Literature DB >> 33265921

Genetic Deficiency and Pharmacological Stabilization of Mast Cells Ameliorate Pressure Overload-Induced Maladaptive Right Ventricular Remodeling in Mice.

Akylbek Sydykov1, Himal Luitel1,2, Argen Mamazhakypov1,3, Malgorzata Wygrecka4, Kabita Pradhan1, Oleg Pak1, Aleksandar Petrovic1, Baktybek Kojonazarov1, Norbert Weissmann1, Werner Seeger1,3, Friedrich Grimminger1, Hossein Ardeschir Ghofrani1, Djuro Kosanovic1,5, Ralph Theo Schermuly1.   

Abstract

Although the response of the right ventricle (RV) to the increased afterload is an important determinant of the patient outcome, very little is known about the underlying mechanisms. Mast cells have been implicated in the pathogenesis of left ventricular maladaptive remodeling and failure. However, the role of mast cells in RV remodeling remains unexplored. We subjected mast cell-deficient WBB6F1-KitW/W-v (KitW/KitW-v) mice and their mast cell-sufficient littermate controls (MC+/+) to pulmonary artery banding (PAB). PAB led to RV dilatation, extensive myocardial fibrosis, and RV dysfunction in MC+/+ mice. In PAB KitW/KitW-v mice, RV remodeling was characterized by minimal RV chamber dilatation and preserved RV function. We further administered to C57Bl/6J mice either placebo or cromolyn treatment starting from day 1 or 7 days after PAB surgery to test whether mast cells stabilizing drugs can prevent or reverse maladaptive RV remodeling. Both preventive and therapeutic cromolyn applications significantly attenuated RV dilatation and improved RV function. Our study establishes a previously undescribed role of mast cells in pressure overload-induced adverse RV remodeling. Mast cells may thus represent an interesting target for the development of a new therapeutic approach directed specifically at the heart.

Entities:  

Keywords:  cromolyn; fibrosis; mast cells; pulmonary artery banding; remodeling; right ventricle

Year:  2020        PMID: 33265921      PMCID: PMC7729505          DOI: 10.3390/ijms21239099

Source DB:  PubMed          Journal:  Int J Mol Sci        ISSN: 1422-0067            Impact factor:   5.923


1. Introduction

Right ventricular (RV) remodeling in response to chronic pressure overload represents a complex set of functional and structural adaptations. Initially, the right ventricle adapts with myocardial hypertrophy and increased contractility. However, maladaptive changes subsequently adversely affect the RV remodeling leading to RV fibrosis, chamber dilatation and dysfunction. Furthermore, functional capacity and survival of patients with pulmonary arterial hypertension are mainly determined by the ability of the right ventricle to cope with the chronic pressure overload [1]. Although the response of the right ventricle to sustained pressure overload is an important determinant of the patient outcome, the underlying molecular mechanisms remain elusive [2]. Under normal conditions, the right and left ventricles demonstrate significant differences in their structure and function, suggesting that their adaptation mechanisms to biomechanical stress could be different. Indeed, accumulating evidence indicates that some molecular mechanisms underlying responses to increased afterload differ between the right and left ventricles [3,4]. Identifying these cellular and molecular targets that are differentially altered in the pressure overloaded right ventricle might help developing novel therapeutic approaches directed specifically at the right ventricle. However, the ventricles also share many common features in their response to pressure overload [5]. Consequently, identifying the shared pathways may allow extrapolation of medical therapies used in left heart failure to the treatment of RV failure. In addition, targeting these common pathways may lead to novel strategies applicable to the treatment of both right and left heart failure. There is substantial evidence implicating mast cells in maladaptive left ventricular remodeling and failure [6,7,8]. However, involvement of mast cells in the development of adverse RV remodeling remains largely unexplored. Interestingly, increased mast cells numbers along with increased myocardial fibrosis have recently been found in right ventricles of rats spontaneously developing systemic hypertension [9]. Furthermore, we have demonstrated increased accumulation and activation of mast cells in pressure-overloaded right ventricles in mice subjected to sustained pressure overload [10]. The aim of the current study was to investigate the role of mast cells in the pressure overload-induced RV remodeling and to explore whether pharmacological intervention by targeting mast cells can prevent or reverse adverse RV remodeling.

2. Results

2.1. Mast Cell Deficiency Is Associated with Adaptive Pressure Overload-Induced RV Remodeling

Invasive measurements showed a significant pulmonary artery banding (PAB)-induced increase in right ventricular systolic pressure (RVSP) in both mast cell deficient KitW/KitW-v and mast cell-sufficient littermate control (MC+/+) mice compared to sham mice (Figure 1A). The severity of the pressure overload imposed on the right ventricle of KitW/KitW-v and MC+/+ mice was comparable as evidenced by similar values of RVSP (Figure 1A). There were no differences in systemic arterial pressure (SAP) between the groups (Figure 1B). The magnitude of RV hypertrophy in PAB KitW/KitW-v and MC+/+ mice was comparable as evidenced by an increase in RV mass of similar degree (Figure 1C). However, these mice displayed different types of RV remodeling in response to pressure overload. Noninvasive echocardiographic study showed that PAB led to significant RV chamber enlargement with thickening of the RV wall in MC+/+ mice (Figure 1D,E,G,H). In contrast, in KitW/KitW-v mice, RV remodeling was characterized by increased RV wall thickness with minimal RV chamber dilatation (Figure 1D,E,G,H). Furthermore, RV remodeling in PAB MC+/+ mice was associated with significant functional impairment of the right ventricle as evidenced by reduced tricuspid annular plane systolic excursion (TAPSE); whereas, RV function was preserved in PAB KitW/KitW-v mice (Figure 1F).
Figure 1

KitW/KitW-v mice exhibit adaptive right ventricular (RV) remodeling and preserved RV function following pulmonary artery banding (PAB). (A,B) Invasively measured RV systolic pressure (RVSP) and systemic arterial pressure (SAP) evaluate hemodynamics in MC+/+ and KitW/KitW-v mice subjected either to PAB or sham surgery. (C) RV weight-to-tibia length (RV/TL) ratios assess RV hypertrophy. (D–F) Echocardiography-derived RV wall thickness (RVWT), RV internal diameter (RVID), and tricuspid annular plane systolic excursion (TAPSE) evaluate RV remodeling and function in MC+/+ and KitW/KitW-v mice subjected either to PAB or sham surgery. (G) Representative images of the echocardiography-derived RVWT measurement. (H) Representative images of the echocardiography-derived RVID measurement. Values are means ± SEM. Two-way ANOVA with Tukey’s post-hoc multiple comparisons test. P values shown are for interaction of genotype and condition. * p < 0.05 versus sham, # p < 0.05 versus MC+/+ sham, § p < 0.05 versus PAB MC+/+, n = 7–9 mice per group for echocardiography, and n = 13–15 mice for hemodynamic measurements.

On a cellular level, the cross sectional area of cardiomyocytes increased after PAB in both genotypes (Figure 2A,C). The increase of size in response to banding was statistically significant within each genotype, but the PAB KitW/KitW-v mice displayed a significantly higher cross sectional area of RV cardiomyocytes compared to PAB MC+/+ mice (Figure 2C). RV remodeling was associated with significantly increased mRNA expression of hypertrophic (ANP, BNP) markers in the right ventricles from PAB KitW/KitW-v and MC+/+ mice with no differences in the expression levels between the two genotypes (Figure 3A,B).
Figure 2

KitW/KitW-v mice develop significant cardiomyocyte hypertrophy and myocardial fibrosis following pulmonary artery banding (PAB). (A) Representative images of right ventricles cut in cross-section and stained with wheat germ agglutinin-FITC conjugate in MC+/+ and KitW/KitW-v mice subjected either to PAB or sham surgery. (B) Representative images of picrosirius red stained right ventricles. (C) Bar graphs summarizing quantification of mean RV cardiomyocyte cross-sectional area (CSA). (D) Bar graphs summarizing quantification of RV interstitial fibrosis. Values are means ± SEM. Two-way ANOVA with Tukey’s post-hoc multiple comparisons test. * p < 0.05 versus sham, § p < 0.05 versus PAB MC+/+, n = 4–5 mice per group.

Figure 3

Gene expression of hypertrophic, profibrotic and inflammatory markers in the right ventricles of MC+/+ and KitW/KitW-v mice following pulmonary artery banding (PAB). (A–I) Quantification of qPCR data in the right ventricles of MC+/+ and KitW/KitW-v mice following PAB shown as fold change in mRNA expression of atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), collagen-1 (Col1), collagen-3 (Col3), matrix metalloproteinase (MMP) 2, MMP9, MMP12, tissue inhibitor of metalloproteinase (TIMP) 1, and TIMP2. Values are means ± SEM. Results are presented as fold induction of target gene transcripts compared to respective sham controls. Two-way ANOVA with Tukey’s post-hoc multiple comparisons test. * p < 0.05 versus sham, n = 4 mice per group.

PAB resulted in a significant increase in RV interstitial fibrosis in both PAB MC+/+ and KitW/KitW-v mice compared to sham mice (Figure 2B,D). RV remodeling was associated with significantly enhanced mRNA expression of profibrotic (collagen-1, collagen-3) markers in the right ventricles from both PAB MC+/+ and KitW/KitW-v mice with no differences between them (Figure 3C,D). PAB caused significant upregulation in the mRNA expression of MMP2, TIMP1, and TIMP2 (Figure 3E,H,I). However, the increased expression was not affected by the genotype of the mice (Figure 3E,H,I). No significant changes in the mRNA levels of MMP9 and MMP12 were detected following PAB (Figure 3F,G). In MC+/+ mice, pressure overload was associated with increased number of degranulated mast cells in the right ventricles (Figure 4A). No mast cells were detected in the right ventricles of KitW/KitW-v mice (Figure 4A). RV remodeling was associated with significantly increased mRNA expression of inflammatory mediators TNF-α and IL-6 in the right ventricles of PAB MC+/+ mice compared to sham mice (Figure 4B,C). In contrast, PAB KitW/KitW-v mice displayed significantly attenuated inflammatory response (Figure 4B,C).
Figure 4

Attenuated inflammatory responses in the pressure-overloaded right ventricles of MC+/+ and KitW/KitW-v mice following pulmonary artery banding (PAB). (A) Representative images of right ventricles stained with toluidine blue showing mast cells in sham and PAB mice. (B,C) Quantification of qPCR data in the right ventricles of MC+/+ and KitW/KitW-v mice following PAB showed fold change in mRNA expression of tumor necrosis factor α (Tnf-α) and interleukin-6 (IL-6). Values are means ± SEM. Results are presented as fold induction of target gene transcripts compared to respective sham controls. Two-way ANOVA with Tukey’s post-hoc multiple comparisons test. P values shown are for interaction of genotype and condition (Pinter). * p < 0.05 versus sham, n = 4 mice per group.

2.2. Preventive Cromolyn Application Prevents Adverse RV Remodeling after PAB

To explore whether clinically available mast cell-stabilizing agents can prevent maladaptive RV remodeling, we administered cromolyn (50 mg/kg/day i.p.) starting from day 1 of PAB surgery in C57Bl6/J mice. After three weeks, there were no differences in RVSP between placebo and preventive cromolyn groups (Figure 5A). Similarly, SAP was not different among the groups (Figure 5B). Preventive administration of cromolyn attenuated RV mass increase as compared to placebo (Figure 5C). Furthermore, cromolyn prevented significant RV chamber enlargement, RV wall thickening, and RV dysfunction (Figure 5D–F). Adaptive RV remodeling induced by preventive administration of cromolyn was not associated with any effects of therapy on the cross sectional area of individual cardiomyocytes (Figure 5G,H) and was not associated with attenuated mRNA upregulation of hypertrophic markers in the right ventricles from PAB mice (Figure 6A,B).
Figure 5

Preventive and therapeutic application of cromolyn affects right ventricular (RV) remodeling in C57Bl/6J mice following pulmonary artery banding (PAB). Mice received either placebo or cromolyn (50 mg/kg/day, i.p.) starting from day 1 (preventive) or 7 days (therapeutic) after PAB. (A,B) Invasively measured RV systolic pressure (RVSP) and systemic arterial pressure (SAP) evaluate hemodynamics in PAB mice. (C) RV weight-to-tibia length (RV/TL) ratios assess RV hypertrophy. (D–F) Echocardiography-derived RV wall thickness (RVWT), RV internal diameter (RVID), and tricuspid annular plane systolic excursion (TAPSE) evaluate RV remodeling and function in PAB mice. (G) Bar graphs summarizing quantification of mean RV cardiomyocyte cross-sectional area (CSA). (H) Representative images of right ventricles cut in cross-section and stained with wheat germ agglutinin-FITC conjugate in C57Bl/6J mice subjected PAB surgery and treated with cromolyn. (I) Bar graphs summarizing quantification of RV interstitial fibrosis. (J) Representative images of picrosirius red stained right ventricles. Values are means ± SEM. One-way ANOVA with Dunnett’s post-hoc multiple comparisons test. * p < 0.05 versus placebo-treated PAB mice, n = 10 mice per group for echocardiography, n = 15 mice for hemodynamic measurements and n = 5 mice per group for histological assessment.

Figure 6

Effects of cromolyn on gene expression of hypertrophic, profibrotic, and inflammatory markers in the right ventricles of C57Bl/6J mice following pulmonary artery banding (PAB). Mice received either placebo or cromolyn (50 mg/kg/day, i.p.) starting from day 1 (preventive) or 7 days (therapeutic) after PAB. (A–I) Quantification of qRT-PCR data in the right ventricles of PAB mice shown as fold change in mRNA expression of atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), collagen-1 (Col1), collagen-3 (Col3), matrix metalloproteinase (MMP) 2, MMP9, MMP12, tissue inhibitor of metalloproteinase (TIMP) 1, and TIMP2. Values are means ± SEM. Results are presented as fold induction of target gene transcripts compared to sham. One-way ANOVA with Tukey’s post-hoc multiple comparisons test. * p < 0.05 versus sham mice, n = 4 mice per group.

Cromolyn did not prevent significant interstitial fibrosis (Figure 5I,J). In PAB C57Bl6/J mice, RV remodeling was associated with significantly enhanced mRNA expression of profibrotic markers in the right ventricles (Figure 6C,D). Administration of cromolyn did not prevent mRNA upregulation of profibrotic genes in the right ventricles from PAB mice (Figure 6C,D). PAB caused significant upregulation in the mRNA expression of MMP2, TIMP1, and TIMP2 (Figure 6E,H,I). However, the increased expression was not affected by cromolyn administration (Figure 6E,H,I). No significant changes in the mRNA levels of MMP9 and MMP12 were detected following PAB (Figure 6F,G). Preventive administration of cromolyn was associated with significant reduction of both mast cell numbers and degranulation compared with placebo treated banded mice (Figure 7A,B). RV remodeling was associated with significantly enhanced mRNA expression of inflammatory mediators TNF-α and IL-6 in the right ventricles of PAB C57Bl6/J mice (Figure 7C,D). Administration of cromolyn did not prevent mRNA upregulation of inflammatory mediators in the right ventricles from PAB C57Bl6/J mice (Figure 7C,D).
Figure 7

Effects of cromolyn on inflammatory responses in the pressure-overloaded right ventricles of C57Bl/6J mice following pulmonary artery banding (PAB). (A,B) Bar graphs summarizing quantification of mast cell density and activity in the right ventricles of PAB mice. (C,D) Quantification of qPCR data in the right ventricles of MC+/+ and KitW/KitW-v mice following PAB shown as fold change in mRNA expression of tumor necrosis factor α (Tnf-α) and interleukin-6 (IL-6). Values are means ± SEM. qPCR results are presented as fold induction of target gene transcripts compared to sham. One-way ANOVA with Dunnett’s post-hoc multiple-comparisons test was used in (A,B); one-way ANOVA with Tukey’s post-hoc multiple-comparisons test was used in (C,D). # p < 0.05 versus placebo-treated PAB mice, * p < 0.05 versus sham mice, n = 5 mice per group for mast cell density and activity quantification and n = 4 mice per group for qPCR analysis.

2.3. Therapeutic Cromolyn Administration Ameliorates Maladaptive RV Remodeling after PAB

We further investigated whether cromolyn can reverse maladaptive RV remodeling by starting drug application from day 7 after PAB surgery. After two weeks of treatment, there were no differences in RVSP and SAP between the groups (Figure 5A,B). In the cromolyn treatment group, the degree of RV chamber hypertrophy was not affected, but RV chamber dilatation was significantly attenuated and was associated with improved RV function (Figure 5C–F). Treatment with cromolyn did not affect cardiomyocyte hypertrophy (Figure 5G,H) and was not associated with attenuated mRNA upregulation of hypertrophic markers in the right ventricles from PAB mice (Figure 6A,B). Cromolyn treatment did not reduce interstitial fibrosis compared to placebo-treated PAB mice (Figure 5I,J) and was not associated with attenuated mRNA expression levels of profibrotic markers in the right ventricles (Figure 6C,D). Cromolyn treatment did not diminish mRNA upregulation of MMP2, TIMP1, and TIMP2 in the right ventricles of banded mice (Figure 6E,H,I). Treatment with cromolyn was associated with significant reduction of both mast cell density and activity compared with placebo-treated banded mice (Figure 7A,B). Therapeutic administration of cromolyn did not attenuate mRNA upregulation of inflammatory mediators TNF-α and IL-6 in the right ventricles from PAB C57Bl6/J mice (Figure 7C,D).

3. Discussion

In the present study, we provided further evidence for the potential role of mast cells in the pressure overload-induced adverse RV remodeling. Sustained pressure overload in mast cell-deficient mice was associated with adaptive RV remodeling as evidenced by minimal dilatation of the RV chamber and preserved RV function. Furthermore, we have demonstrated that inhibition of mast cell degranulation by cromolyn ameliorates pressure overload-induced RV structural and functional alterations in mice. Substantial evidence implicates mast cells in adverse myocardial remodeling and heart failure in the pressure-overloaded left ventricle [7,8]. In contrast, the role of mast cells in RV remodeling has not yet been addressed. Recently, we have demonstrated accumulation and activation of mast cells along with increased expression of several mouse mast cell proteases (mMCP), including mMCP-2, 4, 5, 6 and carboxypeptidase A3, in the right ventricles of mice subjected to PAB [10]. Similar to the previous findings in C57Bl/6J mice, in the current study, sustained pressure overload led to adverse RV remodeling with chamber dilatation, myocardial fibrosis, and functional impairment of the right ventricle in MC+/+ mice. Interestingly, mast cell deficiency was not associated with diminished RV cellular and chamber hypertrophy. Enhanced RVWT and cardiomyocyte cell size in KitW/KitW-v mice might reflect greater pressure load on the right ventricle compared with MC+/+ mice. Indeed, sham and PAB KitW/KitW-v mice exhibited slightly elevated RVSP compared with corresponding MC+/+ mice. Of note, elevated RVSP was documented in our previous study using two different mast cell deficient mouse lines, WBB6F1/J-KitW/KitW-v (KitW/KitW-v) and WBB6F1-Sl/Sld [11]. Importantly, mast cell deficient mice did not display any morphological changes in the pulmonary vasculature [11], suggesting that elevated RVSP was not due to pulmonary vascular remodeling. The reason for higher RVSP in mast cell deficient mouse lines remains though undetermined. Nevertheless, in KitW/KitW-v mice, pressure overload-induced RV remodeling was characterized by minimal dilatation of the RV chamber and preserved RV function. Our findings are in line with the previous study, which showed preservation of heart function following left ventricular pressure overload using the same mouse strain KitW/KitW-v [12]. In contrast, mast cell-deficient C57BL/6-KitW-sh mice developed progressive left ventricular dilatation with markedly impaired cardiac function after transverse aortic constriction [13]. The discrepancy in the response to increased hemodynamic load between these two mast cell-deficient mouse strains is not clear but may be due to the genetic inversion in C57BL/6-KitW-sh mice, which causes disruption in the Corin gene, coding for corin, a serine protease important for ANP processing [14]. Mechanisms of tissue fibrosis regression involve cessation of chronic tissue injury, deactivation of myofibroblasts, switch of proinflammatory processes to an anti-inflammatory microenvironment, and degradation of excessive extracellular matrix [15]. In PAB mice, chronic pressure overload to the right ventricle is maintained stimulating continuation of the fibrogenic processes as evidenced by persistently enhanced expression of fibrogenic markers in the right ventricles. Mast cells store a wide variety of other fibrogenic mediators including histamine, cytokines, and growth factors [16]. However, pro-fibrotic mediators can originate also from other cell types in the heart [17]. Hence, we could not find any differences in the expression level of pro-fibrotic markers (collagen-1 and collagen-3) in the right ventricles between banded KitW/KitW-v and MC+/+ mice. Consequently, RV collagen accumulation in KitW/KitW-v mice was not affected. The discrepancy between unattenuated fibrosis in our study and decreased collagen deposition in studies of left ventricular pressure overload suggest that the relative contribution of mast cells to collagen synthesis in pressure-overloaded right ventricles is marginal. There is growing evidence suggesting involvement of inflammatory mediators in the maladaptive RV remodeling [18,19]. Mast cells store and release IL-6 and TNF-α, multifunctional cytokines with pleiotropic actions, which have been implicated in left ventricular remodeling and failure following aortic constriction [20,21]. Increased IL-6 and TNF-α expression in right ventricles has been demonstrated in various experimental models of RV pressure overload-induced RV remodeling [22,23,24,25,26,27,28,29]. Our findings of decreased TNF-α and IL-6 mRNA expression in the right ventricles of PAB KitW/KitW-v mice compared to MC+/+ mice suggest that mast cell-derived inflammatory mediators might be involved in the development of pressure-overload-induced adverse RV remodeling and dysfunction. We further investigated whether clinically available mast cells stabilizing drugs can prevent or reverse maladaptive RV remodeling and dysfunction. For this purpose, we administered cromolyn to C57Bl/6J mice starting either from day 1 or 7 days after PAB surgery. Efficacy of cromolyn treatment was confirmed by significant inhibition of mast cell degranulation in treated animals. Interestingly, treatment with cromolyn led also to reduction in mast cell density in the right ventricle. The ability of cromolyn to prevent an increase in mast cell numbers has been previously demonstrated in other animal models [30,31]. Prevention of mast cell degranulation inhibits stem cell factor release, which is a potent growth and chemotactic factor for mast cells. This may lead to attenuated chemotaxis, replication, and differentiation of mast cells. Both preventive and therapeutic cromolyn applications significantly attenuated RV dilatation and improved RV function. The ability of cromolyn to prevent RV hypertrophy was demonstrated in animal models of pulmonary hypertension including monocrotaline-induced pulmonary hypertension, pulmonary hypertension due to left heart disease, and hypoxia-induced pulmonary hypertension [11,32,33]. Importantly, RV hypertrophy reduction in those models was secondary to the alleviation of pulmonary hypertension. In flow-associated pulmonary hypertension induced by combination of monocrotaline injection and an aorto-caval shunt creation, preventive administration of cromolyn did not attenuate pulmonary hypertension [34]. However, a trend towards blunted RV hypertrophy was observed [34]. Interestingly, cromolyn treatment of established pulmonary hypertension in monocrotaline-treated rats affected neither pulmonary hemodynamics nor RV hypertrophy [11]. In our study, preventive cromolyn administration resulted in decreased RV/TL, RVWT, and RVID in PAB C57Bl6/J mice. Notably, blunted chamber hypertrophy in cromolyn-treated PAB mice was not paralleled by reduction in cardiomyocyte size, which was comparable to that in placebo-treated PAB mice. Thus, maintenance of cardiomyocyte hypertrophy associated with adaptive remodeling seems to be important for the right ventricle to cope with the persistent afterload. Conversely, in mast cell deficient KitW/KitW-v mice, pressure overload was associated with enhanced RV wall thickness. Of note, both sham KitW/KitW-v mice and those subjected to PAB displayed more prominent cardiomyocyte cell size compared to corresponding MC+/+ mice. Remarkable cardiomyocyte hypertrophy might have contributed to better preservation of RV function in PAB KitW/KitW-v mice despite significantly higher RVSP compared to PAB C57Bl6/J mice. Moreover, in an animal model of hemorrhagic shock and resuscitation, it has been demonstrated that inhibition of mast cell degranulation can significantly improve cardiac function [35]. As both preventive and therapeutic approaches resulted in improved RV remodeling and function, we suggest that mast cell are involved in early events initiating adaptive processes to pressure overload as well as in later transition from compensatory hypertrophy to RV failure. Unlike to PAB KitW/KitW-v mice, cromolyn treatment did not affect IL-6 and TNF-α expression. The reason for this discrepancy is not understood, but may be related to the fact that, while KitW/KitW-v mice were lacking mast cells with the remaining cells being dysfunctional [36], cromolyn only decreased mast cell numbers in the RV tissue and inhibited their degranulation. Importantly, mast cells can synthesize and secrete a number of mediators, which exert effects, without degranulating [37]. Consequently, concomitant inhibition of mast cell degranulation and stimulation of beneficial mediator production has been suggested as a therapeutic approach to fully exploit the potency of these cells [37]. Moreover, in addition to its mast cell stabilizing properties, cromolyn affects many facets of the inflammatory processes, which are unrelated to mast cell activation [38]. Taken together, our study demonstrated a potential role of mast cells in pressure overload-induced adverse RV remodeling and dysfunction. Mast cells may thus represent an interesting target for the development of a new therapeutic approach directed specifically at right ventricle.

4. Materials and Methods

4.1. Animals

Adult (12 weeks old) male C57Bl/6J were obtained from Charles River Laboratories (Sulzfeld, Germany). Adult (12 weeks old) male WBB6F1/J-Kit/Kit (Kit/Kit mice carrying compound heterozygous mutations of c-kit (KitW, null; KitW-v, dominant negative) with their mast cell-sufficient littermate controls (MC+/+) were purchased from Jackson Laboratories (Bar Harbor, ME, USA). The Kit/Kit compound heterozygous mice combine severe Kit mutation with milder Kit mutation have markedly reduced KIT receptor activity and are severely mast cell-deficient [39]. All mice received humane care and were maintained under appropriate barrier conditions in a 12/12 h light-dark cycle and received standard laboratory food ad libitum and free access to water throughout the experimental period. All experimental procedures were approved by the governmental ethics committee for animal welfare (Gi 20/10, Nr. 4/2012, Regierungspräsidium Giessen, Germany).

4.2. PAB Surgery

Right ventricular pressure overload was induced by PAB in mice, as previously described [10]. Briefly, buprenorphine hydrochloride (Temgesic®, 0.1 mg/kg bw, Essex Pharma GmbH, Munich, Germany) was administered s.c. as an analgesic prior to operation. Surgery was performed under general anesthesia of 2% isoflurane. The animals were placed on a controlled warming platform to maintain body temperature and were ventilated with a rodent ventilator (MiniVent Type 845, Hugo Sachs Elektronik KG, March, Germany). Following left lateral thoracotomy, the pulmonary artery was constricted using a small titanium clip (Hemoclip®, Teleflex Inc., Morrisville, NC, USA) and a modified, adjustable clip applier (Hemoclip®, Teleflex Inc., Morrisville, NC, USA). In control mice, a sham operation without pulmonary artery occlusion was performed.

4.3. Experimental Design

To explore the role of mast cell deficiency on right ventricular remodeling, KitW/KitW-v and MC+/+ mice were subjected to either PAB or sham surgery for 3 weeks. The effects of mast stabilizing drugs were studied in C57Bl/6J mice, which were subjected to PAB for 3 weeks. To investigate whether mast cells stabilizing drugs can prevent maladaptive RV remodeling, the mice were randomized to receive either placebo or cromolyn sodium (50 mg/kg/day) starting from day 1 following PAB surgery. To investigate whether mast cells stabilizing drugs can reverse established maladaptive RV remodeling, we administered cromolyn (50 mg/kg/day, i.p.) starting from day 7 after PAB surgery.

4.4. Assessment of Right Ventricular Structure and Function

Transthoracic echocardiography was performed under isoflurane anesthesia at baseline and one day before final hemodynamic measurements, as previously described [4]. Briefly, mice were anesthetized using isoflurane (1.5% v/v) and taped to a controlled warming platform in a supine position. The core temperature, measured via rectal probe, was maintained at 37 °C. Echocardiography examination was performed in spontaneously breathing mice using Vevo 770 imaging system equipped with a 40-MHz linear array transducer (VisualSonics, Toronto Canada). Parameters for RV remodeling included RV internal diameter (RVID) and RV wall thickness (RVWT). The RVWT and the RVID were measured in the right parasternal long-axis view. For assessment of the RV performance, TAPSE was measured from the apical four-chamber view. Images were then analyzed off-line (VevoLab, VisualSonics) by a single observer blinded to the respective treatments of mice.

4.5. Hemodynamic Measurements

In vivo hemodynamic assessment was performed under isoflurane anesthesia three weeks after PAB surgery, as previously described [10]. Briefly, mice were anesthetized using isoflurane (1.5% v/v) and placed on controlled heating table and the core temperature, measured via rectal probe, was maintained at 37 °C. Hemodynamic measurements were performed using a high fidelity 1.4 F micromanometer catheter (Millar Instruments, Houston, TX, USA). The right jugular vein was used for catheterization of the right ventricle to measure RVSP. SAP was measured by catheterizing the right carotid artery. Data were collected and analyzed with the PowerLab data acquisition system (MPVS-Ultra Single Segment Foundation system, AD instruments, Spechbach, Germany) and Labchart 7 software.

4.6. Sample Processing and Histology

Hearts were harvested immediately following hemodynamic assessment. The right ventricle was separated from the left ventricle and septum (LV + S). Then, the right ventricle, left ventricle and septum were patted dry and weighed. The RV hypertrophy was evaluated using the ratio of the RV mass to tibia length. Afterwards, the RV tissue was snap-frozen in liquid nitrogen, and stored at −80 °C until further analysis. For histological analyses, freshly dissected RV tissue was fixed in 4% paraformaldehyde overnight, then dehydrated and embedded in paraffin and sectioned at a thickness of 3 µm. RV sections were stained with FITC conjugated wheat germ agglutinin to determine cardiomyocyte size, with picrosirius red to determine fibrosis, as previously described [10]. To assess the degree of fibrosis, the whole sections were imaged with an objective lens magnification at ×40, and the images from at least 100 fields for each heart were analyzed. The fibrosis fraction was obtained by calculating the ratio of picrosirius red stained connective tissue area (stained red) to total myocardial area (stained yellow) using Leica Qwin V3 computer-assisted image analysis software and macro program “Collagen” (Leica Microsystem, Wetzlar, Germany). Cardiomyocyte size was assessed on WGA-stained sections using ImageJ software (National Institutes of Health, Bethesda, ML, USA). Cross-sectional cardiomyocyte area was determined by manually tracing the outline of round to cuboidal-shaped cells. More than 100 randomly chosen cardiomyocytes in each independent RV were analyzed to measure cross-sectional cardiomyocyte area. Mast cell density and activity was quantified using toluidine blue staining, as previously described [10]. Briefly, mast cell density was quantified by counting the number of toluidine blue-positive cells from each entire RV longitudinal sections (Leica QWin). The mast cell density was expressed as a number of mast cells per mm2. Degranulated mast cells were identified as cells, in which granules are substantially reduced by 70–90% [11]. The activity of mast cells was expressed as percentage of degranulated to total amount of mast cells.

4.7. Quantitative RT-PCR

RNA was extracted from frozen RV tissue samples using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and reversely transcribed to cDNA. Real-time PCR quantification of atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), collagen-1 (Col1), collagen-3 (Col3), matrix metalloproteinase (MMP)-2, MMP9, MMP12, tissue inhibitors of metalloproteinase (TIMP)-1, TIMP2, tumor necrosis factor α (TNF-α), interleukin-6 (IL-6), and porphobilinogen deaminase (PBGD, endogenous control) gene expression was performed with sequence-specific primers and the iQ SYBR Green Supermix (Bio-Rad) kit, as previously described [10]. The primers used for real-time quantitative PCR are presented in Table A1. Calculation of ΔCt values was performed by subtracting the Ct values of the target gene from the endogenous control [ΔCt = Ct (reference gene) − Ct (target gene)]. Results are presented as fold induction of target gene transcripts, which was calculated according to the 2ΔΔCt formula.
Table A1

Sequence of the primers used in quantitative real-time PCR reactions.

GeneTitle 2
ANPForward Primer: TCTGCCCTCTTGAAAAGCAAReverse Primer: TTCGGTACCGGAAGCTGTT
BNPForward Primer: GAACGTGCTGTCCCAGATGAReverse Primer: TCCAGGAGCTTCTGCATCTT
Col1A1Forward Primer: GACGGGAGGGCGAGTGCTGTReverse Primer: ACGGGTCCCCTTGGGCCTTG
Col3A1Forward Primer: AAAGGGTGAAATGGGTCCCAGReverse Primer: TCACCTGAAGGACCTCGAGT
MMP2Forward Primer: TCCTCGTGGCAGCCCATGAGTReverse Primer: CATCGGGGGAGGGCCCATAGAG
MMP9Forward Primer: GATAGGCCGTGGGAGGTATAGReverse Primer: CACTGGGCTTAGATCATTCCA
MMP12Forward Primer: TTCAGTCCCTCTATGGAGCCCCAGTReverse Primer: GTGGCTGGACTCCCAGGAAGCT
TIMP1Forward Primer: GTCTGTGGGTGGGGTGGGGCReverse Primer: GGCTCCTAGAGACACACCAGAGCAGA
TIMP2Forward Primer: GGCTGTGAGTGCAGGATCACTReverse Primer: GTGCCCATTGATGCTCTTCT
IL6Forward Primer: CCTCTCTGCAGGAGACTTCCATCCAReverse Primer: AGCCTCCGACTTGTGAGGTGGT
TNF-αForward Primer: TACTGAACTTCGGGGTGATTGGTCCReverse Primer: CAGCCTTGTCCCTTGAAGAGAACC
PBGDForward Primer: AGAAGAGCCTGTTTACCAAGGAGReverse Primer: TTTCTCTGTAGCTGAGCCACTCT

4.8. Statistical Analysis

Data are expressed as mean ± SEM. All statistics were performed using GraphPad Prism software version 7.00 for Windows (GraphPad Software Inc., San Diego, CA, USA). Group data were compared using one-way ANOVA with Dunnett’s or Tukey’s post-hoc multiple comparisons tests or two-way ANOVA and Tukey’s post-hoc multiple-comparisons test for between-group differences. Differences were considered statistically significant when p values were < 0.05.
  38 in total

Review 1.  Cardiac mast cells: the centrepiece in adverse myocardial remodelling.

Authors:  Scott P Levick; Giselle C Meléndez; Eric Plante; Jennifer L McLarty; Gregory L Brower; Joseph S Janicki
Journal:  Cardiovasc Res       Date:  2010-08-24       Impact factor: 10.787

Review 2.  Organ and tissue fibrosis: Molecular signals, cellular mechanisms and translational implications.

Authors:  Ralf Weiskirchen; Sabine Weiskirchen; Frank Tacke
Journal:  Mol Aspects Med       Date:  2018-06-30

Review 3.  Getting to the heart of the matter: new insights into cardiac fibrosis.

Authors:  Andrew Leask
Journal:  Circ Res       Date:  2015-03-27       Impact factor: 17.367

4.  Corin-deficient W-sh mice poorly tolerate increased cardiac afterload.

Authors:  Cadie L Buckley; Alexander J Stokes
Journal:  Regul Pept       Date:  2011-09-06

5.  Mast cells promote lung vascular remodelling in pulmonary hypertension.

Authors:  J Hoffmann; J Yin; M Kukucka; N Yin; I Saarikko; A Sterner-Kock; H Fujii; H Leong-Poi; H Kuppe; R T Schermuly; W M Kuebler
Journal:  Eur Respir J       Date:  2010-12-09       Impact factor: 16.671

Review 6.  Molecular Mechanisms of Right Ventricular Failure.

Authors:  Sushma Reddy; Daniel Bernstein
Journal:  Circulation       Date:  2015-11-03       Impact factor: 29.690

7.  Involvement of mast cells in monocrotaline-induced pulmonary hypertension in rats.

Authors:  Bhola K Dahal; Djuro Kosanovic; Christina Kaulen; Teodora Cornitescu; Rajkumar Savai; Julia Hoffmann; Irwin Reiss; Hossein A Ghofrani; Norbert Weissmann; Wolfgang M Kuebler; Werner Seeger; Friedrich Grimminger; Ralph T Schermuly
Journal:  Respir Res       Date:  2011-05-02

8.  Evidence for a role of mast cells in the evolution to congestive heart failure.

Authors:  Masatake Hara; Koh Ono; Myung-Woo Hwang; Atsushi Iwasaki; Masaharu Okada; Kazuki Nakatani; Shigetake Sasayama; Akira Matsumori
Journal:  J Exp Med       Date:  2002-02-04       Impact factor: 14.307

9.  The cardiac repair benefits of inflammation do not persist: evidence from mast cell implantation.

Authors:  Zhengbo Shao; Mansoreh Nazari; Lily Guo; Shu-Hong Li; Jie Sun; Shi-Ming Liu; Hui-Ping Yuan; Richard D Weisel; Ren-Ke Li
Journal:  J Cell Mol Med       Date:  2015-10-16       Impact factor: 5.310

Review 10.  Mast Cells: Key Contributors to Cardiac Fibrosis.

Authors:  Scott P Levick; Alexander Widiapradja
Journal:  Int J Mol Sci       Date:  2018-01-12       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.