authors:  Puttur Santhoshkumar; Padmanabha Udupa; Raju Murugesan; K Krishna Sharma
Journal:  J Biol Chem       Date:  2008-01-28       Impact factor: 5.157

View more
  2 in total

1.  An AFM Approach Applied in a Study of α-Crystallin Membrane Association: New Insights into Lens Hardening and Presbyopia Development.

Authors:  Nawal K Khadka; Raju Timsina; Laxman Mainali
Journal:  Membranes (Basel)       Date:  2022-05-14

2.  Alpha-Crystallin-Membrane Association Modulated by Phospholipid Acyl Chain Length and Degree of Unsaturation.

Authors:  Geraline Trossi-Torres; Raju Timsina; Laxman Mainali
Journal:  Membranes (Basel)       Date:  2022-04-23
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.