| Literature DB >> 33295839 |
Minwoo Kim1, Hee Cho1, Seung-Hoon Lee1, Woo-Jung Park2, Jeong-Min Kim3, Jae-Su Moon1, Geon-Woo Kim1, Wooseong Lee1, Hae-Gwang Jung1, Jeong-Sun Yang2, Jang-Hoon Choi4, Joo-Yeon Lee2, Sung Soon Kim5, Jong-Won Oh1.
Abstract
The MERS-CoV isolated during the 2015 nosocomial outbreak in Korea showed distinctive differences in mortality and transmission patterns compared to the prototype MERS-CoV EMC strain belonging to clade A. We established a BAC-based reverse genetics system for a Korean isolate of MERS-CoV KNIH002 in the clade B phylogenetically far from the EMC strain, and generated a recombinant MERS-CoV expressing red fluorescent protein. The virus rescued from the infectious clone and KNIH002 strain displayed growth attenuation compared to the EMC strain. Consecutive passages of the rescued virus rapidly generated various ORF5 variants, highlighting its genetic instability and calling for caution in the use of repeatedly passaged virus in pathogenesis studies and for evaluation of control measures against MERS-CoV. The infectious clone for the KNIH002 in contemporary epidemic clade B would be useful for better understanding of a functional link between molecular evolution and pathophysiology of MERS-CoV by comparative studies with EMC strain.Entities:
Keywords: MERS-CoV; ORF5 deletion variants; clade B Korean isolate; growth attenuation; infectious cDNA clone
Mesh:
Substances:
Year: 2020 PMID: 33295839 PMCID: PMC7782039 DOI: 10.1080/22221751.2020.1861914
Source DB: PubMed Journal: Emerg Microbes Infect ISSN: 2222-1751 Impact factor: 7.163
Figure 1.Construction of a full-length cDNA clone of a MERS-CoV Korean isolate. (A) Transmission routes and the origin of the MERS-CoV isolate used for the construction of an infectious cDNA clone in this study. The index patient (Patient #1) acquired the virus from an unknown source during his visit to the Middle East in 2015. Patient #1 spread the virus via nosocomial routes and also transmitted the virus to his spouse (Patient #2) in a household setting. A sputum sample from Patient #2 was inoculated onto Vero E6 cells, and viruses were passaged three times prior to sequencing analysis of the viral genome (KT029139). The purified virus (KNIH002 strain) was further passaged three times in Huh7 cells at the Korea Research Institute of Chemical Technology (Daejeon, Korea). Total RNA extracted from culture supernatants was then used to construct a full-length cDNA clone of the MERS-CoV Korean isolate. (B) Schematic illustration of the full-length cDNA clone of KNIH002. The cassette vector pBAC-MERS-CoV/YKC-5′-3′ carries a CMV promoter fused to the cDNA representing the first 811-nt of the genome, a multiple cloning site (MCS), and the cDNA of the last 950-nt (nt 29,159–30,108) of the genome followed by poly(dA)28, HDV ribozyme (Rz), and bovine growth hormone transcription termination and polyadenylation signal (BGH). The four unique restriction enzyme sites within MCS were used for the assembly of cDNA fragments (M-CoV-1, M-CoV-2, M-CoV-3, and M-CoV-4). Three nonsynonymous mutations incorporated in the resulting full-length clone (pBAC-MERS-CoV/YKC) are shown in red below the genome.
Primers used to generate MERS-CoV cDNA fragments
| cDNA fragments | Primers | Sequence (5′-3′) |
|---|---|---|
| M-CoV-B1 | M-CoV-B1 1F | GATTTAAGTGAATAGCTTGGCTATC |
| M-CoV-B1 811R | GGATCCGCCTCAAAATCGTC | |
| M-CoV-1 | M-CoV-1 791F | GGACGATTTTGAGGCGGATCC |
| M-CoV-1 9084R | GAACATGAGGCCTCATCTGACTG | |
| M-CoV-2 | M-CoV-2 9065F | TCAGATGAGGCCTCATGTTCGTTAC |
| M-CoV-2 18784R | GCAATAACGATCGTGATTAGTAGCAAG | |
| M-CoV-3 | M-CoV-3 18765F | CTAATCACGATCGTTATTGCTCTG |
| M-CoV-3 25767R | GACTCACGATCGACAGAAACTG | |
| M-CoV-4 | M-CoV-4 25748F | GTTTCTGTCGATCGTGAGTCTAC |
| M-CoV-4 29176R | GATGGACCTGGAGAAGTGCC |
Summary of sequence analysis of the 4 cDNA clones used for construction of a full-length cDNA clone of KNIH002 (KT029139).
| Open reading frame | Genomic position of nucleotide | Nucleotide change | Amino acid change (position) | Frequency | Incorporated in YKC |
|---|---|---|---|---|---|
| ORF1a/b | 6286 | C → T | Ala → Val (2003) | 3/3 | Yes |
| 11061 | C → T | Pro → Ser (3595) | 6/6 | Yes | |
| 19075 | G → A | SM (6266) | 6/6 | Yes | |
| S | 23303 | T → C | SM (616) | 6/6 | Yes |
| 24383 | C → T | SM (976) | 6/6 | Yes | |
| ORF4a | 25968 | T → A | SM (39) | 6/6 | Yes |
| 26109 | T → C | SM (86) | 6/6 | Yes | |
| ORF4b | 26109 | T → C | Met → Thr (6) | 6/6 | Yes |
| ORF5 | 26886–26887 | TT → - | V16SPAFHRI → V16SCISSH22• | 2/6 | No |
| N | 29097 | G → T | Val → Leu (178) | 1/6 | No |
Both synonymous (silent; SM) and nonsynonymous mutations are shown.
Number of clones containing indicated mutations among 6 independent clones analysed.
The GenBank number of the YKC clone: MT361640.
The nt 26,109 is in the overlapping region of ORF4a and ORF4b (+1 frameshifted ORF). Consequently, the “T → A” change at nt 26,109 results in a silent mutation at the ORF4a and a nonsynonymous substitution at the ORF4b.
A deletion mutation at nt 26,886–26,887 was observed, where the two nt “TT” was deleted in 2 out of 6 clones analysed.
A deletion of 2 nts (TT) at nt 26,886–26,887 leads to −2 frameshift resulting in early termination by introducing a stop codon (•).
Mutations with low frequency as well as those that lead to nonsense mutations were changed to the sequence in wild-type virus by site-directed mutagenesis.
Figure 2.Infectivity and replication competence of the recombinant MERS-CoV YKC rescued from the full-length cDNA clone of KNIH002. (A) The cytopathic effect induced by YKC P0 on Huh7 cells. (B) Immunoblotting analysis for the indicated viral structural proteins 2 days after infection of Huh7 cells with the P0 virus. α-tubulin was used as a loading control. (C) Northern blotting for detection of viral genome and subgenomic mRNAs at 2 dpi using a radiolabeled probe specific to ∼1 kb 3′-end region of the MERS-CoV genome. Visualization of 28S and 18S rRNA by ethidium bromide staining of total RNA separated by denaturing agarose gel electrophoresis (right panel). (D) Nucleotide sequence of the sgRNA encoding N protein (sgRNA8-N). The target gene was RT-PCR amplified using total RNA recovered from P0 YKC-infected Huh7 cells at 2 dpi. Shown in the enlarged chromatogram is the transcriptional regulatory sequence (TRS) flanked by the leader sequence and capsid protein (N)-coding gene. (E) The signature sequence (G7622C in ORF1a) of the infectious cDNA clone, verified by sequencing analysis of the corresponding region. (F) Vero E6 cells infected with MERS-CoV YKC at an MOI of 0.001 were subjected to immunoblotting analysis for the viral capsid protein N and the spike protein S (along with its two major cleaved forms). SFL, full-length S protein. Shown on the right of immunoblot is an illustration depicting proteolytic cleavage sites (S1/S2 and S2′) in S protein and its cleaved fragments, with their predicted molecular masses. SP, signal peptide; RBD, receptor-binding domain; RBM, receptor-binding motif; FP, fusion peptide; HR1 and HR2, heptad repeat 1 and 2; TM, transmembrane; CP, cytoplasmic tail. A single asterisk indicates a non-specific band, and a double asterisk indicates degraded forms of S protein. α-tubulin was used as a loading control.
Figure 3.Analysis of the infectivity of the tdTomato RFP-expressing recombinant YKC, YKC-RFP. (A) A schematic illustration of the MERS-CoV YKC-RFP in which the ORF5 gene in YKC was replaced with tdTomato gene (top panel). Nucleotide sequence of the 5′-end region of the viral mRNA encoding the RFP (middle panel). TRS, transcriptional regulatory sequence. Fluorescence microscopic images of YKC-RFP (P2)-infected Vero E6 cells at 2 dpi (bottom panel). Scale bar, 100 µm. (B and C) Infectious virus titres and viral protein levels in Vero E6 cells infected with YKC (P1) or YKC-RFP (P1) at an MOI of 0.001. The results are the mean ± SD of two independent experiments with two replicates.
Figure 4.Growth attenuation features of KNIH002 and YKC. (A) The 44 amino acid differences within various ORFs between EMC and KNIH002 strains. (B–E) Infectious virus titre was determined at the indicated time points following infection of Vero E6 cells with MERS-CoV EMC, KNIH002, or YKC at an MOI of 0.001. The results are the mean ± SD of two independent experiments with two replicates (B). Immunoblotting for N and S proteins at 24 and 60 hpi. (C). Copy number of N protein-coding viral sgRNA (sgRNA8-N) determined by RT-qPCR at 60 hpi (D). The average and range of two technical replicates is shown. Plaque size was measured at 4 dpi of Vero E6 cells (EMC, n = 23, KNIH002, n = 23; YKC, n = 18). Shown under the scatter plots are representative plaque morphologies with mean diameters ± SD (mm) of plaques (E). The asterisk in (C) indicates a nonspecific band. In (B and E), red and blue asterisks indicate the comparison of the EMC strain with KNIH002 and with YKC strains respectively; black asterisks indicate the comparison between KNIH002 and YKC strains. **P < 0.01; ***P < 0.001; ****P < 0.0001.
Figure 5.Genetic instability of the ORF5 of MERS-CoV. (A) Various ORF5 deletion variants in KNIH002 (P6). (B) Identification and localization of mutations emerged following three consecutive passages (P3) of the YKC P0 rescued from the infectious cDNA clone of the KNIH002 strain. A total of 6 clones were analysed for the detection of variants. del, deletion; ins, insertion.