Literature DB >> 33227907

Absence of mgrB Alleviates Negative Growth Effects of Colistin Resistance in Enterobacter cloacae.

Jessie E Wozniak1,2,3, Aroon T Chande4,5,6,7, Eileen M Burd2,3, Victor I Band1,2,3, Sarah W Satola2,3, Monica M Farley2,3,8, Jesse T Jacob2,3, I King Jordan5,9, David S Weiss1,2,3,8.   

Abstract

Colistin is an important last-line antibiotic to treat highly resistant Enterobacter infections. Resistance to colistin has emerged among clinical isolates but has been associated with a significant growth defect. Here, we describe a clinical Enterobacter isolate with a deletion of mgrB, a regulator of colistin resistance, leading to high-level resistance in the absence of a growth defect. The identification of a path to resistance unrestrained by growth defects suggests colistin resistance could become more common in Enterobacter.

Entities:  

Keywords:  CRE; Enterobacter; colistin

Year:  2020        PMID: 33227907      PMCID: PMC7699182          DOI: 10.3390/antibiotics9110825

Source DB:  PubMed          Journal:  Antibiotics (Basel)        ISSN: 2079-6382


1. Introduction

Antibiotic resistance is an impending crisis that threatens advancements of modern medicine including transplants, cancer therapy, and common surgical procedures such as joint replacements. Recent reports estimate that 2.8 million people are diagnosed with an antibiotic-resistant infection each year in the United States, leading to between 35,000 and 160,000 deaths [1,2]. Carbapenem-resistant Enterobacterales (CRE) including Enterobacter, Klebsiella, and Escherichia spp. are associated with a mortality rate of up to 50% [3]. These bacterial infections are only susceptible to a handful of “last line” drugs such as colistin. Unfortunately, resistance to colistin is increasingly observed. A common mechanism of colistin resistance in Enterobacterales involves chromosomal mutations in the two-component system (TCS) PhoPQ or in genes in its regulon. PhoQ is a sensor kinase that responds to polymyxin antibiotics including colistin, as well as cationic antimicrobial peptides and environmental magnesium and calcium [4,5]. When activated, PhoQ phosphorylates its response regulator, PhoP. Phosphorylated PhoP is a transcriptional regulator with a broad regulon of hundreds of genes, which includes its self-regulation of the phoPQ operon [6]. An additional level of regulation of the PhoPQ system is mediated by the inner membrane protein and negative regulator, MgrB [4,7]. The deletion of mgrB results in an upregulation of phoPQ transcription and the overexpression of mgrB decreases phoPQ transcription, regardless of magnesium concentration [7]. The mechanism(s) by which MgrB regulates PhoPQ is not clear, but the protein may directly interact with PhoQ in the inner membrane [7]. PhoPQ regulates biosynthetic operons involved in the modification of the lipid A portion of lipopolysaccharide (LPS), the major structural component of the Gram-negative outer membrane. PhoPQ activation leads to the addition of cationic sugars to lipid A, which increase the charge of the outer membrane. In Enterobacter cloacae, PhoPQ is required for the addition of positively charged 4-amino-4-deoxy-L-arabinose (L-Ara4N) to lipid A, mediated by arnBCADTEF [8,9]. This increased positive charge leads to the electrostatic repulsion of colistin, which is also cationic, and results in bacterial resistance. Lipid A modifications occur in Enterobacterales and numerous other bacteria. In Pseudomonas aeruginosa, activating point mutations in PhoPQ and the PmrAB TCS are implicated in colistin resistance [10]. Although pmrAB are encoded in Enterobacter cloacae, these genes were not found to be involved in colistin resistance [9]. The roles of PhoPQ and PmrAB in lipid A modification and resistance to cationic antimicrobial peptides have been extensively reviewed elsewhere [6,10]. Previous studies indicated that colistin resistance is often associated with a reduced growth rate (a biological fitness cost) [11,12] and that in the absence of colistin, these mutations can revert and lead to the loss of resistance [13,14]. Fitness costs associated with colistin resistance (by multiple mechanisms) have been well documented in the Enterobacterales species Escherichia coli and Klebsiella pneumoniae, as well as in P. aeruginosa and Acinetobacter baumannii [15,16,17]. In particular, mutations in PhoPQ that lead to constitutive lipid A modification and colistin resistance exert a fitness cost and are reversible in the absence of colistin [13]. Additionally, mutations in pmrAB are associated with costly and reversible colistin resistance in A. baumannii [14]. In contrast, the inactivation of mgrB is a known mechanism of fitness cost-free colistin resistance in K. pneumoniae, although the reason it does not exert a fitness cost is unknown [16]. Mutations within mgrB leading to colistin resistance have very recently been described in Enterobacter species, but the effect these mutations have on the growth rate has not been interrogated [18,19]. This study details a colistin-resistant Enterobacter cloacae clinical isolate lacking mgrB and reveals that this path to resistance occurs without the characteristic negative effect on growth.

2. Results

We identified a colistin-resistant Enterobacter cloacae clinical isolate, Mu471, collected from the Georgia Emerging Infections Program’s Multi-site Gram-negative Surveillance Initiative (Figure 1A) [20]. Bioinformatic analysis revealed an approximately 4 kb region absent from the Mu471 chromosome in comparison to strain ATCC13047 [21], a close genetic relative to Mu471 in the NCBI database. Average nucleotide identity (ANI) between ATCC13047 and Mu471 and between Mu471 and Enterobacter cloacae DSM 30054 was >98%, confirming Mu471 to be E. cloacae. Interestingly, among the genes encoded in this 4 kb region was mgrB, a negative regulator of PhoPQ (Figure S1). To determine if the absence of mgrB was responsible for colistin resistance in Mu471, we introduced a plasmid (pBAV1K-T5-gfp) encoding mgrB from ATCC13047 into this strain, creating strain Mu471 pmgrB [21,22]. Colistin susceptibility testing was performed by Etest (bioMérieux, Marcy-l’Étoile, France) (Figure 1A) and broth microdilution (BMD; Table S1) [8]. Indeed, the expression of mgrB in Mu471 pmgrB led to colistin susceptibility (Figure 1B), indicating that the loss of mgrB was responsible for the colistin resistance of the parental strain (Figure 1A). Importantly, there was no difference in the growth curve of Mu471 pBAV (empty vector) and Mu471 pmgrB, highlighting that the colistin resistance of Mu471 did not have a negative effect on the growth rate (Figure 1C). To our knowledge, this is the first demonstration of colistin resistance in Enterobacter cloacae in the absence of an observable effect on growth.
Figure 1

Mu471 exhibits high-level colistin resistance in the absence of a growth delay. (A) Etest of Mu471. (B) Etest of Mu471 with pBAV PmgrB. Agar contains kanamycin (90 μg/mL) for plasmid retention. (C) Growth curves of Mu471 with pBAV PmgrB and empty vector control. Growth curves were performed in Mueller–Hinton broth with kanamycin (90 μg/mL) for plasmid retention.

Since the complementation of mgrB into a colistin-resistant strain that lacks this gene resulted in susceptibility, we then tested whether the deletion of this gene would lead to broad resistance in a strain with only a minor population of resistant cells (ATCC13047). The sensitivity of the Etest revealed that ATCC13047 is largely composed of susceptible cells, resulting in a large zone of clearing, however, a minor subpopulation of resistant cells was observed as well (Figure 2A). The deletion of mgrB from ATCC13047 (creating strain ATCC13047 ΔmgrB) led to a vast expansion of the resistant cells, and the strain exhibited no zone of clearing by Etest (Figure 2A,B). Due to the presence of resistant cells in both cases, BMD was not sensitive enough to detect the differences in susceptibility between ATCC13047 and ATCC13047 ΔmgrB (Table S1). Most importantly, in agreement with the results from Mu471 (Figure 1A,B), the deletion of mgrB and the subsequent increase in colistin resistant cells in ATCC13047 did not correspond to a decrease in growth rate (Figure 2C). Taken together, these results suggest that the absence of mgrB is a previously unobserved path to high-level colistin resistance without an observable impact on growth in E. cloacae.
Figure 2

Deletion of mgrB causes high-level colistin resistance in the absence of a growth delay. (A) Etest of ATCC13047. (B) Etest of ATCC13047ΔmgrB. (C) Growth curve of ATCC13047 and ATCC13047 ΔmgrB. Growth curves were performed in Mueller–Hinton broth.

3. Discussion

To our knowledge, this is the first identification of an Enterobacter cloacae clinical isolate (Mu471) that naturally lacks mgrB and subsequently displays high-level colistin resistance without an observable impact on growth rate. Introduction of mgrB into this strain reversed colistin resistance (Figure 1B). Additionally, when mgrB was deleted from a distinct strain, ATCC13047, this led to colistin resistance (Figure 2B). Supporting these findings are recent reports of colistin resistance via mgrB inactivation in Klebsiella pneumoniae, which were also without an impact on growth [16,23,24,25]. Reports of this mechanism of resistance in K. pneumoniae are increasing, including a comprehensive study from Greece which found mgrB inactivation to be the most common mechanism of colistin resistance and deemed this phenomenon an emerging epidemic [15,26].

4. Materials and Methods

4.1. Bacterial Growth Conditions

Strains used in this study included Mu471, ATCC13047, and ATCC13047 ΔmgrB (Table 1). Plasmids used in this study were pBAV (derived from pBAVIK-t5-GFP [22]) empty vector and pBAV mgrB (Table 2). pBAV mgrB was generated using the primers below with the mgrB coding region from ATCC13047 inserted to pBAVIK-t5-GFP between the EcoRI and PstI sites (Table 3). All liquid cultures were grown in Mueller–Hinton broth at 37 °C overnight unless otherwise stated. Etests were performed in accordance with bioMérieux on Mueller–Hinton agar plates with kanamycin (90 μg/mL) when plasmid retention was necessary. Broth microdilution was performed in accordance with the CLSI-EUCAST (Clinical and Laboratory Standards Institute and European Committee on Antimicrobial Susceptibility Testing) joint polymyxin breakpoints working group [27].
Table 1

Bacterial strains used in this study.

Strain NameSpeciesStrain Information
Mu471 Enterobacter cloacae Collected by MuGSI from the urine of a female patient from a GA hospital in 2013
ATCC13047 Enterobacter cloacae Purchased from ATCC
ATCC13047ΔmgrB Enterobacter cloacae Clean mgrB deletion generated as described below
Table 2

Plasmids used in this study.

Plasmid NameInformation
pBAV EVDerived from pBAVIK-t5-GFP
pBAV mgrBComplementation plasmid containing mgrB generated as described below
Table 3

Primers used in this study.

Primer NameSequence
pBAV mgrB Fccacaattatgatagaatttgacgtcgaattccattgcctctttatctttgttgtcatgc
pBAV mgrB Rgcggcggcatcgatcgggccctgaggcctgcagttcaccacctcaataaaaacacgc

4.2. Cloning

The construction of plasmid for complementation was performed as previously described in a pBAVIK-T5-GFP derivative [8]. Deletion of mgrB in ATCC13047 was also performed as previously described. Briefly, mgrB was replaced with a kanamycin resistance cassette (KanFRT) by λ Red mutagenesis [28], resulting in ATCC13047 mgrB::KanFRT. A clean deletion strain was subsequently generated by the introduction of the vector pCP20 containing the FLP recombinase proteins, resulting in strain ATCC13047 ΔmgrB [29]. Mutations were confirmed by PCR.

4.3. Growth Curves

Bacterial growth was measured by optical density (OD600) using a plate reader (Biotek Synergy MX plate reader (Applied Biosystems)). Bacteria were grown at 37 °C shaking at 220 rpm for 24 h as previously described [30]. Bacteria were grown in Mueller–Hinton broth with kanamycin (90 μg/mL) for plasmid retention when necessary.

4.4. Bioinformatics

The integrated genome visualization of a read to genome mapping using ATCC13047 as a reference sequence (NCBI Reference Sequence: NC_014121.1) was performed. (Mu471 sequence runs: SRR4035130). Bwa version 0.7.17 (r1188), https://github.com/lh3/bwa, was used for mapping. Visualization was done with samplot version 1.0.14, https://github.com/jbelyeu/samplot, and edited in Illustrator. Average Nucleotide Identity (ANI) was calculated and Mu471 has an ANI value of >98% compared to ATCC13047, and >98% compared to E. cloacae strain DSM 30054. >9 ANI was performed using mummer v3 [31].

5. Conclusions

Multiple studies demonstrate that the cost of resistance to colistin can be so great that the reversal of this phenotype occurs in the absence of the antibiotic. In contrast, the evolution of colistin resistance without an impact on growth may lead to more rapid increases in the frequency of colistin resistant isolates, especially if colistin usage increases in the clinic.
  29 in total

1.  Inactivation of mgrB gene regulator and resistance to colistin is becoming endemic in carbapenem-resistant Klebsiella pneumoniae in Greece: A nationwide study from 2014 to 2017.

Authors:  Mouna Hamel; Stylianos Chatzipanagiotou; Linda Hadjadj; Efthimia Petinaki; Sophia Papagianni; Nikoletta Charalampaki; Sophia Tsiplakou; Vassiliki Papaioannou; Nikoletta Skarmoutsou; Iris Spiliopoulou; Myrto Christofidou; Nikolaos Papamichalopoulos; Tilemachos Skalidis; Nicholaos Legakis; Kimon Fountoulis; Efstathia Perivolioti; Heleni Kraniotaki; Maria Bournia; Anastasios Ioannidis; Alexandra Baron Sophie; Jean-Marc Rolain
Journal:  Int J Antimicrob Agents       Date:  2020-03-01       Impact factor: 5.283

2.  MgrB Inactivation Is Responsible for Acquired Resistance to Colistin in Enterobacter hormaechei subsp. steigerwaltii.

Authors:  Amel Mhaya; Dominique Bégu; Slim Tounsi; Corinne Arpin
Journal:  Antimicrob Agents Chemother       Date:  2020-05-21       Impact factor: 5.191

3.  Complete genome sequence of Enterobacter cloacae subsp. cloacae type strain ATCC 13047.

Authors:  Yan Ren; Yi Ren; Zhemin Zhou; Xi Guo; Yayue Li; Lu Feng; Lei Wang
Journal:  J Bacteriol       Date:  2010-03-05       Impact factor: 3.490

Review 4.  The Epidemiology of Carbapenem-Resistant Enterobacteriaceae: The Impact and Evolution of a Global Menace.

Authors:  Latania K Logan; Robert A Weinstein
Journal:  J Infect Dis       Date:  2017-02-15       Impact factor: 5.226

5.  Polymyxin resistance caused by mgrB inactivation is not associated with significant biological cost in Klebsiella pneumoniae.

Authors:  Antonio Cannatelli; Alfonso Santos-Lopez; Tommaso Giani; Bruno Gonzalez-Zorn; Gian Maria Rossolini
Journal:  Antimicrob Agents Chemother       Date:  2015-02-17       Impact factor: 5.191

6.  Colistin heteroresistance in Enterobacter cloacae is regulated by PhoPQ-dependent 4-amino-4-deoxy-l-arabinose addition to lipid A.

Authors:  Katie N Kang; Dustin R Klein; Misha I Kazi; François Guérin; Vincent Cattoir; Jennifer S Brodbelt; Joseph M Boll
Journal:  Mol Microbiol       Date:  2019-04-10       Impact factor: 3.501

7.  Rational design of a plasmid origin that replicates efficiently in both gram-positive and gram-negative bacteria.

Authors:  Anton V Bryksin; Ichiro Matsumura
Journal:  PLoS One       Date:  2010-10-08       Impact factor: 3.240

8.  mcr-1 Gene Has No Effect on Colistin Resistance When It Coexists with Inactivated mgrB Gene in Klebsiella pneumoniae.

Authors:  Huichuan Zhang; Dongdong Zhao; Qiucheng Shi; Jingjing Quan; Xi Li; Yunsong Yu
Journal:  Microb Drug Resist       Date:  2018-05-16       Impact factor: 3.431

9.  Preservation of Acquired Colistin Resistance in Gram-Negative Bacteria.

Authors:  Ji-Young Lee; Myung-Jin Choi; Hyeon Jin Choi; Kwan Soo Ko
Journal:  Antimicrob Agents Chemother       Date:  2015-10-12       Impact factor: 5.191

10.  The mgrB gene as a key target for acquired resistance to colistin in Klebsiella pneumoniae.

Authors:  Laurent Poirel; Aurélie Jayol; Séverine Bontron; Maria-Virginia Villegas; Melda Ozdamar; Salih Türkoglu; Patrice Nordmann
Journal:  J Antimicrob Chemother       Date:  2014-09-03       Impact factor: 5.790

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.