MAGE-A3 is a prognostic biomarker for poor clinical outcome in cutaneous squamous cell carcinoma with perineural invasion via modulation of cell proliferation.

Perineural invasion is a pathologic process of neoplastic dissemination along and invading into the nerves. Perineural invasion is associated with aggressive disease and a greater likelihood of poor outcomes. In this study, 3 of 9 patients with cutaneous squamous cell carcinoma and perineural invasion exhibited poor clinical outcomes. Tumors from these patients expressed high levels of MAGE-A3, a cancer testis antigen that may contribute to key processes of tumor development. In addition to perineural invasion, the tumors exhibited poor differentiation and deep invasion and were subsequently classified as Brigham and Women's Hospital tumor stage 3. Cyclin E, A and B mRNA levels were increased in these tumors compared with normal skin tissues (102.93±15.03 vs. 27.15±4.59, 36.83±19.41 vs. 11.59±5.83, 343.77±86.49 vs. 95.65±29.25, respectively; p<0.05). A431 cutaneous squamous cell carcinoma cells pretreated with MAGE-A3 antibody exhibited a decreased percentage S-phase cells (14.13±2.8% vs. 33.97±1.1%; p<0.05) and reduced closure in scratch assays (43.88±5.49% vs. 61.17±3.97%; p = 0.0058). In a syngeneic animal model of squamous cell carcinoma, immunoblots revealed overexpression of MAGE-A3 and cyclin E, A, and B protein in tumors at 6 weeks. However, knockout of MAGE-A3 expression caused a reduction in tumor growth (mean tumor volume 155.3 mm3 vs. 3.2 mm3) compared with parental cells. These results suggest that MAGE-A3 is a key mediator in cancer progression. Moreover, elevated collagen XI and matrix metalloproteases 3, 10, 11, and 13 mRNA levels were observed in poorly differentiated cutaneous squamous cell carcinoma with perineural invasion compared with normal skin tissue (1132.56±882.7 vs. 107.62±183.62, 1118.15±1109.49 vs. 9.5±5, 2603.87±2385.26 vs. 5.29±3, 957.95±627.14 vs. 400.42±967.66, 1149.13±832.18 vs. 19.41±35.62, respectively; p<0.05). In summary, this study highlights the potential prognostic value of MAGE-A3 in clinical outcomes of cutaneous squamous cell carcinoma patients.

Introduction

Cutaneous squamous cell carcinoma (cSCC) is the second most common human cancer responsible for approximately 10,000 deaths in the United States each year primarily due to complications from overwhelming tumor burden after nodal metastasis [1]. Perineural invasion (PNI) in cSCC is associated with aggressive disease and a greater likelihood of nodal metastasis with rates of 10% to 50% and subsequent disease-specific death. The reported incidence rates of PNI in cSCC range from 2.5% to 14% since most patients with cSCC and PNI present with no clinical symptoms and no radiologic evidence of PNI.

We previously demonstrated that expression of MAGE-A3, a cancer testis antigen (CTA), in cSCC is associated with advanced tumor stage and poor prognosis [2]. Cancer testis antigens (CTAs) are detected in many solid tumors as well as normal testis and placental tissues. CTAs contribute to key processes of tumor development, including stimulation of oncogenic pathways, such as cell proliferation, angiogenesis, and metastasis, and inhibition of tumor suppressor pathways [3]. Many studies have suggested that CTAs may represent valuable targets for the development of anti-cancer therapies with limited side effects [3-5]. Melanoma-associated genes (MAGEs) are CTAs expressed in various malignancies and have been widely studied as prognostic biomarkers [6-9]. Expression of the CTA MAGE-A3 correlates with aggressive clinical progression and drug resistance in variety of carcinomas, such as non-small cell lung carcinoma, diffuse large B-cell lymphoma, and gastric cancer [10-12]. MAGE-A3 expression is associated with enhanced cell proliferation and mediates fibronectin-controlled cancer progression and metastasis [12, 13]. Other factors, including cyclin proteins, may contribute to metastasis. Cyclin proteins partner with cyclin-dependent kinases (CDKs) to tightly control proliferation by regulating progression into G0/G1, S, G2 and M phases of the cell cycle. Given that altered cell cycle activity is commonly observed in cancer cells, regulatory proteins, such as cyclin D and E and CDKs, have been studied as biomarkers of cancer progression and targets of cancer therapy [14-18].

Herein, we studied a cohort of high risk cSCC patients and found that PNI cSCC was associated with increased expression of MAGE-A3 and cyclins E, A and B. We also found that elevated mRNA levels of collagen XI and matrix metalloproteases 3, 10, 11, and 13 were observed in poorly differentiated cutaneous squamous cell carcinoma with PNI.

Materials and methods

All human studies were reviewed and approved by the institutional review board at NYU Langone Medical Center. Written informed consent was obtained for all patients before their participation, and the study was performed with strict adherence to the Declaration of Helsinki Principles. Human Subjects protocol: IRB protocol 16–00122.

Animal studies described were reviewed and approved by the Institutional Animal Care and Use Committee at NYU Langone Medical Center and were conducted according to the requirements established by the American Association for Accreditation of Laboratory Animal Care. All procedures were approved by the Institutional Animal Care and Use Committee before the initiation of any studies. Animal Protocol number: IA16-00510.

Patients and samples

IRB approval at NYU Langone Medical Center was acquired prior to the study (IRB protocol 16–00122). Surgical discard that would otherwise be disposed of as medical waste was obtained from a total of 24 patients who had no history of organ transplants and presented for dermatologic evaluation of primary cSCC at NYU Langone Medical Center. Participation involved the use of surgical discard and correlation with clinical characteristics of the tumor. Participation was voluntary. Among the participants, nine patients with primary cSCC who revealed PNI in their pathological reports were chosen for follow-up of their clinical outcomes, and their tumor specimens were analyzed for further investigation. Demographic information on these patients is reported in S1 Table. Other molecular characteristics of these patient tumors were described in another study [19].

All cSCC samples were selected from sun-exposed skin areas and obtained from debulking during Mohs micrographic surgery. Normal specimens were collected from non-sun-exposed areas of healthy volunteers with no history of cancers and organ transplants. Archived formalin-fixed paraffin-embedded (FFPE) blocks were acquired as previously reported in separate studies assessing potential biomarkers in SCC [2]. Four consecutive 15-μm sections were selected from each FFPE block using a standard microtome (Leica Instruments). The microtome blade was replaced, and equipment was sterilized using 100% isopropanol and Terminator RNase remover (Denville) between blocks.

RNA extraction from FFPE

Total RNA was extracted from FFPE tissue samples using the Agencourt FormaPure kit (Beckman Coulter) per the manufacturer’s protocol. The final samples were suspended in 80 μl RNase/DNase-free water, and purity was measured using a NanoDrop Reader (NanoDrop 2000C, Thermo Fisher Scientific).

Nanostring analysis

Total RNA quality was assessed using the Agilent 2200 TapeStation Bioanalyzer. Total RNA samples were processed using a custom probe set via the nCounter Analysis System (NanoString Technologies) per the company’s protocol. The raw quantification that resulted from the nCounter System’s barcode analysis was normalized using the nSolver software (NanoString Technologies) with relation to housekeeping genes. Data obtained via the NanoString nCounter system were analyzed using NanoString nSolver software. MAGEA3 positivity is defined by a normalized NanoString value of greater than 20 as described in our previous study [2].

Cell lines and cell culture

A431 cells were obtained from American Type Culture Collection (ATCC CRL-1555; Manassas, VA) and grown in Dulbecco's modified Eagle's medium supplemented (DMEM) with 10% fetal bovine serum (FBS) (Gibco; Waltham, MA). All Pam 212 cell lines, including Pam 212 (gift from Dr. Stuart Yuspa, NIH, National Cancer Institute) [20], Pam 212 LY2 (gift from Dr. Carter Van Waes, National Institute on Deafness and Other Communication Disorders) [21], and the Pam 212 altered by CRISPR/Cas 9 were grown in DMEM with 10% FBS supplemented with 2 mM L-glutamine and 1 mM sodium pyruvate (Gibco), were grown in an incubator at 37°C for 48 hours before experiments. For cell collection, cells were washed once using 1X phosphate buffer saline (PBS; Gibco) and digested using 0.25% trypsin (Gibco), which was terminated following addition of serum containing media. All cell cultures were grown at 37°C in 5% CO2. Prior to use in experiments, all cells were routinely assessed for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Cat # LT07-418, Lonza).

Mice

All animals were handled in strict accordance with good animal practice as defined by the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals, and the Public Health Service (PHS) Policy on Humane Care and Use of Laboratory Animals. Six- to eight-week-old female BALB/c mice were purchased from Harlan Laboratories (Indianapolis) and maintained at the NYU Langone Skirball animal facility. Mice were maintained in ventilated cages and fed/watered ad libitum with experiments performed under an IACUC approved protocol (160103–01) as well as following institutional guidelines for the proper and humane use of animals in research. For tumor growth experiments, 5.0 x 106 Pam 212 or Pam 212 guide RNA (520 or 521) cells were injected intradermally with Matrigel under anesthesia to minimize pain and discomfort. After tumor implantation, mice were monitored thrice weekly for signs of pain or distress. Mice meeting any of the following criteria were immediately euthanized by CO2 euthanasia: ulcerated tumors, greater that 20% of weight loss, signs of difficulty breathing or appear moribund, difficulty moving freely in the cage, or tumor burden greater than 15% body weight. Tumor growth measured weekly by the caliper method. Tumor volume was calculated using the formula a 2 ×b/2, in which a is the short diameter of the tumor and b is the long diameter of the tumor. At the 6th week, mice were sacrificed by CO2 euthanasia, and tumors were extracted. All experiments were conducted as approved by the Institutional Animal Care and Use Committee (Study number IA16-00510).

Plasmids

To generate an inducible Cas9 construct for MAGE-A3 knockout, we employed the pBigTRE3Gr eCas9 vector to generate constructs which express MAGE-A3 gRNAs (U6-driven) together with a dox-inducible TRE3G EGFP-IRES-eCas9 cassette. Embedded in the same construct is a PGK Neomycin-IRES-rtTA3 cassette, which provides a 3rd generation reverse-Tetracycline Activator (rtTA3). To target MAGE-A3, ds-oligos harboring gRNA sequences (-3, -4, and -5) were cloned into BbsI opened eSpCas9 (Addgene #71814). MAGE-A3 gRNA expression cassettes were PCR-amplified with the CRISPR(-)XbaI (5’-GGTACCTCTAGAGCCATTTGTCTGC-3’)/hU6(+)NheI (5’- tttgctagcGAGGGCCTATTTCCCATGAT -3’) primer pair, and the purified NheI/XbaI fragment was cloned into either XbaI opened pBigTRE3Gr (MAGE-A3-5) or XbaI opened pBigTRE3Gr MAGE-A3-5 (MAGE-A3-3 and -4). This procedure generated constructs pBigTRE3Gr MAGE-A3-5/3 (guide RNA 520) and pBigTRE3Gr MAGE-A3-5/4 (guide RNA 521) with gRNAs for dual (1280) and (366) targeting (the numbers in parenthesis indicate the bp distance between the dual Cas9 target sites). The dual (366) targeting removes the splice-acceptor site of the coding exon, whereas the dual (1280) targeting removes the entire coding region of MAGE-A3 in a dox-dependent manner. The sequences of the targeting vectors are listed in Table 1.

Table 1

Sequences of the targeting vectors.

	Vector sequence
Cas9MAGE-A3(-)5	5’-aaacCTATCCTTTCTCCATCAGGCC-3’
Cas9MAGE-A3(+)5	5’-caccgGCCTGATGGAGAAAGGATAG-3’
Cas9MAGE-A3(-)4	5’- aaacACTTCATTTGTTGCACAATGC-3’
Cas9MAGE-A3(+)4	5’- caccgCATTGTGCAACAAATGAAGT-3’
Cas9MAGE-A3(-)3	5’- aaacGCTTTGCTGAATGTCATCATC-3’
Cas9MAGE-A3(+)3	5’- caccgATGATGACATTCAGCAAAGC-3’

Generation of cell lines

Pam 212 cells were seeded at a density of 8.0 x 105 cells per well into 24 well plates. After 24 hours, cells were transfected with CRISPR vectors 520 or 521 using lipofectamine 2000 reagent (Carlsbad, CA) according to the manufacturer’s protocol. Doxycycline (2 ug/mL) was added 24–48 hours post-transfection and the GFP positive cells were sorted using a BD Biosciences FACSAria Fusion flow cytometer. Then, 96-well serial dilution was performed using expanded GFP+ sorted cells followed by screening for MAGE-A3 knockout.

PCR validation of Pam 212 CRISPR cell lines

Complete genomic DNA of Pam 212 wild type, Pam 212 with guide RNA 520 (Guide 520) and Pam 212 with guide RNA 521 (Guide 521) was isolated separately by the Qiagen DNeasy Blood and Tissue kit (QIAGEN, Cat No. 69506) according to the manufacturer’s protocol. Afterwards, PCR was performed using Platinum Taq High Fidelity polymerase (Invitrogen, Carlsbad, CA) in a volume of 25 μl containing 1X Platinum Taq High Fidelity Buffer (MgCl2-free), 0.2 mM dNTPs, 1 U Ex Taq DNA polymerase, and 5 mol each of the aforementioned forward and reverse primers. A total of 500 ng extracted genomic DNA was added to the reaction mixture. The following thermal cycling profile was utilized: 98°C for 30 sec followed by 30 cycles of 98°C for 10 sec, 60°C for 90 sec and 72°C for 2 min. The last cycle was followed by a final extension step of 5 min at 72°C.

EDU assays

For EDU assays, A431 cells were seeded at 1.0 x 105 cells per well in 6-well plates and treated with MAGE-A3 antibody at a 1:500 dilution mixed with antibody transport solution (ATS), which contained PBS, 50% glycerol, 0.02% sodium azide PH 7.3 and 0.1% dimethylsulfoxide (DMSO). At 72 hours post-treatment, the Click-IT EDU assay was performed according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA). Flow cytometry was performed using BD Biosciences LSR II (BD Biosciences, San Jose, CA), and data were analyzed using FloJo2 software (BD Biosciences, San Jose, CA).

Scratch assays

A431 cells were seeded into 24-well plates at a density of 5 x 105 per well and grown to 90% confluence. A scratch was made in the cell monolayer using a 1-mL pipette tip 24 hours after incubation with 5% CO2 at 37°C. Afterwards, the cells were washed with warmed 1 X PBS and media replaced with or without MAGE-A3 antibody treatment, the mixture of MAGE-A3 antibody and ATS at 1:500 dilution as described above. Scratch closure was photographed at 0, 24, 48, and 72 hours. The percentage of closure was calculated using ImageJ software.

Immunoblot analysis and antibodies

For immunoblot analysis, cells were lysed in RIPA and whole cell lysates resolved by 10% SDS-PAGE and transferred to PVDF membrane. Immunoblots were probed using the following antibodies where specified: MAGE-A3 IgG1-kappa monoclonal antibody (Proteintech 60054-1-Ig), MAGE-A4 (Cell Signaling (E7O1U) XP Rabbit mAb #82491), p53 (Cell Signaling (1C12) Mouse mAb #2524), Actin IgG1-kappa monoclonal antibody (Thermo Fisher #MA5-11869), GAPDH (Cell Signaling 14C10) and cyclin antibodies (Cell Signaling: Cyclin A2 (BF683), Cyclin B1 (4138), Cyclin D1 (92G2), Cyclin D2 (D52F9), Cyclin D3 (DCS22), and Cyclin E1 (HE12)). Anti-mouse (Cell Signaling 7076s) and anti-rabbit (Cell Signaling 7074s) HRP-conjugated secondary antibodies were used for detection using HRP detection reagent (Thermo Scientific product # 1859698) and autoradiography film (Denville Scientific cat # E3012).

Immunohistochemistry

Briefly, FFPE sections were incubated for 1 hour at 60°C followed by online deparaffinization. Antigen retrieval was performed using protease-3 (Ventana Medical Systems) for 12 minutes. Endogenous peroxidase activity was blocked with hydrogen peroxide. Samples were incubated in indicated antibodies for 1 hour at 37°C followed by biotinylated, goat anti-rabbit (Vector Laboratories Cat# Ba-1000 Lot# ZA0324 RRID: AB_2313606) diluted 1:200 in Tris-BSA and incubated for 30 minutes at 37°C. This step was followed by the application streptavidin-horseradish-peroxidase conjugate. Antibodies were visualized with 3,3 diaminobenzidene and enhanced with copper sulfate. Slides were washed in distilled water, dehydrated and mounted with permanent media. Appropriate positive and negative controls were included with study samples.

Quantitative RT-PCR

For qRT-PCR analysis, cells were lysed in RTL buffer (Qiagen) supplemented with 1% BME prior to total RNA column purification (Qiagen RNEasy Mini Kit). CDNA generation and real-time PCR reactions were performed using the SuperScript III Platinum One-Step Quantitative RT-PCR kit with Rox by Invitrogen (Carlsbad, California). For MAGE-A3 transcript validation in CRISPR cell lines, Pam 212, Guide 520 and Guide 521 cells were lysed in RTL buffer (Qiagen) supplemented with 1% BME prior to total RNA column purification (Qiagen RNEasy Mini Kit) and DNase treatment (Ambion Turbo DNA Free kit) according to the manufacturers’ instructions. DNase-free RNA was reverse transcribed using SuperScript III (Invitrogen), and cDNA was analyzed by qPCR using Taqman Gene expression assay with primers specific for murine MAGE-A3, MAGE-A4, Cyclin D1, and GAPDH (Table 2). RT-PCR was performed using the Applied Biosystems Step-one Real Time PCR system (Foster City, CA).

Table 2

Primers for qRT-PCR.

	Forward	Reverse
Murine MAGE-A3	CAGAGCCTACCCTGAAAAGTATG	AGCATCTGTTCAAGATCCAGGT
Murine MAGE-A4	GTCTCTGGCATTGGCATGATAG	GCTTACTCTGAACATCAGTCAGC
Murine GAPDH	AGGTCGGTGTGAACGGATTTG	GGGGTCGTTGATGGCAACA
Murine CCND1	GCGTACCCTGACACCAATCTC	ACTTGAAGTAAGATACGGAGGGC

All gene sequences are listed in 5’ to 3’ order.

Statistical analysis

Fischer’s exact test was used to compare mRNA expression of genes of interest among different groups in the analysis of NanoString results. Statistical analysis of all RT-PCR and proliferation assay data was performed using GraphPad Prism version 7 (GraphPad Software, La Jolla, USA). One-way ANOVA followed by Tukey’s multiple comparison correction was performed. For all tests, p<0.05 was considered statistically significant.

Results

MAGE-A3 and cell cycle-associated cyclins are upregulated in human cSCC tumors exhibiting PNI

Tissue samples from 16 patients, including seven normal patients and nine patients with cSCC and PNI, were subject to RNA analysis using the Nanostring platform. MAGE-A3, MAGE-A4, cyclin D, cyclin E, cyclin A and cyclin B mRNA expression levels in tumor samples categorized by Brigham and Women’s Hospital Tumor Staging System and tumor differentiation are shown in Fig 1.

Fig 1

Expression of MAGE-A3, MAGE-A4 and cyclins mRNA in normal skin and cSCC tumors with PNI.

Expression levels of MAGE-A3, MAGE-A4, cyclin D1-3, cyclin E, cyclin A, cyclin B and p53 mRNA in normal skin tissues (n = 7), cSCC tumors with PNI and moderate differentiation (n = 6), and cSCC tumors with PNI and poor differentiation (n = 3) as assessed by Nanostring analysis. Group names are listed on the x-axis based on BWH tumor stage and tumor differentiation. Mod = moderate differentiation; Poor = poor differentiation; N = normal; T2 and T3 = BWH tumor stage. * and ** represent p<0.05.

Poorly differentiated cSCC with PNI exhibits the highest level of MAGE-A3 expression compared with moderately differentiated cSCC with PNI (924.74±653.82 vs. 16.62±6.815; p<0.0001). Similar expression trends are noted for MAGE-A4, but MAGE-A3 levels were significantly increased in poorly differentiated cSCC with PNI compared with MAGE-A4 (924.74±653.82 vs. 293.71±79.62; p = 0.0146). TP53 expression levels were similar in normal skin and BWH T2 and T3 cSCC tumor samples. Immunohistochemistry further confirms increased MAGE-A3 and MAGE-A4 expression in cSCC with PNI with poor differentiation compared with moderate differentiation (Fig 2).

Fig 2

Immunohistochemistry of MAGE-A3 and MAGE-A4 expression in normal skin tissue and moderately and poorly differentiated cSCC tumors.

Images in the upper row represent MAGE-A3 expression as assessed by immunohistochemistry, whereas images in the bottom row depict MAGE-A4 expression. Upregulated expression of MAGE-A3 and MAGE-A4 is noted in poorly differentiated cSCC with PNI. Scale bar in each image indicates 100 μm.

Given that cSCC tumors with PNI are associated with enhanced proliferation as evidenced by tumor size > 2 cm at presentation, we assessed the levels of cell cycle-related genes in these tumors [22]. As shown in Fig 1, poorly differentiated cSCC with PNI exhibits no statistically significant difference in cyclin D1 levels compared with other groups, including normal epithelial tissues (p>0.05). In contrast, cyclin A, E, and B are expressed at higher levels in poorly differentiated cSCC with PNI compared with normal tissues (p = 0.0097, p = 0.01, and p = 0.0167, respectively). However, cyclin D2 and D3 levels in poorly differentiated cSCC with PNI were significantly increased compared with normal tissues (391.35±227.5 vs. 247.85±43.33 (p = 0.000945) and 149.66±109.46 vs. 111.35±14.69 (p = 0.000134), respectively). Cyclin A is the only cyclin that is significantly increased in cSCC tumors with PNI with moderate differentiation compared with poor differentiation (36.83±19.41 vs. 25.68±6.86; p = 0.0028).

Blocking MAGE-A3 modulates cell cycle progression in A431 cells

We evaluated the role of MAGE-A3 in cell cycle progression using a 5-ethynyl-2´-deoxyuridine (EDU) incorporation assay. A431 cSCC cells were treated with anti-MAGE-A3 antibody vs. control, and the effect on the percentage of S-phase cells was assessed (Fig 3A). Reduced levels of S-phase A431 cSCC cells were observed upon treatment with MAGE-A3 antibody compared with antibody transport solution (ATS) alone and untreated groups (14.13±2.8% vs. 24.33±3.19% vs. 33.97±1.1%, respectively; p < 0.05). Moreover, immunoblot analysis reveals increased p53 expression but no change in cyclin D1 expression in A431 cSCC cells pre-treated with MAGE-A3 antibody compared to controls (Fig 3B). We next assessed the impact of MAGE-A3 antibody treatment on A431 cell migration using scratch assays. The percentage closure in the group pre-treated with MAGE-A3 antibody vs. control was reduced after 72 hours compared with the untreated group (43.88±5.49% vs. 61.17±3.97% (p = 0.0058), respectively; Fig 3C and 3D).

Fig 3

MAGE-A3 antibody treatment reduces the number of S-phase A431 cells, impedes cell migration in scratch assays, and increases p53 expression by interacting with MAGE-A3 proteins.

(A) Percentage of A431 cells in S-phase in response to the following treatments: untreated, ATS alone, MAGE-A3 antibody + ATS, and untreated without EDU as a negative control. (B) Immunoblot of p53 and cyclin D1 expression in A431 cells subject to the following treatments: untreated, ATS alone and MAGE-A3 antibody. (C) Percentage closure in the different treatment groups over 72 hours. Actin antibody is used as an isotype control. The percentage closure in the group pre-treated with MAGE-A3 antibody was reduced after 72 hours compared with the untreated group (43.88±5.49% vs. 61.17±3.97% (p = 0.0058), respectively). (D) Light microscopy images of scratch closures between 0 and 72 hours in the noted treatment groups. Dotted lines highlight the wounded area. Scale bars indicate 100 μm. * and ** represent p<0.05.

Increased MAGE-A3 expression in an in vivo model of cSCC is associated with altered cyclin expression

Intradermal injection of Pam 212 cSCC cells into five syngeneic BALB/c mice resulted in locally invasive cSCC growth over six weeks (Fig 4A). Tumors exhibited significantly increased volume at week 6 compared with week 1 (1112.24± 34.6 mm3 vs. 29.7± 10.9 mm3; p = 0.02). MAGE-A3 and cyclin A2, B1 and E1 protein levels were increased in Pam 212 cSCC tumors compared with normal keratinocytes and Pam 212 cSCC cells grown in vitro, whereas cyclin D1 levels were reduced (Fig 4B). No significant differences in Cyclin D2 and D3 protein expression were noted as assessed by Western blot. In Fig 4C, significantly elevated MAGE-A3 and MAGE-A4 RNA transcript levels were also detected by qPCR in primary Pam 212 cSCC tumors compared to normal murine keratinocytes and Pam 212 cells in culture (77.4± 46.2 vs. 1± 0.1 vs. 2.62± 2.1; 90.4± 68.3 vs. 1± 0.1 vs. 1.86± 1.19, respectively; all p < 0.05). However, cyclin D1 levels were not significantly different (3.41± 0.12 vs. 1± 0.07 vs. 4.46± 0.32, p>0.05).

Fig 4

Pam 212 cells form cSCC tumors in Balb/c mice with concomitant increases in MAGE-A3 and cyclin expression.

(A) Pam 212 cell growth in a syngeneic tumor model in 5 Balb/c mice over 6 weeks. (B) Western blot of MAGE-A3, cyclin A2, B1, D1-3 and E1 in normal murine keratinocytes, Pam 212 cells grown in culture, and Pam 212 cells grown as tumors in Balb/c mice. (C) Fold increase in MAGE-A3, MAGE-A4 and cyclin D1 mRNA expression in in normal murine keratinocytes, Pam 212 cells grown in culture, and Pam 212 cells grown as tumors in Balb/c mice as determined by qPCR. Fold increase of expression in normal murine keratinocytes was set to 1 ± 0. * and ** represent p<0.05.

Knockout of MAGE-A3 expression reduces cSCC tumor growth

Knockout of MAGE-A3 expression in Guide 520 and 521 was confirmed by PCR, qPCR and Western blot (Fig 5A–5C). These MAGE-A3 knockout cells along with wild type Pam 212 cells were injected intradermally into BALB/c mice, and tumor growth was assessed over a 6-week period. The results showed that MAGE-A3 knockout reduced the growth of Pam 212 cells in a syngeneic model of SCC (Fig 5D and 5E). At the 6th week, the volumes of syngeneic tumors of Guide 520 and 521 were reduced to 4.8 ± 11.2 mm3 and 3.2 ± 5.3 mm3 compared to tumors generated from parental cells (155.3 ± 124.3 mm3). These tumors also exhibited reduced levels of cyclin B, D, and E (Fig 5F). Moreover, reduced proliferation in these tumors was also supported by reduced Ki67 staining (Fig 5G).

Fig 5

Knockout of MAGE-A3 expression in Pam 212 by CRISPR guide RNA 521 and 520 results in reduction of syngeneic tumor growth in Balb/c mice.

(A) Validation of MAGE-A3 gene disruption was assessed by PCR. (B) RNA knockout was confirmed by qRT-PCR. Fold increase of MAGE-A3 expression in wild type Pam 212 was set to 1 ± 0. Fold changes in MAGE-A3 expression in Guide 521 and 520 were 0.0049 ± 0.00198 and 0.000535 ± 0.000209, respectively. Error bars indicate standard deviations. (C) MAGE-A3 suppression in Guide 521 and 520 was confirmed by Western Blot. Pam 212.MAGE-A3 represents Pam 212.pLKO.3G.MAGE-A3 as a positive control. (D) Volumes changes of Pam 212, Guide 521, and Guide 520 tumors in Balb/c mice over 6 weeks (n = 3 per group). The experiment was conducted twice with a total of 18 mice. At the 6th week, the volumes of syngeneic tumors of Guide 520 and 521 were reduced to 4.8 ± 11.2 mm3 and 3.2 ± 5.3 mm3 compared to Pam 212 tumors (155.3 ± 124.3 mm3). (E) Images of tumors obtained from mice after 6 weeks of growth in Balb/c mice. NOTE: Guide 520 yielded total tumor regression in 2 mice, so these tumors are not displayed. (F) Immunohistochemistry analysis of cyclin B, cyclin D, and cyclin E expression in MAGE-A3 wild type (W.T.) and Guide 521 tumor tissue. Scale bars indicate 100 μm. (G) Immunohistochemical assessment of MAGEA3, Ki67, and CD3 expression in Pam 212, Guide 520 and Guide 521 cSCC tumor tissue. Scale bars indicate 100 μm. * and ** represent p<0.05.

Collagen and matrix metalloprotease genes are upregulated in human cSCC tumors exhibiting PNI

We also profiled the expression of collagens (Fig 6) and matrix metalloproteases (MMPs) of patients with primary cSCC and PNI (Fig 7) to assess the interaction between carcinoma and extracellular matrix (ECM). Collagen XI was the only collagen elevated in poorly differentiated PNI compared with other two groups (1132.56±882.7 vs. 197.6±261.24 vs. 107.62±183.62; p< 0.05). MMP3, 10, 11 and 13 expression was significantly increased in poorly differentiated cSCC tumors with PNI compared with moderately differentiated (p<0.05). However, MMP11 levels were not different compared with poorly differentiated cSCC tumors with PNI and normal skin tissue (p = 0.325).

Fig 6

Expression of collagens in normal skin and cSCC tumors with PNI.

Collagen and fibronectin mRNA levels in normal skin (n = 7), cSCC tumors with PNI and moderate differentiation (n = 6), and cSCC tumors with PNI and poor differentiation (n = 3) as assessed by Nanostring. Three groups were listed on x-axis based on BWH tumor stage and tumor differentiation. Mod = moderate differentiation; Poor = poor differentiation; N = normal; T2, T3 = BWH tumor stage. * and ** represent p<0.05. COL1A1 = collagen I alpha 1 chain; COL2A1 = collagen II alpha 1 chain; COL3A1 = collagen III alpha 1 chain; COL4A3 = collagen IV alpha 3 chain; COL5A5 = collagen V alpha 5 chain; COL6A6 = collagen VI alpha 6 chain; COL11A1 = collagen XI alpha 1 chain; FN1 = fibronectin.

Fig 7

Expression of MMPs in normal skin and cSCC tumors with PNI based on BWH tumor stage and tumor differentiation.

(A) The nSolver’s Heat Map Cluster Analysis of normalized MMP1, 3, 9, 10, 11 and 13 in all samples. (B) Comparison of mRNA expression of MMPs in the three groups, as noted on the x-axis, based on BWH tumor stage and tumor differentiation. Mod = moderate differentiation; Poor = poor differentiation; N = normal; T2, T3 = BWH tumor stage. * and ** represent p<0.05. MMP3, 10, 11 and 13 expression were significantly increased in poorly differentiated cSCC with PNI compared with moderately differentiated cSCC with PNI. However, MMP 11 levels were not different compared with poorly differentiated cSCC with PNI and normal skin tissues (p = 0.325).

Discussion

Numerous studies have demonstrated that SCC with PNI is correlated with poor clinical outcome and may benefit from adjuvant treatment post operatively due to increased incidence of recurrence and metastasis [23-26]. Historically, post-operative radiation therapy (PORT) was used for management of perineural SCC [27]; however, the use of PORT with or without a PD-1 inhibitor is being evaluated in a clinical trial (NCT03969004—Study of Adjuvant Cemiplimab Versus Placebo After Surgery and Radiation Therapy in Patients With High Risk Cutaneous Squamous Cell Carcinoma). In contrast, some studies reported no significant changes in outcomes for patients with SCC and PNI. [28, 29] In our study, 3 of 9 patients with cSCC with PNI had poor outcomes eventuating in metastasis and death from disease. On histological examination, the 3 poor outcome patients had BWH T3, poorly differentiated cSCC. In contrast, the other 6 patients had T2A or T2B cSCC with moderate differentiation. Interestingly, all three poor outcome patients exhibited significantly high levels of MAGE-A3 expression in their primary cSCC tumors, whereas the other 6 patients showed no to low MAGE-A3 expression. Thus, MAGE-A3 may be prognostic biomarker for poor outcomes in patients with cSCC with PNI.

MAGE-A4 expression also correlates with poor prognosis of various cancers, and this CTA has been studied as a potential biomarker [30-32]. MAGE-A3 and MAGE-A4 are generally expressed at similar levels. Brisam M. et al. reported that MAGE-A3 and MAGE-A4 along with -A1, -A5, -A9 and -A11 were significantly correlated with clinically advanced stages of disease based on the analysis of MAGE-A1 to -A12 expression in oral squamous cell carcinoma [33]. These authors also suggested that MAGE-A3 and MAGE-A4 could be used as prognostic markers to improve patient follow-up care. In our study, although MAGE-A4 is over-expressed in poorly differentiated stage 3 cSCC with PNI, the greater increase in MAGE-A3 expression makes MAGE-A3 a better biomarker (average 82- vs 37-fold increase, respectively, compared with normal skin).

Others have demonstrated that MAGE-A3 promotes proliferation and growth of cancer cells through interaction with the tumor suppressor gene p53 and enzyme E3 ubiquitin ligase [34-36]. In our study, p53 mRNA levels do not significantly differ among poorly differentiated cSCC with PNI, moderately differentiated cSCC with PNI and normal skin tissues (347.93±69.7 vs. 373.37±47.06 vs. 395.14±66.38; p > 0.05). This finding is consistent with previous studies given that MAGE-A3 is believed to inhibit p53 functions by blocking its interaction with chromatin and accelerating its denaturation and not at the transcription level [35, 36].

We investigated cyclin D, E, A, and B expression to determine any associations with MAGE-A3 expression in stage 3 poorly differentiated cSCC with PNI. Cyclin A, B and E expression was significantly increased compared with normal tissues, which is consistent with the fact that advanced staged tumors exhibit more rapid cell proliferation compared with normal epithelial cells. However, cyclin A is the only cyclin that exhibits a statistical difference between poorly differentiated and moderately differentiated cSCC with PNI (p = 0.0277). In contrast to other studies showing overexpression of cyclin D1 in SCC, we found no significant differences in cyclin D1 expression [37-39]. One possible explanation could be due to the fact that A431 and Pam 212 tumors potentially exhibit overexpression of different isoforms of cyclin D [40]. In our study, cyclin D2 and D3 but not D1 exhibited statistically increased levels in poorly differentiated stage 3 cSCC with PNI compared with normal epithelial tissues (p = 0.0009 and p = 0.0001, respectively). Cyclin D2 even exhibited significant increased expression between poorly differentiated and moderately differentiated cSCC with PNI (p = 0.006).

We postulated that MAGE-A3 might contribute to poor outcomes in patients with cSCC and PNI given its association with tumor proliferation. Prior studies have demonstrated the association of poor outcome with advanced T stage and poor differentiation. In our in vitro experiments with A431 cSCC cells, blockage of MAGE-A3 expression reduced the percentage of S-phase cells and reduced scratch closure after 72 hours. These findings are consistent with previous studies demonstrating that MAGE-A3 modulates cell proliferation [12, 41]. However, cyclin D1 protein levels did not differ among the untreated, ATS alone and pre-treated MAGE-A3 antibody groups. This finding indicates that MAGE-A3 did not modulate the cell cycle via cyclin D1 and might further support the analysis of insignificant changes in cyclin D1 expression in our human tumor samples.

MAGE-A3 protein is located in the endoplasmic reticulum [42]. DMSO can induce water pores in dipalmitoylphosphatidylcholine bilayers, subsequently increasing the permeability of cell membranes and facilitating the entry of antibodies into cells [43]. MAGE-A3 antibodies thus enter cells and interact with MAGE-A3 proteins in the endoplasmic reticulum. Doyle et al. reported that multiple MAGE family proteins are capable of binding E3 RING ubiquitin ligases to form MAGE-RING protein complexes [44]. These complexes promote degradation of p53 in the ubiquitin-protease system, and greater than 50 complexes have been identified [45]. MAGE-A3 proteins specifically interact with TRIM28 E3 RING ubiquitin ligase to form a stable MAGE-RING ligase complex [46, 47]. In addition, previous studies have reported that this complex also accelerates degradation of two important tumor suppressors, fructose-1,6-bisphosphatase (FBP1) and 5’ adenosine monophosphate-activated protein kinase (AMPK) [48, 49]. Altogether, MAGE-A3 downregulates apoptosis and drives tumorigenesis, cell cycle progression and metastasis. Based on these findings, we hypothesize that the decrease in the percentage of cells in S-phase and deceleration of cancer migration observed in our in vitro experiments might be attributed to the blockage of interactions between MAGE-A3 and TRIM E3 RING ubiquitin ligase and disruption of MAGE-RING ligase complex formation by MAGE-A3 antibodies. The upregulation of p53 expression in A431 cells pre-treated with MAGE-A3 antibodies shown in Fig 3B further supports our hypothesis.

To evaluate the role of MAGE-A3 in vivo, we injected Pam 212 murine cSCC cells intradermally into Balb/c mice and measured the expression of MAGE-A3 and cyclins. Six weeks post-injection, tumor volume increased, and MAGE-A3 and cyclin A2, B1 and E1 protein levels were elevated in syngeneic tumors compared to normal murine keratinocytes and Pam 212 cells grown in vitro. This result supports our hypothesis that MAGE-A3 expression is increased in proliferating tumors. We found that Pam 212 cells with MAGE-A3 knockout failed to grow in Balb/c mice, and total regression was observed in two cases. In addition, immunohistochemical analysis revealed down regulation of cyclin B, D and E expression in MAGE-A3 knockout tumors. This finding suggests that the reduction of MAGE-A3 expression leads to changes in cyclins and results in tumor regression.

Interestingly, our experiments also indicate that MAGE-A3 is more highly expressed in Pam 212 cells grown in vivo compared with those grown in vitro. We believe this upregulation observed is associated with ECM changes in mice. ECM plays an important role in cancer progression. Lu et al. demonstrated that tumors display desmoplasia, which can alter the organization and enhancing post-translational modifications of ECM proteins [50]. Others reported that cell-to-cell adhesive signaling in the ECM can alter tumor behavior [51-53]. Nanostring analysis of our human cSCC samples revealed no statistical difference in collagen I, II, III, IV, V and VI levels between poorly differentiated or moderately differentiated PNI-cSCC and normal skin tissues. However, levels of COL11A1, which encodes collagen XI alpha 1 chain, are significantly increased when cSCC advances from moderate to poor differentiation (1132.56±882.7 vs. 197.6±267.2; p = 0.014). Similar findings were also reported in the study of Li et al. in esophageal SCC patients; however, we did not find any changes in other collagens [54]. Increased collagen XI expression is associated with fibroblasts in various cancers, including lung and breast, and is considered as a potential biomarker for cancer invasiveness [55-57]. Sok J.C. et al. revealed that knockout of collagen XI alpha I gene in a head and neck SCC cell line results in significant reductions in cancer proliferation, invasion and migration [55].

In addition, fibronectin (FN), a large heterodimeric glycoprotein, is a well-studied ECM protein in cancer progression. Increased FN levels are associated with metastasis, proliferation and poor prognosis in various cancers [58-62]. Liu et al. further demonstrated that down regulation of FN increased MAGE-A3 expression, which further promoted cell migration and invasion of thyroid carcinoma in vitro and lung metastasis in vivo by inhibiting p53 functions [13]. However, we did not find any significant changes in FN1 expression between moderately and poorly differentiated cSCC tumors with PNI and normal skin tissues (3023.8±1996.4 vs. 1432±1487.9 vs. 1686.5±2135.4; p>0.05). A larger sample size may help further clarify the correlation among collagens, FN and tumor growth. On the other hand, MMPs have long been known to facilitate cancer progression, cell invasion and metastasis through degradation of the ECM [63-65]. In our study, MMP3, 10 and 13 mRNA expression in poorly differentiated cSCC with PNI is significantly increased compared with moderately differentiated cSCC with PNI and normal skin tissues (p<0.05). These changes indicate that the interactions between cSCC with PNI and ECM are greatly increased as the cancer progresses from moderate differentiation to poor differentiation.

In summary, we found that cSCC tumors with PNI tend to exhibit poor clinical outcomes in the context of increased MAGE-A3 expression, advanced tumor stage and poor differentiation. Both in vitro and in vivo models suggested that upregulation of MAGE-A3 promotes tumor progression via modulation of cyclin levels. Taken together, this study highlights the prognostic value of MAGE-A3 in patients with cSCC with PNI via acceleration of cell proliferation.

Clinical characteristics of patients with cSCC and PNI.

(DOCX)

Click here for additional data file.

Original images of blots and gels reported in the manuscript.

(PDF)

Click here for additional data file.

26 Feb 2020

PONE-D-19-34576

MAGE-A3 is a prognostic biomarker for poor clinical outcome in cutaneous squamous cell carcinoma with perineural invasion via modulation of cell proliferation

PLOS ONE

Dear Dr. Carucci,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Apr 11 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Yoshihiko Hirohashi, M. D., Ph. D.

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

Dear Dr. John A. Carucci,

As pointed out by reviewer's, please re-consider about specific concerns. Especially, what is the mechanisms that anti-MAGE-A3 antibody have functions on A431 cells. Is MAGE-A3 protein expressed on cell surface?

Sincerely yours,

Yoshihiko Hirohashi, M. D., Ph. D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. At this time, we request that you  please report additional details in your Methods section regarding animal care, as per our editorial guidelines:

(1) Please state the number of mice used in the study

(2) Please provide details of animal welfare (e.g., shelter, food, water, environmental enrichment)

(3) Please describe any steps taken to minimize animal suffering and distress, such as by administering anaesthesia

(4) Please include the method of euthanasia

(5) Please provide the formula used to calculate tumor volume

(6) Please describe the post-operative care received by the animals, including the frequency of monitoring and the criteria used to assess animal health and well-being.

Thank you for your attention to these requests.

3. Thank you for stating the following in the Competing Interests section:

Jean-Philippe Therrien and James Lee were employees and shareholders of GlaxoSmithKline while these studies were being performed.

Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests).  If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.

Please include your updated Competing Interests statement in your cover letter; we will change the online submission form on your behalf.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this paper, the authors examined the expression of MAGE-A3, cyclin proteins, collagens, and MMPs in cutaneous SCC (cSCC) with perineural invasion (PNI). They found that MAGE-A3 and some of cyclins, collagens, and MMPs were upregulated in poorly differentiated cSCC with PNI. Furthermore, they also investigated the role of MAGE-A3 in cancer progression using in vivo and in vitro models. Although this manuscript contains some interesting findings, there are several important issues that need to be improved before publication.

Major points:

1) Cutaneous SCC is the common cancer and is not rare. Thus, the authors should be able to collect more samples. The number of patients with cSCC with PNI (only 9 patients) is too small to reach a conclusion.

2) The authors must describe the details of the clinical characteristics of patients with cSCC with PNI.

3) The authors showed that not only MAGE-A3 but also MAGE-A4 mRNA expression was upregulated in poorly differentiated cSCC with PNI in Figure 1A. How about the expression of MAGE-A4 protein in tissue from the patients with cSCC with PNI? The authors should also examine the MAGE-A4 expression in tissue using immunohistochemistry.

4) What is the minimum percentage of MAGE-A3 positive tumor cells required to consider the sample MAGE-A3 positive?

5) Representative immunohistological futures of not only poorly and moderately differentiated cSCC but also healthy controls should be shown in Figure 1B.

6) In Figure 2, the authors treated A431 SCC cells with anti-MAGE-A3 antibody to explore the role of MAGE-A3 in cell cycle progression. What is the mechanism in this experiment? Does MAGE-A3 express on cell surface of A431 SCC cells? Furthermore, the authors compared A431 SCC cells treated with MAGE-A3 antibody with those treated with vehicle or untreated. However, A431 SCC cells treated with isotype control antibody should be used as a control group.

If the authors want to examine the role of MAGE-A3 in A431 SCC cells, it may be desirable to knockdown or knockout expression of MAGE-A3 using siRNA or CRISPR/Cas9.

7) In page 15, the authors described that the trend of increased MAGE-A3 expression in Pam 212 SCC tumors was confirmed by immunohistochemical staining. However, there are no immunohistological images.

8) In Figure 4, knockout of MAGE-A3 expression via CRISPR/Cas9 was confirmed by PCR and qPCR. However, the authors should also perform western blot analysis to prove knockout of MAGE-A3 protein.

Miner points:

1) Please describe the details of MAGE-A3 antibody such as company, clone name, and dilution rate in EDU assays and Immunohistochemistry of the materials and methods section (page 9 and 10).

Reviewer #2: In “MAGE-A3 is a prognostic biomarker for poor clinical outcome in cutaneous squamous cell carcinoma with perineural invasion via modulation of cell proliferation,” Chen et al., demonstrate the prognostic value of MAGE-A3 in clinical outcomes of patients with cutaneous squamous cell carcinoma with perineural invasion. They go on elucidate mechanisms by which MAGE-A3 can positively influence tumor migration and growth. Overall, the study makes the novel association between a cancer-associated gene and squamous cell carcinoma, a skin cancer with significant morbidity and mortality and few specific molecular targets. Further, the authors establish mechanisms by which this gene and protein product impacts cancer cell behavior.

SPECIFIC COMMENTS

Figure 2, Please report whether MAGE-A3 expressed in A431 cells in vitro by mRNA or protein.

Figure 2A, Please include results from IgG1 isotype control treatment if such reagent exists and if such experiments were performed. In the legend, “A341” should be “A431.” Further, please provide any historical data or cited literature indicating that the cellular localization of MAGE-A3 has access to antibody on the surface of cells.

Figure 2B, Please include statistical significance data on the graph.

Figure 2D, Please describe the use of the anti-p53 Western Blot antibody used in the methods

Figure 3A, Please include the number of mice used per cohort & how many experiments were conducted. Further, in the text, the description of the change in growth is reported without units (1112.24?...) – please include units. This is also the case later in the text – please include units numerical values throughout.

Figure 3B, Cyclin D2/D3 does not appear to be elevated in PAM212 tumors as text suggests. Quantification not provided. Please clarify this statement.

“The trend of increased MAGE-A3 expression in Pam 212 SCC tumors was further confirmed by immunohistochemical staining (Figure 3C)” on page 21 –while Figure 3C reports relative RNA expression. Please clarify this statement.

MTS proliferation is noted in the methods but not includes in the Figures. Please remove from the methods if this data is not to be included.

Figure 4B, Please include the statistical details in the graph

Figure 4C, Please report the number of mice per cohort & how many experiments were performed; Please include the statistical significance in the graph.

Figure 4D & 4E are appear to be transposed compared to what is described in the text on page 16.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

25 Sep 2020

Editor Comments

Major comments:

I. What is the mechanisms that anti-MAGE-A3 antibody have functions on A431 cells. Is MAGE-A3 protein expressed on cell surface?

We thank the editor for raising this important question. MAGE-A3 protein is localized to the endoplasmic reticulum. (Morishima, Nakanishi et al. J Biol Chem 2002 277(37): 34287-34294) Doyle et al discovered that multiple MAGE family proteins are capable of binding E3 RING ubiquitin ligases to form MAGE-RING protein complexes. (Doyle, Gao et al. Mol Cell 2010 39(6): 963-974) These complexes promote degradation of p53 in the ubiquitin-protease system, and more than 50 complexes have been identified. (Lee and Potts. J Mol Biol 2017 429(8): 1114-1142) MAGE-A3 protein specifically interacts with TRIM28 E3 RING ubiquitin ligase to form a stable MAGE-RING ligase complex. (Yang, O’Herrin et al. Cancer Res 2007 67(20): 9954-9962; Pineda and Potts. Autophagy 2015 11(5): 844-846) In addition, previous studies have found this complex also accelerates degradation of two important tumor suppressors, fructoses-1,6-bisphosphatase (FBP1) and 5’ adenosine monophosphate-activated protein kinases (AMPK). (Jin, Pan et al. Oncogenesis 2017 6(4): e312; Ye, Xie et al. Cell Physiol Biochem 2018 45(3): 1205-1218) Together, MAGE-A3 downregulates apoptosis and drives tumorigenesis, cell cycle progression and metastasis. Based on these findings, we hypothesize that the decrease in the percentage of cells in S-phase and deceleration of cancer migration observed in our in vitro experiments might be attributed to the blockage of interactions between MAGE-A3 and TRIM E3 RING ubiquitin ligase and disruption of MAGE-RING ligase complex formation by MAGE-A3 antibodies. The upregulation of p53 expression in A431 cells pre-treated with MAGE-A3 antibodies shown in Figure 3B further supports our hypothesis. (Page 24 Line 9 to Page 25 Line 3) We prepared an antibody transport solution (ATS) that contained PBS, 50% glycerol, 0.02% sodium azide (pH 7.3) and 0.1% dimethyl sulfoxide (DMSO) to assist MAGE-A3 antibodies to enter A431 cells.(Page 10 Line 18-20) DMSO can induce water pores in dipalmitoylphosphatidylcholine bilayers and cause cell membrane to become floppier, which increases permeability for the antibodies to enter cells. (Notman, Noro et al. J Am Chem Soc 128(43): 13982-13983) (Page 24 Line 9-11)

II. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files.

We thank the editor for this important reminder. The original uncropped and unadjusted images of all blot or gel results reported are included in the supporting file “S1_raw_images.pdf”.

Additional comments:

(1) Please state the number of mice used in the study

We thank the editor for this comment. PAM 212 was injected intradermally into 5 balb/c mice, and tumor growth and MAGE-A3 and cyclin expression were assessed. (Page 18 Line 12) In the in vivo MAGE-A3 KO tumor growth study, 3 mice were included in each group and the experiment was conducted twice for a total of 18 mice. (Page 19 Line 20)

(2) Please provide details of animal welfare (e.g., shelter, food, water, environmental enrichment)

We thank the editor for this suggestion. This information has been added to the Materials and Methods section. Mice were maintained in ventilated cages and fed/watered ad libitum with experiments carried out under an IACUC approved protocol (160103-01) as well as following institutional guidelines for the proper and humane use of animals in research. (Page 7 Line 14-17)

(3) Please describe any steps taken to minimize animal suffering and distress, such as by administering anaesthesia.

We thank the editor for this comment. This information has been added to the Materials and Methods section. For tumor growth experiments, 5.0 x 106 Pam 212 or Pam 212 guide RNA (520 or 521) cells were injected intradermally with Matrigel under anesthesia to minimize pain and discomfort. (Page 7 Line 17-19)

(4) Please include the method of euthanasia

We thank the editor for this comment. This information has been added to the Materials and Methods section. Mice were sacrificed by CO2 euthanasia. (Page 7 Line 21)

(5) Please provide the formula used to calculate tumor volume

We thank the editor for this comment. This information has been added to the Materials and Methods section. Tumor volume was calculated using the formula a 2 �b/2, in which a is the short diameter of the tumor and b is the long diameter of the tumor. (Page 8 Lines 2-4)

(6) Please describe the post-operative care received by the animals, including the frequency of monitoring and the criteria used to assess animal health and well-being.

We thank the editor for helping clarify our animal control protocols. This information has been added to the Materials and Methods section. After tumor implantation, mice were monitored thrice weekly for signs of pain or distress during the course of the experiment. Mice meeting any of the following criteria were immediately euthanized via by CO2 euthanasia: ulcerated tumors, mice that experience greater that 20% of weight loss, mice that show signs of difficulty breathing or appear moribund, mice that experience difficulties moving freely in the cage, or tumor burden greater than 15% body weight. (Page 7 Line 19 to Page 8 Line 2)

Reviewer #1

Major points:

1) Cutaneous SCC is the common cancer and is not rare. Thus, the authors should be able to collect more samples. The number of patients with cSCC with PNI (only 9 patients) is too small to reach a conclusion.

The reviewer has raised an excellent question. Cutaneous SCC is the second most common human cancer. However, PNI is diagnosed mainly by incidental pathological finding due to the fact that most patients with cSCC and PNI have no clinical symptoms and no radiologic evidence of PNI. Its reported incidence rates range between ~2 and 5 %. For this study, we evaluated 24 patients with cSCC, and 9 exhibited PNI (37.5% in this cohort). We were limited with respect to total number of patients evaluated by budgetary concerns. Results of this limited series showed upregulation of MAGE-A3 mRNA expression in the patients showing poor prognosis and we investigated possible mechanisms driving this correlation. Utility of MAGE as a biomarker for prognosis is currently under study by our group.

2) The authors must describe the details of the clinical characteristics of patients with cSCC with PNI.

We thank the reviewer for this important suggestion. The clinical characteristics of patients with cSCC with PNI is provided in the supporting file “S1 table.docx” and presented below.

Patient

No. Age Gender Tumor Site Tumor Size (cm) IHC Score Differentiation BWH Stage

1 86 M Scalp 2 < 20 Mod 2A

2 96 F Forehead 2.5 20 Mod 2A

3 81 M Face 2.5 < 20 Mod 2B

4 81 M Temple 1.4 < 20 Mod 2B

5 64 M Temple 3.1 21-49 Mod 2B

6 45 F Forehead 2.5 21-49 Mod 2B

7 65 M Ear 2.5 50-999 Poor 3

8 90 M Arm 2 >1000 Poor 3

9 88 M Scalp 2 >1000 Poor 3

3) The authors showed that not only MAGE-A3 but also MAGE-A4 mRNA expression was upregulated in poorly differentiated cSCC with PNI in Figure 1A. How about the expression of MAGE-A4 protein in tissue from the patients with cSCC with PNI? The authors should also examine the MAGE-A4 expression in tissue using immunohistochemistry.

We thank the reviewer for this important suggestion. We have split Figure 1 into Figures 1 and 2. IHC assessment of MAGE-A4 expression in normal skin, moderately differentiated cSCC and poorly differentiated cSCC with PNI have been added to Figure 2, and this information has been added to the text on page 15 line 15.

4) What is the minimum percentage of MAGE-A3 positive tumor cells required to consider the sample MAGE-A3 positive?

We thank the reviewer for this question about a key measurement in our Nanostring technology analysis. This information has been added to the Material and Methods section. MAGEA3 positivity is defined by a normalized NanoString value of greater than 20 as described in our previous study (Abikhair et al. J Invest Dermatol. 2017 Mar;137(3):775-778). (Page 6 Line 14-15)

5) Representative immunohistological futures of not only poorly and moderately differentiated cSCC but also healthy controls are shown in Figure 1B.

We thank the reviewer for this important suggestion. Figure 1B has been modified and changed to Figure 2. The immunohistological features of healthy control has been added into Figure 2 for both MAGE-A3 and MAGE-A4, and this information has been added to the text on page 15 line 15.

6) In Figure 2, the authors treated A431 SCC cells with anti-MAGE-A3 antibody to explore the role of MAGE-A3 in cell cycle progression. What is the mechanism in this experiment? Does MAGE-A3 express on cell surface of A431 SCC cells? Furthermore, the authors compared A431 SCC cells treated with MAGE-A3 antibody with those treated with vehicle or untreated. However, A431 SCC cells treated with isotype control antibody should be used as a control group. If the authors want to examine the role of MAGE-A3 in A431 SCC cells, it may be desirable to knockdown or knockout expression of MAGE-A3 using siRNA or CRISPR/Cas9.

We thank the reviewer for raising this important question. Figure 2 has been changed to Figure 3. MAGE-A3 protein is localized to the endoplasmic reticulum. (Morishima, Nakanishi et al. J Biol Chem 2002 277(37): 34287-34294) Doyle et al discovered that multiple MAGE family proteins are capable of binding E3 RING ubiquitin ligases to form MAGE-RING protein complexes. (Doyle, Gao et al. Mol Cell 2010 39(6): 963-974) These complexes promote degradation of p53 in the ubiquitin-protease system, and more than 50 complexes have been identified. (Lee and Potts. J Mol Biol 2017 429(8): 1114-1142) MAGE-A3 protein specifically interacts with TRIM28 E3 RING ubiquitin ligase to form a stable MAGE-RING ligase complex. (Yang, O’Herrin et al. Cancer Res 2007 67(20): 9954-9962; Pineda and Potts. 2015 Autophagy 11(5): 844-846) In addition, previous studies have found this complex also accelerates degradation of two important tumor suppressors, fructoses-1,6-bisphosphatase (FBP1) and 5’ adenosine monophosphate-activated protein kinases (AMPK). (Jin, Pan et al. Oncogenesis 2017 6(4): e312; Ye, Xie et al. Cell Physiol Biochem 2018 45(3): 1205-1218) Together, MAGE-A3 downregulates apoptosis and drives tumorigenesis, cell cycle progression and metastasis. Based on these findings, we hypothesize that the decrease in the percentage of cells in S-phase and deceleration of cancer migration observed in our in vitro experiments might be attributed to the blockage of interactions between MAGE-A3 and TRIM E3 RING ubiquitin ligase and disruption of MAGE-RING ligase complex formation by MAGE-A3 antibodies. The upregulation of p53 expression in A431 cells pre-treated with MAGE-A3 antibodies shown in Figure 3B further supports our hypothesis. (Page 24 Line 9 to Page 25 Line 3)

We used actin monoclonal IgG1-kappa antibody (ThermoFisher #MA5-11869) as an isotype control antibody (IgG1, kappa), and this information has been added to the Methods section on page 11 line 17-18. We have conducted the scratch tests using this antibody as an isotype control, and the results have been included into Figure 3C and 3D. This information is presented in the text on page 17 lines 10-15.

Dimethyl sulfoxide (DMSO) can induce water pores in dipalmitoyl phosphatidylcholine bilayers and cause cell membrane to become floppier, which increases permeability for the antibodies to enter cells. (Notman, Noro et al. J Am Chem Soc 128(43): 13982-13983) (Page 24 Line 9-11) Thus, we prepared an antibody transport solution (ATS) that contained PBS, 50% glycerol, 0.02% sodium azide (pH 7.3) and 0.1% dimethyl sulfoxide (DMSO) to assist MAGE-A3 antibodies to enter A431 cells. (Page 10 Lines 18-20) The results demonstrated suppression of cancer proliferation and migration; therefore, we decided to knockout expression of MAGE-A3 by CRISPR/Cas9 in PAM212 and follow-up its syngeneic tumor growth in balb/c mice in 6 weeks. This in vivo experiment reveals that knockout expression of MAGE-A3 results in significant tumor regression.

7) In page 15, the authors described that the trend of increased MAGE-A3 expression in Pam 212 SCC tumors was confirmed by immunohistochemical staining. However, there are no immunohistological images.

We apologize for this error. The sentence has been removed.

8) In Figure 4, knockout of MAGE-A3 expression via CRISPR/Cas9 was confirmed by PCR and qPCR. However, the authors should also perform western blot analysis to prove knockout of MAGE-A3 protein.

We thank the reviewer for this comment. We have performed western blot analysis to show knockout of MAGE-A3 protein expression. The findings have been added to Figure 5C, and this information has been presented on page 19 line 17-19.

Minor points:

1) Please describe the details of MAGE-A3 antibody such as company, clone name, and dilution rate in EDU assays and Immunohistochemistry of the materials and methods section (page 9 and 10).

We thank the reviewer for this comment. The details of MAGE-A3 antibody has been added on page 11 line 15. Dilution rates in EDU assays and immunohistochemistry have been added on page 10 line 18 and page 12 line 9.

Reviewer #2

SPECIFIC COMMENTS

1) Figure 2, Please report whether MAGE-A3 expressed in A431 cells in vitro by mRNA or protein.

We thank the reviewer for this comment. MAGE-A3 protein localizes to the endoplasmic reticulum are the targets of MAGE-A3 antibodies in our A431 experiments. (Page 24 Line 9) The original figure 2 has been changed to Figure 3. (Page 17 Line 4)

2) Figure 2A, Please include results from IgG1 isotype control treatment if such reagent exists and if such experiments were performed. In the legend, “A341” should be “A431.” Further, please provide any historical data or cited literature indicating that the cellular localization of MAGE-A3 has access to antibody on the surface of cells.

We thank the reviewer for this comment. Actin monoclonal IgG1-kappa antibody (ThermoFisher #MA5-11869) was used in A431 experiments as an isotype control (IgG1, kappa). (Page 11 Line 17)

We have corrected the typo and apologize for the error.

We have provided cited literature and a description as follows: MAGE-A3 protein is located to the endoplasmic reticulum. (Morishima, Nakanishi et al. J Biol Chem 2002 277(37): 34287-34294) (Page 24 Line 9) Dimethyl sulfoxide (DMSO) can induce water pores in dipalmitoyl phosphatidylcholine bilayers and cause cell membrane to become floppier, which increases permeability for the antibodies to enter cells.( Notman, Noro et al. J Am Chem Soc 128(43): 13982-13983) (Page 24 Line 9-11) Thus, we prepared an antibody transport solution (ATS) that contained PBS, 50% glycerol, 0.02% sodium azide (pH 7.3) and 0.1% dimethyl sulfoxide (DMSO) to assist MAGE-A3 antibodies to enter A431 cells. (Page 10 Lines 18-20)

3) Figure 2B, Please include statistical significance data on the graph.

We thank the reviewer for this comment. We have modified Figure 2B with results of isotype antibody into Figure 3C. The legend on page 17 line 10-13 has also changed accordingly.

4) Figure 2D, Please describe the use of the anti-p53 Western Blot antibody used in the methods

We thank the reviewer for this comment. Figure 2D has been changed to Figure 3B matching to the text on page 17 Line 8. We have added the p53 antibody (Cell Signaling (1C12) Mouse mAb #2524) in the Immunoblot Analysis and Antibodies of the Methods section. (Page 11 Line 16-17)

5) Figure 3A, Please include the number of mice used per cohort & how many experiments were conducted. Further, in the text, the description of the change in growth is reported without units (1112.24?...) – please include units. This is also the case later in the text – please include units numerical values throughout.

We thank the reviewer for correcting our errors. Figures 3 and 4 have been changed to Figures 4 and 5. We have added a total of 5 mice done in the experiment shown in Figure 4A. (Page 18 Line 12) The knockout experiment was conducted twice and the results of total 18 mice were analyzed in Figure 5D. (Page 19 Line 20) Units also have been added in the text. (Page 17 Line 21)

6) Figure 3B, Cyclin D2/D3 does not appear to be elevated in PAM212 tumors as text suggests. Quantification not provided. Please clarify this statement.

We thank the reviewer for pointing out this error. We have removed the statement.

7) “The trend of increased MAGE-A3 expression in Pam 212 SCC tumors was further confirmed by immunohistochemical staining (Figure 3C)” on page 21 –while Figure 3C reports relative RNA expression. Please clarify this statement.

We apologize for this error. The sentence has been removed.

8) MTS proliferation is noted in the methods but not includes in the Figures. Please remove from the methods if this data is not to be included.

We apologize for this error. The section has been removed from the Material and Methods section.

9) Figure 4B, Please include the statistical details in the graph

We thank the reviewer for the comment. Figure 4B has been changed to Figure 5B. The statistical details have been added in the Figure 5B legend as follows: Fold increase of MAGE-A3 expression in wide type Pam 212 was set to 1. Fold changes in MAGE-A3 expression in KO Pam 212 by Guide 521 and 520 were 0.0049 ± 0.00198 and 0.000535 ± 0.000209, respectively. Error bars have been added into the graph to indicate the standard deviation. The error bars are difficult to see in the graph, so we also added the exact values to the figure legend. (Page 19 Line 14-17)

10) Figure 4C, Please report the number of mice per cohort & how many experiments were performed; Please include the statistical significance in the graph.

We thank the reviewer for the comment. The figure 4C has been changed to Figure 5D and this change has been updated in the manuscript. (Page 19 Line 19) MAGE-A3 KO animal experiments were conducted twice, and each time 3 balb/c mice were included in each group for a total of 18 mice. (Page 19 Line 20) Results with statistical significance in the graph are noted with *, and this information has been added to the figure legend. (Page 19 Line 21-22)

11) Figure 4D & 4E appear to be transposed compared to what is described in the text on page 16.

We thank the reviewer for correcting this confusion. Figure 4D has been changed to Figure 5F, and Figure 4F has been changed to Figure 5G. The changes have been updated in the text on page 20 Lines 1-4.

Moreover, we have updated our Competing Interests statement as follows per the editor’s suggestion: Jean-Philippe Therrien and James Lee were employees and shareholders of GlaxoSmithKline while these studies were being performed. This does not alter our adherence to Plos One policies on sharing data and materials.

Submitted filename: Response to Samantha Russell.doc

Click here for additional data file.

19 Oct 2020

MAGE-A3 is a prognostic biomarker for poor clinical outcome in cutaneous squamous cell carcinoma with perineural invasion via modulation of cell proliferation

PONE-D-19-34576R1

Dear Dr. John A. Carucci,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Yoshihiko Hirohashi, M. D., Ph. D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

The authors addressed concerning points.

Reviewers' comments:

23 Oct 2020

PONE-D-19-34576R1

MAGE-A3 is a prognostic biomarker for poor clinical outcome in cutaneous squamous cell carcinoma with perineural invasion via modulation of cell proliferation

Dear Dr. Carucci:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Yoshihiko Hirohashi

Academic Editor

PLOS ONE