Literature DB >> 33145997

Prefoldin subunit 6 of Plasmodium falciparum binds merozoite surface protein-1.

Vikash Kumar1, Rumaisha Shoaib2, Ankita Behl1, Akshay Munjal1, Mohammad Abid2, Shailja Singh1.   

Abstract

Malaria is a human disease caused by eukaryotic protozoan parasites of the Plasmodium genus. Plasmodium falciparum (Pf) causes the most lethal form of human malaria and is responsible for widespread mortality worldwide. Prefoldin is a heterohexameric molecular complex that binds and delivers unfolded proteins to chaperonin for correct folding. The prefoldin PFD6 is predicted to interact with merozoite surface protein-1 (MSP-1), a protein well known to play a pivotal role in erythrocyte binding and invasion by Plasmodium merozoites. We previously found that the P. falciparum (Pf) genome contains six prefoldin genes and a prefoldin-like gene whose molecular functions are unidentified. Here, we analyzed the expression of PfPFD-6 during the asexual blood stages of the parasite and investigated its interacting partners. PfPFD-6 was found to be significantly expressed at the trophozoite and schizont stages. Pull-down assays suggest PfPFD-6 interacts with MSP-1. In silico analysis suggested critical residues involved in the PfPFD-6-MSP-1 interaction. Our data suggest PfPFD-6 may play a role in stabilizing or trafficking MSP-1.
© 2020 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.

Entities:  

Keywords:  Plasmodium falciparum; chaperone; malaria; merozoite surface protein-1; prefoldin

Mesh:

Substances:

Year:  2022        PMID: 33145997      PMCID: PMC9063436          DOI: 10.1002/2211-5463.13022

Source DB:  PubMed          Journal:  FEBS Open Bio        ISSN: 2211-5463            Impact factor:   2.792


glutathione S‐transferase immunofluorescence assay merozoite surface protein‐1 nickel–nitrilotriacetic acid Plasmodium falciparum prefoldin red blood cells reverse transcription polymerase chain reaction Malaria is a major human health concern caused by the eukaryotic protozoan parasite ‘Plasmodium’. Among Plasmodium species, Plasmodium falciparum (Pf) causes the most lethal form of human malaria and is responsible for widespread mortality worldwide [1]. Humans become infected when a female Anopheles mosquito transfers parasite through its saliva, which migrate through the skin into the host blood stream [2, 3]. The parasite then infects the hepatocytes where it undergoes asexual multiplication. This is followed by the release of merozoites, which specifically invade the host erythrocytes to commence asexual life cycle [4]. This specificity is associated with receptor–ligand‐type interactions between merozoites and erythrocytes [5, 6]. It has been believed that initial interactions are mediated by merozoite surface proteins (MSPs) through multiple weak interactions with receptors on the surface of RBCs [7, 8]. Among MSPs, merozoite surface protein‐1 (MSP‐1) is best characterized and reports suggest its role in erythrocyte invasion [8, 9, 10]. Uniform distribution of MSP‐1 over the merozoite surface and the observation that antibodies against MSP‐1 inhibit invasion have implicated its role in host cell invasion [10]. Another interesting aspect about MSP‐1 is that it is essential for parasite viability [11] and undergoes proteolytic processing that is coincident with merozoite maturation and invasion [12, 13, 14, 15, 16]. Molecular chaperones are ubiquitous proteins, which play key roles in protein folding, trafficking, and degradation of proteins within the cell, and are critical for maintaining cellular homeostasis [17, 18, 19]. Among chaperones, ATP‐dependent group of proteins known as chaperonin are characterized by double‐ring structure that are found in both prokaryotes and eukaryotes [20, 21, 22, 23]. Based on the presence or absence of a co‐chaperonin, chaperonins are classified into two groups, that is, group I and group II chaperonins [24]. Group I chaperonins expressed in bacterial cytoplasm (GroEL) and endosymbiotic organelles [25], whereas group II chaperonins are found in archae (thermosome) and in the eukaryotic cytosol as TCP‐1 ring complex (TRiC or CCT) [26]. Both chaperonins share common structures with different functions [27]. Prefoldin (PFD) is widely regarded as a cochaperone of group II chaperonin in eukaryotes and was first recognized as Gim (genes involved in microtubule biogenesis) in yeast [23, 28]. PFD plays a central role in stabilizing unfolded proteins and subsequently deliver them to group II chaperonin to facilitate correct folding [23, 28, 29, 30]. Archaeal PFDs are comprised of two types of subunits (two α subunits and four β subunits), whereas eukaryotic PFDs are composed of six different subunits (two α‐like subunits: PFD3 and PFD5 and four β‐like subunits: PFD1, PFD2, PFD4, and PFD6) [31]. Archaeal PFDs have been shown to stabilize nascent proteins and prevent them from aggregation [32, 33]. In eukaryotes, PFDs mainly bind to nascent cytoskeletal proteins and protect them from unwanted interactions [31, 34, 35]. Prefoldins have been reported to play key roles in several necessary cellular processes. In Caenorhabditis  elegans, reduction in functional PFDs by RNAi leads to defects in cell division that ultimately causes embryonic lethality [36]. Deletion of single or multiple subunits of PFD genes causes cytoskeletal defects, slow growth, and low temperature stress in yeast [37, 38, 39]. In Arabidopsis, PFD6 mutant causes a range of deformability that includes defect in microtubule and cell division, cortical array organization, and microtubule dynamicity [40, 41, 42]. Recent studies show that eukaryotic PFD plays an important role in quality control against protein aggregation. Moreover, dysfunction of PFD leads to neurodegenerative diseases [43, 44]. Another reports suggest that PFD1 promotes epithelial–mesenchymal transition (EMT) and lung cancer progression by suppressing expression of cyclin A by binding to its promoter at transcription start site [45, 46]. Although the role of PFDs has been described in archae and eukaryotes, their functions in P. falciparum remain largely unidentified. Lilburn et al. studied the heat‐shock response network of P. falciparum by integrating available high‐throughput omics data. They found putative prefoldin subunits namely prefoldin 6 (PF3D7_051200), prefoldin 3 (PF3D7_071850), prefoldin 4 (PF3D7_090450), cochaperone prefoldin complex subunit 5 (PF3D7_112810), and prefoldin 2 (PF3D7_1416900) as heat‐shock proteins that had protein–protein associations. This interactome of heat‐shock response‐related proteins is believed to a play crucial role in the survival of parasite during febrile episodes of temperature fluctuations [47]. A more recent study showed upregulated expression of prefoldin ‘FAZP’ in artesunate (ART)‐resistant line of Leishmania donovani. FAZP is associated with ART resistance in P. falciparum malaria [48]. We searched in Plasmodb database using the keyword ‘prefoldin’ and found that P. falciparum encodes six PFD subunits and a prefoldin‐like protein [49]. According to yeast two‐hybrid (Y2H) data available on PlasmoDb, PFD6 is found to interact with merozoite surface protein‐1 (MSP‐1), a protein well known to play a pivotal role in erythrocyte binding and invasion by Plasmodium merozoites. This looks intriguing that how a small prefoldin subunit of molecular mass 13 kDa associates and stabilizes a large protein (MSP1) of mass ~ 200 kDa, which is indispensable for invasion of the red cell by the parasite. This led us to look closer into PFD6 among all prefoldin subunits. In this study, we have attempted to delineate the function of PfPFD‐6 (Plasmodb Id: PF3D7_0512000; [49]) using pull‐down assays and confirmed its expression in Plasmodium asexual blood stages by RT–PCR, immunofluorescence assay (IFA), and western blotting. PfPFD‐6 was found to interact with MSP‐1, which shed light on the probable role of PfPFD‐6 in MSP‐1 stability and indirectly in erythrocyte invasion.

Materials and methods

Parasite culture

Plasmodium falciparum 3D7 parasites were cultured in O+ RBCs using complete RPMI 1640 medium supplemented with 0.5 g·L−1 AlbuMAX I (Gibco, Dún Laoghaire, Dublin, Ireland), 27.2 mg·L−1 hypoxanthine (Sigma, St. Louis, Missouri, USA), and 2 g·L−1 sodium bicarbonate (Sigma). Culture was maintained at 37 °C in 90% N2, 5% CO2, and 5% O2 containing environment and maintained at 5% hematocrit and 5% parasitemia. Late stages of schizonts were harvested by centrifugation from Plasmodium cultures (parasitemia 8–10%), and the parasites were released from red blood cells by treatment with 0.15% saponin. Parasite pellet was washed with 1× PBS and stored at −80 °C for experiments. Parasites were synchronized by 5% sorbitol (Sigma) selection of rings, and late trophozoites or schizonts were purified from mixed parasite culture using 65% Percoll (Sigma).

Cloning, expression, purification, and antibody generation of recombinant PfPFDN‐6

Gene encoding full‐length PF3D7_0512000 (360 bp size; PfPFD‐6) was PCR‐amplified from cDNA using gene‐specific forward (5′ ATGTCTCAAGAAAAAATTAGTGAA 3′) and reverse (5′ TTAAGCTTGTGGAACGGGTAT 3′) primers. PCR‐amplified product was cloned into pGEX4T‐1 and pET28a vector. Full constructs were expressed as C‐terminal hexahistidine‐tagged and GST‐tagged fusion protein in BL21 (DE3) Escherichia coli cells. Affinity purification was carried out for His‐tagged recombinant protein in buffer containing 50 mm Tris/HCl, 300 mm NaCl, and 0.02% Na/azide, pH 8.0. Elutes of affinity chromatography of PfPFD‐6 were subjected to anion exchange chromatography using a Q Sepharose column (GE Healthcare Life Sciences, Chicago, IL, USA). GST‐tagged recombinant protein was purified in 50 mm Tris, 150 mm NaCl, and 0.02% Na/azide pH 8.0 by using glutathione affinity chromatography.

RNA isolation and RT–PCR of PfPFD‐6 gene

RNA was isolated from all the three stages of parasite (16–20 h of ring, 32–38 h of trophozoite, and 40–46 h of schizont) using TRIzol reagent (Life Technologies, Carlsbad, CA, USA) following standard protocol [50]. DNA was removed by the DNase treatment kit (DNA‐free™ DNA Removal Kit; Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA). Purity and concentration of RNA were estimated. Two microgram of total RNA was reverse‐transcribed into cDNA using the cDNA Kit (Thermo Fisher scientific) according to the manufacturer's protocol. One hundred nanogram of cDNA from each stage was used for semi‐quantitative PCR by using specific PfPFD‐6 primers. 18s primer was used as a loading control.

Raising polyclonal antisera and in vivo expression analysis of PfPFD‐6

Polyclonal antibodies were raised in house in male New Zealand White rabbits and male BALB/c mice using purified recombinant proteins as immunogens following standard protocol [51]. Briefly, animals were immunized with emulsion containing 1 : 1 ratio of Freund's complete adjuvant and antigen followed by three booster doses at an interval of 14 days. Booster doses comprise 1 : 1 ratio of Freund's incomplete adjuvant and antigen. Final bleed was collected, and the end point titers of raised antisera were determined by western blotting. For in vivo expression analysis, Pf3D7 schizont stage asexual cultures (parasitemia ~ 8%) were subjected to saponin lysis (0.15% w/v) followed by extensive washing of parasite pellet with 1× PBS to remove traces of hemoglobin. Parasite pellet (~ 10 µg total protein) was resolved on 12% SDS/PAGE and transferred to nitrocellulose membrane. The blot was blocked in 5% BSA in 1× PBS overnight at 4 °C and probed with rabbit anti‐PfPFD‐6 antisera (1 : 5000) followed by incubation with horseradish peroxidase (HRP)‐conjugated goat anti‐rabbit IgG (1 : 5000; Sigma‐Aldrich, St. Louis, MO, USA). The blot was developed using Enhanced Chemiluminescence Kit (Bio‐Rad, Hercules, CA, USA).

Colocalization assay

Thin blood smears of mixed stage Pf3D7 cultures at 5% parasitemia were fixed in methanol for 45 min at −20 °C, permeabilized with 0.05% PBS/Tween 20, and blocked with 5% (w/v) BSA in PBS. For colocalization studies, mouse anti‐PfPFD‐6 (1 : 250) and rabbit anti‐MSP‐1 (1 : 250) [52] were added as primary antibodies and incubated for 2 h at room temperature. Alexa Fluor 488‐conjugated anti‐rabbit (1 : 500, red color; Molecular Probes, Invitrogen, Carlsbad, CA, USA) and Alexa Fluor 546‐conjugated anti‐mouse (1 : 500, green color; Molecular Probes) were used as secondary antibodies. The parasite nuclei were counterstained with DAPI (40, 60‐diamidino‐2‐phenylindole; Invitrogen) and mounted with a coverslip. The slides were examined using a confocal microscope (Olympus, Shinjuku, Tokyo, Japan) with a 9 100 oil‐immersion objective.

Pull‐down assay

Pull‐down assays were performed to test PfPFD‐6 and MSP‐1 interaction. Briefly, E. coli BL21 (DE3) cells containing pGEX4T‐1 with and without PfPFD‐6 insert were grown and harvested. Culture was lysed, and bacterial lysate was incubated with Glutathione Sepharose beads for binding. Beads bound with GST‐fused PfPFD‐6 and only GST‐bound beads were incubated with parasite lysate comprising majorly of trophozoites and late schizonts for 3 h at 4 °C. The beads were washed extensively three times with the washing buffer (20 mm HEPES, 150 mm NaCl, pH 7.4). The complex was recovered from the beads by eluting in elution buffer containing reduced 20 mm glutathione in 50 mm Tris/Cl. Eluted fraction and protein complex bound beads were resolved on 12% SDS/PAGE, transferred to nitrocellulose membrane, and probed with monoclonal anti‐MSP119 (1 : 500) followed by incubation with horseradish peroxidase (HRP)‐conjugated goat anti‐rabbit IgG (1 : 5000; Sigma‐Aldrich). Eluted fraction and protein complex bound beads were also probed with anti‐PfPFD‐6 and anti‐GST antibodies on the same blot.

Homology modeling and docking of PfPFD‐6 and MSP‐1

Three‐dimensional structures of PfPFD‐6 and MSP‐1 (amino acids 241–1700) were constructed by I‐TASSER server [53]. The built models were subjected to refinement and energy minimization using 3D refine and Swiss‐PdbViewer (SPDBV), respectively [54, 55]. Procheck and ERRAT servers were used to check the stereochemical quality and overall energy of predicted model, respectively [56, 57]. For docking studies, PfPFD‐6 was docked with MSP‐1 model using HDOCK web server. The RIN profile of obtained representative structure of PfPFD‐6 and MSP‐1 complex was generated using RING 2.0 web server [58]. RIN analysis is a technique that represents various interactions in the form of a detailed network model.

Results

Cloning, expression, and purification of PfPFD‐6 protein

The PfPFD‐6 gene was cloned in pET‐28a (+) and pGEX‐4 T1 vector (Novagen, Vadodara GJ, India) and expressed in E. coli BL21 (DE3) cells. Figure 1A shows a schematic representation of full‐length PfPFD‐6 protein (119 amino acid residues; yellow color) harboring a prefoldin β‐domain (100 amino acid residues; blue color). Expression of N‐terminal hexahistidine (His)‐tagged and C‐terminal GST‐tagged PfPFD‐6 constructs was scaled up to purify protein from the soluble fraction using various chromatographic techniques. Recombinant GST‐tagged PfPFD‐6 was purified by affinity chromatography using GST beads, whereas His‐tagged PfPFD‐6 was purified using nickel/nitrilotriacetic acid (Ni‐NTA) resin. His‐tagged protein was further purified by ion‐exchange chromatography. Purified recombinant His‐tagged PfPFD‐6 and GST‐tagged PfPFD‐6 run as a species of ~ 16 and ~ 39 kDa, respectively, on SDS/PAGE (Fig. 1B,C). Identity of His‐tagged PfPFD‐6 and GST‐tagged PfPFD‐6 was confirmed by western blotting using anti‐His monoclonal and anti‐GST antibodies, respectively (Fig. 1D,E). Multiple sequence alignment of PfPFD‐6 with its homologs in Plasmodium species, Homo sapiens, Toxoplasma gondii,   Caenorhabditis elegans, Saccharomyces cerevisiae, Arabidopsis thaliana,  Mus musculus, and Canis lupus showed significant conservation among PFD6 proteins (Fig. 2A). Phylogenetic tree depicting the sequence relationship among these PFD6 proteins is represented in Fig. 2B.
Fig. 1

Domain organization and expression of PfPFD‐6 protein. (A) Domain organization of PF3D7_0512000 (PfPFD‐6). Schematic representation of full‐length PfPFD‐6 protein (yellow) containing a prefoldin β‐superfamily domain (blue) (B) SDS/PAGE of purified recombinant protein cloned in pET28a vector lane 1: protein ladder; lane 2: purified recombinant PfPFD‐6. Dashed line indicates that lanes were not originally adjacent. (C) SDS/PAGE of purified recombinant protein cloned in pGEX4T‐1 vector. Lane 1: protein ladder; lane 2: purified recombinant PfPFD‐6 (D) Western blot of purified recombinant protein using antihistidine antibodies. (E) Western blot of purified recombinant protein using anti‐GST antibodies.

Fig. 2

Multiple sequence alignment and phylogenetic tree of PfPFD‐6 subunits with its homologs. (A) Comparison of amino acid sequence of PfPFD‐6 subunits with its homologs in Plasmodium species, Homo sapiens, T. gondii, C. elegans, Saccharomyces cerevisiae, A. thaliana, M. musculus, and C. lupus. Alignment was performed using clustal omega, EMBL‐EBI, Hinxton, Cambridge, UK. ‘*’ represents conserved residues, whereas ‘:’ and ‘.’ represent semi‐conserved residues. (B) Phylogenetic tree of PfPFD‐6 subunits with its homologs using mega 6 software, Pennsylvania State University, PA, USA.

Domain organization and expression of PfPFD‐6 protein. (A) Domain organization of PF3D7_0512000 (PfPFD‐6). Schematic representation of full‐length PfPFD‐6 protein (yellow) containing a prefoldin β‐superfamily domain (blue) (B) SDS/PAGE of purified recombinant protein cloned in pET28a vector lane 1: protein ladder; lane 2: purified recombinant PfPFD‐6. Dashed line indicates that lanes were not originally adjacent. (C) SDS/PAGE of purified recombinant protein cloned in pGEX4T‐1 vector. Lane 1: protein ladder; lane 2: purified recombinant PfPFD‐6 (D) Western blot of purified recombinant protein using antihistidine antibodies. (E) Western blot of purified recombinant protein using anti‐GST antibodies. Multiple sequence alignment and phylogenetic tree of PfPFD‐6 subunits with its homologs. (A) Comparison of amino acid sequence of PfPFD‐6 subunits with its homologs in Plasmodium species, Homo sapiens, T. gondii, C. elegans, Saccharomyces cerevisiae, A. thaliana, M. musculus, and C. lupus. Alignment was performed using clustal omega, EMBL‐EBI, Hinxton, Cambridge, UK. ‘*’ represents conserved residues, whereas ‘:’ and ‘.’ represent semi‐conserved residues. (B) Phylogenetic tree of PfPFD‐6 subunits with its homologs using mega 6 software, Pennsylvania State University, PA, USA.

Expression profile in the intra‐erythrocytic cycle by RT–PCR

Stage‐specific real‐time PCR assays on 18S rRNA were performed to investigate the expression of PfPFD‐6 gene during asexual blood stages (i.e., rings, trophozoites, and schizonts) of parasite life cycle. Parasites were synchronized, and RNA was extracted from three intra‐erythrocytic asexual blood stages of the parasite. Our result revealed that the expression of PfPFD‐6 transcripts at all asexual parasite stages. 18S rRNA was used as a loading control to clarify equal loading of cDNA sample (Fig. S1A).

Confirmation of in vivo expression of PfPFD‐6

Polyclonal antibodies against PfPFD‐6 were raised in house in rabbits and mice using purified recombinant PfPFD‐6 and tested for reactivity on PfPFD‐6. These antibodies were checked for their specificity against PfPFD‐6 prior to their use. Detection of a single band of induced PfPFD‐6 in crude extract of E. coli BL21 (DE3) transformed with its cloned plasmid validated the specificity of these antibodies (lane 4; Fig. S1B,C). Crude extract of E. coli BL21 (DE3), uninfected red blood cell pellet, and uninfected red blood cell cytosol were used as a negative controls (lanes 1, 2, and 3; Fig. S1B,C). Signal was absent when samples were probed with pre‐immune sera (data not shown). Western blot analysis was then conducted on schizont stage parasite lysate and iRBC cytosol using rabbit anti‐PFD6 antisera to check in vivo expression of PFD protein during the asexual blood stages of Pf. A single band of expected molecular weight for PfPFD‐6 (13 kDa) was detected only in the parasite lysate, suggesting the expression of PfPFD‐6 in asexual blood stages of parasite life cycle (Fig. 3A; lane 2). No band was detected in infected red blood cells cytosol, suggesting the presence of PfPFD‐6 within parasite (Fig. 3A; lane 1).
Fig. 3

In vivo expression and colocalization assay. (A) Western blot analysis of schizont stage Pf3D7 parasite lysates to test in vivo expression of PfPFD‐6. Lane 1: protein ladder; lane 2: schizont stage parasite lysate. Blot was probed with anti‐PfPFD‐6 antibodies followed by secondary antibodies. (B) Expression analysis and colocalization of PfPFD‐6 with MSP‐1 at different asexual stages of parasite life cycle. Smears of methanol‐fixed Pf3D7‐infected erythrocytes were stained with anti‐PfPFD‐6 antibodies (1 : 250) and anti‐MSP‐1 antibodies (1 : 250), followed by incubation with Alexa Fluor‐conjugated secondary antibodies (Alexa Fluor 488, red; Alexa Fluor 546, green). DIC, differential interference contrast image; DAPI, nuclear staining 40, 6‐diamidino‐2‐phenylindole (blue); MSP‐1, mouse anti‐MSP‐1 (green); PfPFD‐6, anti‐PfPFD‐6 antibody (red); merge, overlay of PfPFD‐6 proteins with MSP‐1. Scale bar represents 2 μm.

In vivo expression and colocalization assay. (A) Western blot analysis of schizont stage Pf3D7 parasite lysates to test in vivo expression of PfPFD‐6. Lane 1: protein ladder; lane 2: schizont stage parasite lysate. Blot was probed with anti‐PfPFD‐6 antibodies followed by secondary antibodies. (B) Expression analysis and colocalization of PfPFD‐6 with MSP‐1 at different asexual stages of parasite life cycle. Smears of methanol‐fixed Pf3D7‐infected erythrocytes were stained with anti‐PfPFD‐6 antibodies (1 : 250) and anti‐MSP‐1 antibodies (1 : 250), followed by incubation with Alexa Fluor‐conjugated secondary antibodies (Alexa Fluor 488, red; Alexa Fluor 546, green). DIC, differential interference contrast image; DAPI, nuclear staining 40, 6‐diamidino‐2‐phenylindole (blue); MSP‐1, mouse anti‐MSP‐1 (green); PfPFD‐6, anti‐PfPFD‐6 antibody (red); merge, overlay of PfPFD‐6 proteins with MSP‐1. Scale bar represents 2 μm.

PfPFD‐6 colocalizes with MSP‐1

Yeast two‐hybrid data of Plasmodium PFDs showed that PfPFD‐6 interact with merozoite surface protein 1 (MSP‐1) [49]. MSP‐1 is considered as a candidate for blood‐stage malaria vaccines owing to its role in host erythrocyte binding and invasion [59, 60]. Immunofluorescence assays (IFAs) were performed to visualize the expression of PfPFD‐6 and colocalization of PfPFD‐6 with MSP‐1 during the asexual stages of Pf using protein‐specific antibodies on cultured parasites (Fig. 3B). The expression of PfPFD‐6 and MSP‐1 begins at mid‐trophozoite stage of parasite's life cycle. At schizont stages, these seem to remain confined within the parasitophorous vacuole (PV) of Pf. PfPFD‐6 showed negligible colocalization with MSP‐1 at the trophozoite stage of parasite development. In the schizont stage, significant overlapping of signals was observed within the PVM, suggestive of their coexistence (Fig. 3B). At schizont stage, MSP‐1 mostly localizes to PVM of Pf. However, to ascertain confinement of fluorescence within the PV and PVM, costaining with PV and PVM marker proteins would be required.

PfPFD‐6 binds to merozoite surface protein‐1 of Plasmodium falciparum

After observing colocalization of PfPFD‐6 with MSP‐1, we tested the binding of PfPFD‐6 with MSP‐1. GST pull‐down assay was performed to analyze the ability of PfPFD‐6 to pull down MSP‐1 from parasite lysate. Bacterial lysate‐containing GST‐tagged PfPFD‐6 protein and only GST were coupled to Glutathione Sepharose beads followed by incubation with schizont lysates. After extensive washing, the protein fractions were eluted and remaining protein‐bound beads were resolved on SDS/PAGE followed by probing with monoclonal anti‐MSP‐1 antibodies. A ~ 200 kDa band of full‐length MSP‐1 protein was observed in lane where beads containing GST‐tagged PfPFD‐6 were incubated with parasite lysate. In this lane, the supernatant of these beads was loaded after boiling (lane: 4; Fig. 4A). While no band was observed in elution fraction from only GST‐bound beads, supernatant from boiled GST‐bound beads, elution fraction of PfPDF‐6‐bound beads (lanes: 1, 2, and 3; Fig. 4A). In parallel, we resolved all these fractions on SDS/PAGE followed by probing with anti‐PfPFD‐6 and anti‐GST antibodies on the same blot. Our western blot data revealed a band size of 26 kDa (only GST) obtained in elution fraction from only GST‐bound beads and supernatant from boiled GST‐bound beads (lanes 1 and 2; Fig. S1D). Also, a 26 kDa (only GST) band appeared in elution fraction of PfPDF‐6‐bound beads (lane 3; Fig. S1D) and two bands corresponding to molecular sizes of 39 kDa (PFD6 + GST) and 26 kDa (only GST) appeared in supernatant of boiled GST‐tagged PfPFD‐6‐bound beads (lane 4; Fig. S1D). These results suggested that the PfPFD‐6 pulled down MSP‐1 from schizont stages.
Fig. 4

Domain organization of MSP‐1 protein and interaction of PfPFD‐6 with MSP‐1. (A) Pull‐down assay of PfPFD‐6 with MSP‐1. Beads bound with GST‐tagged PfPFD‐6 and only GST‐bound beads were incubated with schizont stage parasite lysate. The protein complex was recovered from the beads by eluting in elution buffer. Eluted fraction and protein complex bound beads were resolved on 12% SDS/PAGE, transferred to nitrocellulose membrane, and probed with monoclonal anti‐MSP119 (1 : 500). Lane M: protein ladder, lane 1: eluted fraction of GST‐bound beads, lane 2: supernatant of boiled GST‐bound beads, lane 3: eluted fraction of GST‐tagged PfPFD‐6‐bound beads, and lane 4: supernatant of boiled GST‐tagged PfPFD‐6‐bound beads. (B) Schematic representation of MSP‐1 showing signal peptide (SP, blue), 235 kDa fam domain (pink), MSP1‐C superfamily domain (yellow), and EGF domain (green). (C) Cartoon representation of modeled structures. (i) Model structure of PfPFD‐6, (ii) model structure of MSP‐1, and (iii) docked structure of PfPFD‐6‐MSP‐1 complex. (D) RIN plot of PfPFD‐6‐MSP‐docked complex. Nodes in blue and orange on the plot represent residues of PfPFD‐6 and MSP‐1, respectively. Pairs of interacting residues are mentioned on the plot (right panel).

Domain organization of MSP‐1 protein and interaction of PfPFD‐6 with MSP‐1. (A) Pull‐down assay of PfPFD‐6 with MSP‐1. Beads bound with GST‐tagged PfPFD‐6 and only GST‐bound beads were incubated with schizont stage parasite lysate. The protein complex was recovered from the beads by eluting in elution buffer. Eluted fraction and protein complex bound beads were resolved on 12% SDS/PAGE, transferred to nitrocellulose membrane, and probed with monoclonal anti‐MSP119 (1 : 500). Lane M: protein ladder, lane 1: eluted fraction of GST‐bound beads, lane 2: supernatant of boiled GST‐bound beads, lane 3: eluted fraction of GST‐tagged PfPFD‐6‐bound beads, and lane 4: supernatant of boiled GST‐tagged PfPFD‐6‐bound beads. (B) Schematic representation of MSP‐1 showing signal peptide (SP, blue), 235 kDa fam domain (pink), MSP1‐C superfamily domain (yellow), and EGF domain (green). (C) Cartoon representation of modeled structures. (i) Model structure of PfPFD‐6, (ii) model structure of MSP‐1, and (iii) docked structure of PfPFD‐6‐MSP‐1 complex. (D) RIN plot of PfPFD‐6‐MSP‐docked complex. Nodes in blue and orange on the plot represent residues of PfPFD‐6 and MSP‐1, respectively. Pairs of interacting residues are mentioned on the plot (right panel). MSP‐1 is a multidomain protein comprising 235 kDa fam domain, MSP‐1C superfamily domain, and EGF domain (Fig. 4B). The three‐dimensional (3D) models for PfPFD‐6 and PfMSP‐1 were generated by I‐TASSER, and protein–protein docking studies were performed to analyze the interaction interface [53]. The generated models were subjected to refinement using 3D refine [54] and were verified using Procheck and ERRAT web servers to check the stereochemical quality and overall quality of predicted models [56, 57]. We found that 3D models of PfPFD‐6 and MSP‐1 were sufficiently robust for protein docking studies. Ramachandran plots of the modeled structures generated by PROCHECK showed 99.9% and 89% residues to lie in the core region for PfPFD‐6 and MSP‐1, respectively, while the overall quality factor obtained from the ERRAT score was 93% and 94%, respectively. Modeled structure of PfPFD‐6 subunit comprises two long α‐helices connected by a short β‐hairpin (Fig. 4C‐i) and depict similar architecture to its homologs in archaea and humans [23, 28]. 3D structure of MSP‐1 showed helical structure linked with disordered loops (Fig. 4C‐ii). We observed docking energy for PfPFD‐6‐MSP‐1 complex as −234.96 kJ·mol−1 that indicates the stability of the docked complex (Fig. 4C‐iii). To identify key residues involved in interactions, the residue interaction network (RIN) profiles of docked complex were generated using RING 2.0 web server [58]. Analysis of docked structure and RIN plot showed that distal end of PfPFD‐6 tentacles is involved in binding with MSP‐1. We observed that Asp104 and His108 of PfPFD‐6 form maximum number of interactions with MSP‐1 (Fig. 4D).

Discussion

Prefoldins facilitate folding of nascent polypeptide chains mainly actin and tubulin in eukaryotes and archaea, and also perform nuclear functions in yeast, plants, and C. elegans [29, 36, 37, 38, 39, 40]. PFD is a heterohexameric protein consisting of two α subunits and four β subunits, showing a jelly fish‐like appearance [23, 28]. Sequence analysis reveals that the presence of either α‐ or β‐Prefoldin domain is the characteristic feature of PFD subunits [23]. Although PFDs are well‐studied in several organisms, the functions of PFDs in malaria parasite are largely unknown. Transcriptome data from PlasmoDB show the existence of PFDs (PF3D7_1107500, PF3D7_1416900, PF3D7_0718500, PF3D7_0904500, PF3D7_1128100, PF3D7_0512000, and PF3D7_0907300) in the Plasmodium parasites. Despite the presence of a common domain (α‐ or β‐Prefoldin domain) with the same average length (~ 120 and ~ 140 amino acids for β‐subunits and α‐subunits, respectively), sequence polymorphism exists in the PfPFD subunits. In the present study, we have chosen PfPFD‐6 for the functional characterization and attempted to assign a possible role to it. We have cloned full‐length PfPFD‐6 gene in pET28a and pGEX‐4T1 vector. Expression of full‐length construct was scaled up in E. coli expression system BL21 (DE3) to purify protein from the soluble fraction using various chromatography techniques. Stage‐specific expression of the PfPFD‐6 subunit from RT–PCR revealed its expression at all three asexual blood stages of parasites. In vivo expression of PfPFD‐6 subunit is clearly evident from our western blot analysis on schizont stage parasite lysates, which shows a single band at the expected size for PfPFD‐6 (13 kDa). Our IFA data demonstrate that the expression of PfPFD‐6 subunit began from trophozoite stage and continued at schizont stage of asexual parasite life cycle. Yeast two‐hybrid data from Plasmodb suggested MSP‐1 as the interacting partner of PfPFD‐6. Therefore, we perform colocalization experiments with anti‐PfPFD‐6 and anti‐MSP‐1 antibodies. The PfPFD‐6 was observed to have negligible colocalization with the merozoite surface protein‐1 (MSP‐1) at the mature trophozoite stages of parasite development. At later stages, both proteins showed maximum colocalization. Localization signals of MSP‐1 observed in our IFA are coherent with a previous report that suggests that MSP‐1 is synthesized at the mid‐trophozoite at asexual blood stage and transported to the parasite's plasma membrane [61]. Further, we tested the binding of PfPFD‐6 with MSP‐1 by using GST pull‐down assays. Our binding assays revealed that PfPFD‐6 is able to pull down MSP‐1 from parasite lysate (Fig. 4A). Therefore, it clearly illustrate for the first time that PfPFD‐6 interact with MSP‐1. P. falciparum MSP‐1 has been studied extensively as a vaccine candidate antigen [62] and is reported to be essential for parasite viability [11]. Merozoite surface location of MSP‐1 has implicated its role in erythrocyte invasion. A report by Blackman et al. [63] suggested that antibodies against MSP‐1 inhibit erythrocyte invasion. MSP‐1 is also known to bind with erythrocyte glycophorin A [64] Band 3 [65, 66], and heparin‐like molecules [67, 68]. At mid‐trophozoite stage, MSP‐1 is primarily synthesized as a large molecular size precursor of ~ 200 kDa [61] and is proteolytically processed into four fragments, that is, 83 kDa, 30 kDa, 38 kDa, and C‐terminal 42 kDa (MSP1‐42) just before egress from the schizonts [12, 13, 14, 15, 16]. Following cleavage, MSP‐1 fragments remain noncovalently attached to the merozoite surface until invasion. The noncovalent MSP‐1 complex polypeptide fragments shed from the merozoite surface following proteolysis, and only a small C‐terminal fragment is carried into the erythrocyte. From our interaction studies, we propose that PfPFD‐6 may play a possible role in MSP‐1 stability and trafficking, and have an indirect role in host cell invasion. However, this function needs to be confirmed in vivo. We performed in silico analysis to investigate interaction between PfPFD‐6 and MSP‐1. To date, there is no experimentally solved structure for Plasmodium chaperone. In this study, we attempted for the first time to predict the reliable model structure of PfPFD‐6 subunit and performed docking with modeled structure of MSP‐1. RING web server was used to explore crucial residues of PfPFD‐6 interacting with MSP‐1. Analysis of docked structure and RIN plot revealed that distal end of tentacles of PfPFD‐6 bind to MSP‐1. A previous report has also suggested that distal tentacle end is required for interaction with non‐native substrate, while β‐hairpin of PFD subunits is involved in oligomerization [29, 34, 69]. Overall, our studies highlight information on an unexplored PfPFD member and are likely to shed new light on malaria biology. Our studies using in vivo, in vitro, and computational approach form the outline for understanding PfPFD‐6 expression during asexual blood stages of parasite and its interaction with MSP‐1. Further in vivo experiments would help in getting better insight into the role of PfPFD‐6 in malaria biology.

Conflict of interest

The authors declare no conflict of interest.

Author contributions

VK conducted experiments, analyzed data, and wrote the manuscript. RS conducted experiments and helped in manuscript writing. AB conducted bioinformatic work, and wrote and edited the manuscript. AM conducted some cloning and pull‐down experiments. MA edited the manuscript. SS conceived the idea, analyzed the data, wrote the manuscript and approved the final draft. Fig. S1. Expression profile of PfPFD‐6 gene at asexual blood stages, determination of antibody specificity and pull‐down assay of PfPFD‐6 with MSP‐1. Click here for additional data file.
  68 in total

1.  Structure of the molecular chaperone prefoldin: unique interaction of multiple coiled coil tentacles with unfolded proteins.

Authors:  R Siegert; M R Leroux; C Scheufler; F U Hartl; I Moarefi
Journal:  Cell       Date:  2000-11-10       Impact factor: 41.582

2.  Structure of eukaryotic prefoldin and of its complexes with unfolded actin and the cytosolic chaperonin CCT.

Authors:  Jaime Martín-Benito; Jasminka Boskovic; Paulino Gómez-Puertas; José L Carrascosa; C Torrey Simons; Sally A Lewis; Francesca Bartolini; Nicholas J Cowan; José M Valpuesta
Journal:  EMBO J       Date:  2002-12-02       Impact factor: 11.598

3.  Chaperonin-facilitated protein folding: optimization of rate and yield by an iterative annealing mechanism.

Authors:  M J Todd; G H Lorimer; D Thirumalai
Journal:  Proc Natl Acad Sci U S A       Date:  1996-04-30       Impact factor: 11.205

4.  A novel protein complex promoting formation of functional alpha- and gamma-tubulin.

Authors:  S Geissler; K Siegers; E Schiebel
Journal:  EMBO J       Date:  1998-02-16       Impact factor: 11.598

5.  Dynamic regulation of cortical microtubule organization through prefoldin-DELLA interaction.

Authors:  Antonella Locascio; Miguel A Blázquez; David Alabadí
Journal:  Curr Biol       Date:  2013-04-11       Impact factor: 10.834

6.  Nested cooperativity in the ATPase activity of the oligomeric chaperonin GroEL.

Authors:  O Yifrach; A Horovitz
Journal:  Biochemistry       Date:  1995-04-25       Impact factor: 3.162

7.  Exploring systems affected by the heat shock response in Plasmodium falciparum via protein association networks.

Authors:  Timothy G Lilburn; Hong Cai; Jianying Gu; Zhan Zhou; Yufeng Wang
Journal:  Int J Comput Biol Drug Des       Date:  2014-12-25

Review 8.  Chaperones as integrators of cellular networks: changes of cellular integrity in stress and diseases.

Authors:  Robin Palotai; Máté S Szalay; Péter Csermely
Journal:  IUBMB Life       Date:  2008-01       Impact factor: 3.885

9.  Proteomic analysis of Plasmodium falciparum schizonts reveals heparin-binding merozoite proteins.

Authors:  Yan Zhang; Ning Jiang; Huijun Lu; Nan Hou; Xianyu Piao; Pengfei Cai; Jigang Yin; Mats Wahlgren; Qijun Chen
Journal:  J Proteome Res       Date:  2013-04-19       Impact factor: 4.466

10.  Phase 1 trial of the Plasmodium falciparum blood stage vaccine MSP1(42)-C1/Alhydrogel with and without CPG 7909 in malaria naïve adults.

Authors:  Ruth D Ellis; Laura B Martin; Donna Shaffer; Carole A Long; Kazutoyo Miura; Michael P Fay; David L Narum; Daming Zhu; Gregory E D Mullen; Siddhartha Mahanty; Louis H Miller; Anna P Durbin
Journal:  PLoS One       Date:  2010-01-22       Impact factor: 3.240

View more
  1 in total

Review 1.  Prefoldin Function in Cellular Protein Homeostasis and Human Diseases.

Authors:  Ismail Tahmaz; Somayeh Shahmoradi Ghahe; Ulrike Topf
Journal:  Front Cell Dev Biol       Date:  2022-01-17
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.