Literature DB >> 33281263

Reduced Efflux Pumps Expression of Pseudomonas Aeruginosa with Satureja Khuzistanica Essential Oil.

Davoud Iman Islamieh1,2, Hossein Goudarzi2, Azad Khaledi3,4, Davoud Afshar5, Davoud Esmaeili1,6.   

Abstract

BACKGROUND: Efflux pumps such as MexEF-OprN and mexXY-OprM play an important role in the resistance of Pseudomonas Aeruginosa (P. aeruginosa) to antibiotics. The present study aimed to assess the reduced expression of efflux pump genes of P. aeruginosa with Satureja Khuzistanica essential oil (SKEO).
METHODS: The present cross-sectional study was conducted in 2016 at the Microbiology Laboratory of Baqiyatallah University of Medical Sciences, Tehran, Iran. The disk diffusion method was used for susceptibility testing of gentamicin and norfloxacin. Minimum inhibitory concentration (MIC) was determined for gentamicin and norfloxacin. The antibacterial efficacy of SKEO was defined by determining the MIC values using the microdilution method. In vitro, the synergistic interaction of SKEO combined with gentamicin or norfloxacin was examined via checkerboard assay and defined as a fractional inhibitory concentration index. The reverse transcription-polymerase chain reaction technique was used to measure changes in the expression of the efflux pump genes. The data were analyzed using SPSS software version 16.0, and P<0.05 was considered statistically significant.
RESULTS: The MIC values of SKEO were in the range of 6 to 12 µg/mL. In the presence of sub-inhibitory concentrations (1.16 to 2 MIC) of SKEO, synergistic effects were revealed using the checkerboard method. The effect of norfloxacin and gentamicin increased up to 8-fold. The expression of mexY and mexE was reduced after treatment with SKEO.
CONCLUSION: SKEO reduced the expression of efflux pumps and the MIC values of norfloxacin and gentamicin in vitro. Copyright: © Iranian Journal of Medical Sciences.

Entities:  

Keywords:  Efflux pump ; Gene expression ; Gentamicin; Norfloxacin ; Pseudomonas Aeruginosa

Year:  2020        PMID: 33281263      PMCID: PMC7707626          DOI: 10.30476/ijms.2019.72675

Source DB:  PubMed          Journal:  Iran J Med Sci        ISSN: 0253-0716


What’s Known Satureja khuzistanica essential oil (SKEO) has antibacterial activity against Pseudomonas aeruginosa. What’s New For the first time, the effect of Satureja khuzistanica essential oil on the expression of efflux pump genes of Pseudomonas aeruginosa is demonstrated. Satureja khuzistanica essential oil reduced the expression of efflux pumps and the MIC values of norfloxacin and gentamicin in vitro.

Introduction

Pseudomonas aeruginosa (P. aeruginosa) is an important cause of nosocomial infections, which can rapidly develop resistance to many antibiotics through various mechanisms such as the high expression of efflux pumps. [1] Resistance-nodulation-division family transporters are the main category of efflux pumps in P. aeruginosa and contain at least 10 different types of efflux pumps. [2] MexXY-OprM and mexEF-OprN are the two most relevant pumps systems involved in resistance to antimicrobial agents. [3] MexXY-OprM has a main role in extruding various antibiotics in P. aeruginosa isolates, particularly beta-lactam antibiotics. [4 , 5] Its expression commonly occurs in wild type strains and involves innate bacterial resistance to a number of antibiotics. [2 , 6] However, mexEF-OprN pump is expressed at low levels in wild-type isolates [7 , 8] and contributes to acquired resistance to antibiotics. [9] A previous study described some compounds such as herbal extracts could inhibit the activity of efflux pumps. [10] When plant extracts are used concurrently with chemical drugs, they enhance the effectiveness of antibiotics and can also act as an efflux pump inhibitor (EPI). [11] EPIs interrupt the extruding process of antibiotics by interference with the regulatory steps thereby suppressing the efflux pumps gene expression. [12] Checkerboard and real-time polymerase chain reaction (PCR) techniques can be used to assess the indirect activity of essential oils on the gene expression of efflux pumps. Compared with the checkerboard method, real-time PCR is a rapid technique with a high specificity and sensitivity, low contamination rate, and excellent efficiency in determining the synergistic effect. [13] Satureja khuzistanica (S. khuzistanica) is an endemic plant in southern Iran. It has an antimicrobial activity due to the presence of essential oil content. [14] The principal components of S. khuzistanica are thymol and carvacrol, which can damage bacteria. These substances, after disruption of efflux pumps, indirectly inhibit the gene expression of efflux pumps. The present study aimed to assess the reduced expression of efflux pump genes of P. aeruginosa with S. khuzistanica essential oil (SKEO).

Materials and Methods

The present cross-sectional study was conducted in 2016 at the Microbiology Laboratory of Baqiyatallah University of Medical Sciences, Tehran, Iran. The minimum inhibitory concentration (MIC) and checkerboard synergy assays were carried out in the cation-adjusted Mueller-Hinton broth (Hi-Media, India).

Strains and Inoculum Preparation

P. aeruginosa strains were isolated from the pus and wound specimens of burn patients referred to Shahid Motahari Hospital, Tehran, Iran. Multidrug-resistant (MDR) isolates were detected using the disk diffusion method according to the Clinical and Laboratory Standards Institute (CLSI, supplement M100) instructions. P. aeruginosa PAO1 was used as a standard strain. [15]

Preparation of SKEO

Based on the method recommended by the European Pharmacopeia, dry aerial parts (100 g) of S. khuzistanica were subjected to hydrodistillation for three hours using a Clevenger-type apparatus (Bakhtaran Co., Iran). The content of the device was kept at room temperature for 24 hours and subsequently mixed at the speed of 130 rpm using a shaker. A rotary device was used to remove solvents from the samples. Then, the sample was filtered using a vacuum pump. The obtained extract was weighed and then dissolved in dimethy sulfoxide (DMSO) solvent (Merck, Germany). The solution was kept in a refrigerator (Donar, Iran) at 4 °C for further use.

Determination of MIC

The macro broth dilution method was used to determine the MIC value of SKEO against MDR isolates. To dissolve SKEO, 100 μg/mL DMSO solvent was added to SKEO concentrations of 100, 120, 140, 160, 180, 200, 220, and 240 μg in eight sterile glass tubes (13×100 mm). Each tube was filled with 1 mL of Muller-Hinton broth and isolates were inoculated into tubes. After mixing, 1 mL of bacterial suspension (106 CFU/mL) was added to each tube and the final concentration of 5×105 CFU/mL was obtained. After incubation at 37 ºC for 24 hours, the minimal concentration of SKEO inhibiting bacterial growth was defined as MIC. [16]

RNA Extraction and cDNA Synthesis

A total of five MDR isolates were cultured in Muller-Hinton broth and suspended in diluted SKEO with a concentration below the MIC value and incubated at 37 ºC for 24 hours. The total RNA was extracted using an RNA extraction kit (Qiagen, USA) according to the manufacturer’s instruction. Then, cDNA was synthesized in a total volume of 20 μL reaction mixture, including 2 µg of the extracted RNA, 1 μL of deoxyribonucleotide triphosphate (10 mM), 50 ng of random Hexamer primer, 2 μL of M-MuLV buffer (10X) (Macrogen®, Korea), and 100 U of M-MuLV reverse transcriptase under an initial denaturation at 65 ºC for five minutes and reverse transcription steps at 42 ºC for one hour (Vivantis Technologies, Malaysia). The products were then used in the reverse transcription-polymerase chain reaction (RT-PCR) and PCR assay. The primers used in the PCR, RT-PCR, and quantitative reverse transcription PCR (qRT-PCR) assays are presented in table 1.
Table 1

Oligonucleotides sequences used in the present study

PrimersSequence (5′→3′)Amplicon size (bp)Reference
mexY-FGCCCAACGACATCTACTTCA108Present study
mexY-RATGCCTTCCTGGTAATGGTC
mexE-FTCCTCAAGTACGTCGAGCTG131Present study
mexE-RGACCTGGTTGTCGAGGAAGT
gyrA-FGGTCTGGGCATAGAGGTTGT121Jalalvandi[17]
gyrA-RGAAGATCGAGGGTATTTCCG
Oligonucleotides sequences used in the present study The RT-PCR reaction was performed using the RevertAid first-strand cDNA synthesis kit (Fermentas, USA) in a total volume of 25 μL reaction mixture, including 1 µg of cDNA (10 mM) and 0.3 pmol of each primer (table 1). The PCR condition included an initial denaturation at 95 °C for two minutes; 35 cycles at 95 °C for 30 seconds, 57 °C for 30 seconds, and 72 °C for 30 seconds; and a final extension at 72 °C for five minutes. GyrA was used as an internal control. PCR products were subjected to 1% agarose gel electrophoresis and visualized under Ultraviolet (UV) light using the gel documentation system (Bio-Rad, Germany).

Real-Time PCR

The changes in the expression level of mexE and mexY genes before and after being subjected to SKEO were identified through cDNA amplification using the qPCR method. Real-time PCR was performed using the Corbett Palm-Cycler gradient thermal cycler (Qiagen, Germany) under the following conditions: 12.5 μL of Maxima SYBR Green/ROX qPCR Master Mix 2X (Fermentas, USA), 2 μL of template, and 0.3 pmol of each primer (table 1). Amplification of all genes was carried out with one cycle pre-denaturation at 95 °C for 10 minutes, 40 cycles of denaturation at 95 °C for 20 seconds, annealing at 58 °C for 20 seconds, and elongation at 72 °C for 20 seconds, followed by a final step at 72 °C for 60 seconds. Melting curve analysis was drawn at the terminal of the 40th cycle between 58-95 °C. Moreover, the Livak method was used to determine relative changes in the expression of mexE and mexY genes in comparison with the housekeeping genes.

Determination of MIC and Checkerboard Synergy Assay

The MIC values of gentamicin (MAST, England) and norfloxacin (MAST, England) in the absence and presence of SKEO were characterized using macro broth dilution and checkerboard assays. To assess the synergistic effects of SKEO, two-fold serial dilutions of gentamicin and norfloxacin were prepared and added into a 96-well microtitre plate. Dilutions for each antimicrobial agent ranged from 1.16 dilution to 2 sub-inhibitory concentrations. The second agent (SKEO) was also serially diluted at different sub-inhibitory concentrations, and 50 μL of each dilution was added into each well. Then, 100 μL of the bacterial suspension (106 CFU/mL) was added into the wells with a final volume of 200 μL. Each experiment was controlled using solvent and growth sterility tests. All tests were carried out in duplicate. The microtiter plates were incubated at 37 °C for 18 hours under aerobic conditions. Then, 10 μL from each well was poured on the Muller-Hinton agar, and the checkerboard synergy result was obtained by calculating the fractional inhibitory concentration index (FICI) with the following formula: [18] Based on the FICI value, synergism was defined as FICI≤0.5, indifferent as 0.54.

Statistical Analysis

The data were analyzed using SPSS software version 16.0. One-way analysis of variance (ANOVA) was used to compare the means of three or more groups. The post hoc Tukey HSD test was used for pairwise comparisons of the groups. P<0.05 was considered as statistically significant.

Results

Antibacterial Effect of SKEO, Gentamicin, and Norfloxacin

The MIC values of gentamicin, norfloxacin, and SKEO against PAO1 and five MDR strains were investigated. As shown in table 2, SKEO showed dose-dependent antibacterial activity against P. aeruginosa strains. The MIC values of SKEO were in the range of 6 to 12 µg/mL and the PAO1 was the most sensitive strain.
Table 2

Antibacterial activity of Satureja khuzistanica essential oil combined with antibiotics, and the results of synergy tests via the checkerboard method

Strains MIC (µg/mL)FICI of SKEO with antibiotics
SKEOGentamicinNorfloxacinGentamicinNorfloxacin
PAO162 (S)0.5 (S)2 (I)1.83 (I)
PA9104096 (R)32 (R)1.1 (I)0.32 (Sy)
PA1184096 (R)16 (R)1 (I)0.37 (Sy)
PA139>4096 (R)16 (R)ND0.45 (Sy)
PA4172048 (R)16 (R)0.928 (I)0.41 (Sy)
PA4212>4096 (R)64 (R)ND0.83 (I)

I: Indifferent, Sy: Synergism, S: Sensitive, R: Resistance, ND: Not determined, SKEO: Satureja khuzistanica essential oil, MIC: Minimum Inhibitory Concentration, FICI: Fractional Inhibitory Concentration Index

Antibacterial activity of Satureja khuzistanica essential oil combined with antibiotics, and the results of synergy tests via the checkerboard method I: Indifferent, Sy: Synergism, S: Sensitive, R: Resistance, ND: Not determined, SKEO: Satureja khuzistanica essential oil, MIC: Minimum Inhibitory Concentration, FICI: Fractional Inhibitory Concentration Index

Effects of Antibiotics and Extract Combination

The effect of SKEO combined with gentamicin or norfloxacin was evaluated by checkerboard synergy assay. As shown in table 2, based on the FICI value, the results were categorized as synergism and indifferent (antagonism). Treating the MDR strains of P. aeruginosa to SKEO with antibiotics showed a FICI value between 0.37 and 0.45, indicating a synergistic effect (table 2). For most of the tested bacteria, the results of the checkerboard assay were indifferent. A combination of SKEO with gentamicin or norfloxacin did not show any synergistic effect against PAO1 strain. SKEO combined with norfloxacin showed a maximum effect against PA11 (FICI: 0.37). While SKEO reduced the MIC value of gentamicin and norfloxacin by up to 4- and 8-fold, respectively.

Effect of SKEO on the Expression of mexE, and mexY Genes

Gel electrophoresis of RT-PCR products confirmed the specificity of RNA primers. Subsequently, the qPCR analysis was conducted to reveal the quantitative gene expression of mexE, mexY, and gyrA. Based on the melting curves of the amplified genes, there were no non-specific amplicons or primer dimers. The one-way ANOVA test showed a significant reduction in the expression of mexE and mexY genes in the presence of SKEO for all isolates (P<0.001). The Livak method also revealed that different concentrations of SKEO significantly reduced mexE expression (9.7-fold) and mexY (4.99-fold) compared with the control gene. As shown in table 3, pairwise comparisons of the groups using the post hoc Tukey HSD test showed that the efficacy of SKEO on the gene expression of mexE was about two times more than the mexY gene. Moreover, the expression of mexE gene was 2.18-fold greater than mexY gene before treatment.
Table 3

Quantification of the expression levels of normalized mexE and mexY genes by quantitative polymerase chain reaction and minimum inhibitory concentration of Satureja khuzistanica essential oil against multidrug-resistant isolates

IsolatesmexE expression (before)mexY expression (before)Total expression of both genes (before)MIC of SKEO (µg/mL)mexE expression (after)mexY expression (after)
PA95.55±0.031.18±0.086.73±0.05101.12±0.020.03±0.008
PA111.87±0.061.24±0.043.02±0.0180.45±0.030.04±0.005
PA131.67±0.013.88±0.053.02±0.0190.49±0.020.07±0.002
PA411.77±0.020.54±0.022.31±0.0370.42±0.060.01±0.009
PA4210.04±0.062.75±0.0612.79±0.09121.97±0.020.05±0.001
Mean4.18±0.031.92±0.056.08±0.049.20.89±0.030.04±0.005

MIC: Minimum inhibitory concentration, SKEO: Satureja khuzistanica essential oil

Quantification of the expression levels of normalized mexE and mexY genes by quantitative polymerase chain reaction and minimum inhibitory concentration of Satureja khuzistanica essential oil against multidrug-resistant isolates MIC: Minimum inhibitory concentration, SKEO: Satureja khuzistanica essential oil

Discussion

In the present study, the MIC values of SKEO were in the range of 6 to 12 µg/mL, and PAO1 was the most sensitive strain. Treating the MDR strains of P. aeruginosa to SKEO combined with antibiotics showed a FICI value between 0.37 and 0.45, indicating a synergistic effect. SKEO in combination with gentamicin or norfloxacin did not show any synergistic effect against PAO1 strain. SKEO combined with norfloxacin showed a maximum effect against PA11 (FICI: 0.37). While SKEO reduced the MIC value of gentamicin and norfloxacin by up to 4- and 8-fold, respectively. There was a significant reduction in the expression of mexE and mexY genes in the presence of SKEO for all isolates (P<0.01). Different concentrations of SKEO significantly reduced mexE expression (9.7-fold), and mexY (4.99-fold) compared with the control gene. Moreover, the efficacy of SKEO on the gene expression of mexE was about two times more than the mexY gene. Additionally, the expression of mexE gene was 2.18-fold greater than mexY gene before treatment. The majority of developed chemical EPIs have many harmful effects. Hence, the use of natural EPIs such as plant extracts is recommended. It is known that phytocompounds can damage bacterial cell walls, resulting in the permeability of the cell membrane. [19] These membrane-damaging compounds are stress factors and can subsequently activate efflux pumps gene expression. [20] mexEF-OprN confers resistance to doripenem and meropenem, but this resistance could be due to the low expression of OrpD porin. [4] Aminoglycosides act as poor substrates for efflux pumps due to their hydrophilic nature. Studies have shown that they are transported by a large number of efflux pumps (MexXY-OprM) from the resistance-nodulation-division superfamily. [3] We tested the effect of SKEO on the expression of mexEF-OprN and MexXY-OprM pumps to assess the role of efflux pumps involved in antibiotic resistance. We found that SKEO reduced the expression of mexEF-OprN and mexXY-OprM genes. Moreover, SKEO combined with gentamicin or norfloxacin resulted in a decrease in their MIC values. As expected, an acceptable convergence was observed between checkerboard data and the expression of mex genes in all clinical isolates, except for two strains that FICI was not determined. The results showed that SKEO inhibited bacterial growth at a lower dose than gentamicin and norfloxacin. Therefore, SKEO can be more useful than antibiotic therapy due to its mild side effects. In line with our findings, Bahador and colleagues showed that in the presence of SKEO, the expression level of the bap gene in Acinetobacter baumannii decreased by 24-fold. [21] Other studies have also reported that SKEO could reduce the expression of mexR, mexA, and exoS genes in P. aeruginosa strains. [17 , 22] In our earlier study, we reported that SKEO had a significant effect on reducing the expression of lasA and lasB of P. aeruginosa. [23] Similarly, we showed the inhibitory effect of SKEO on the expression of efflux pumps involved in antibiotic resistance. In a previous study, the reported MIC value of the acetonic extract of Clinopodium vulgare was similar to our results, while no effects were observed in the presence of ethanolic extract. The difference can be attributed to the rapid evaporation of ethanol and the presence of P. aeruginosa strains with high resistance to gentamicin. [19] Despite a 2- to 4-fold reduction in the MIC value of gentamicin by SKEO, we did not observe any synergistic effect. This meant that the mexY gene could not be the only resistance factor against gentamicin. Therefore, further studies are required to identify other possible resistance mechanisms. Finally, it seems that SKEO can be used as a significant EPI in the treatment of patients infected with MDR strains of P. aeruginosa. However, it is suggested to assess its pharmacokinetics, potency, and toxicity in human cells. The main limitation of the present study was a low number of isolates, which should be addressed in future studies.

Conclusion

S. khuzistanica essential oil reduced the expression of efflux pumps and the MIC values of norfloxacin and gentamicin in vitro.
  14 in total

1.  Induction of mexCD-oprJ operon for a multidrug efflux pump by disinfectants in wild-type Pseudomonas aeruginosa PAO1.

Authors:  Yuji Morita; Takeshi Murata; Takehiko Mima; Sumiko Shiota; Teruo Kuroda; Tohru Mizushima; Naomasa Gotoh; Takeshi Nishino; Tomofusa Tsuchiya
Journal:  J Antimicrob Chemother       Date:  2003-03-13       Impact factor: 5.790

2.  Clinical strains of Pseudomonas aeruginosa overproducing MexAB-OprM and MexXY efflux pumps simultaneously.

Authors:  Catherine Llanes; Didier Hocquet; Christelle Vogne; Dounia Benali-Baitich; Catherine Neuwirth; Patrick Plésiat
Journal:  Antimicrob Agents Chemother       Date:  2004-05       Impact factor: 5.191

Review 3.  Bacterial efflux pump inhibitors from natural sources.

Authors:  Michael Stavri; Laura J V Piddock; Simon Gibbons
Journal:  J Antimicrob Chemother       Date:  2006-12-04       Impact factor: 5.790

Review 4.  Real-time PCR in clinical microbiology: applications for routine laboratory testing.

Authors:  M J Espy; J R Uhl; L M Sloan; S P Buckwalter; M F Jones; E A Vetter; J D C Yao; N L Wengenack; J E Rosenblatt; F R Cockerill; T F Smith
Journal:  Clin Microbiol Rev       Date:  2006-01       Impact factor: 26.132

Review 5.  The challenge of efflux-mediated antibiotic resistance in Gram-negative bacteria.

Authors:  Xian-Zhi Li; Patrick Plésiat; Hiroshi Nikaido
Journal:  Clin Microbiol Rev       Date:  2015-04       Impact factor: 26.132

6.  Regulation of RamA by RamR in Salmonella enterica serovar Typhimurium: isolation of a RamR superrepressor.

Authors:  Vito Ricci; Stephen J W Busby; Laura J V Piddock
Journal:  Antimicrob Agents Chemother       Date:  2012-09-04       Impact factor: 5.191

Review 7.  Role of efflux mechanisms on fluoroquinolone resistance in Streptococcus pneumoniae and Pseudomonas aeruginosa.

Authors:  George G Zhanel; Daryl J Hoban; Kristen Schurek; James A Karlowsky
Journal:  Int J Antimicrob Agents       Date:  2004-12       Impact factor: 5.283

8.  Efflux pump inhibitors reduce the invasiveness of Pseudomonas aeruginosa.

Authors:  Yoichi Hirakata; Akira Kondo; Kazuki Hoshino; Hisakazu Yano; Kazuaki Arai; Ayako Hirotani; Hiroyuki Kunishima; Natsuo Yamamoto; Masumitsu Hatta; Miho Kitagawa; Shigeru Kohno; Mitsuo Kaku
Journal:  Int J Antimicrob Agents       Date:  2009-07-16       Impact factor: 5.283

9.  Effect of Satureja khuzistanica essential oil (SKEO) extract on expression of lasA and lasB genes in Pseudomonas aeruginosa.

Authors:  Davoud Iman Islamieh; Davoud Afshar; Davoud Esmaeili
Journal:  Iran J Microbiol       Date:  2019-02

10.  Antibacterial activity of endemic Satureja Khuzistanica Jamzad essential oil against oral pathogens.

Authors:  Sogol Seghatoleslami; Nasrin Samadi; Ali Salehnia; Shahram Azimi
Journal:  Iran Endod J       Date:  2009-01-07
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.